Starting /dee2/code/volunteer_pipeline.sh SRR24351042 current disk space = 3054923104256 free memory = 1499590256 SRR24351042 SRAfilesize 32f41634c20d98cb78e53493a8b733a2 SRR24351042.sra SRR24351042.sra file validated SRR24351042 is paired end SRR24351042 is conventional basespace SRR24351042 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR24351042_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1325 37.0 37.0 37.0 37.0 37.0 2 35.9745 37.0 37.0 37.0 37.0 37.0 3 36.1225 37.0 37.0 37.0 37.0 37.0 4 35.9445 37.0 37.0 37.0 37.0 37.0 5 36.212 37.0 37.0 37.0 37.0 37.0 6 36.09 37.0 37.0 37.0 37.0 37.0 7 36.0 37.0 37.0 37.0 37.0 37.0 8 36.0615 37.0 37.0 37.0 37.0 37.0 9 35.9435 37.0 37.0 37.0 37.0 37.0 10-14 35.9588 37.0 37.0 37.0 37.0 37.0 15-19 35.9246 37.0 37.0 37.0 37.0 37.0 20-24 35.908 37.0 37.0 37.0 37.0 37.0 25-29 35.8296 37.0 37.0 37.0 37.0 37.0 30-34 35.7525 37.0 37.0 37.0 37.0 37.0 35-39 35.7403 37.0 37.0 37.0 37.0 37.0 40-44 35.744299999999996 37.0 37.0 37.0 37.0 37.0 45-49 35.6946 37.0 37.0 37.0 37.0 37.0 50-54 35.662 37.0 37.0 37.0 37.0 37.0 55-59 35.5689 37.0 37.0 37.0 37.0 37.0 60-64 35.5515 37.0 37.0 37.0 37.0 37.0 65-69 35.5433 37.0 37.0 37.0 37.0 37.0 70-74 35.4543 37.0 37.0 37.0 37.0 37.0 75-79 35.3743 37.0 37.0 37.0 34.6 37.0 80-84 35.3043 37.0 37.0 37.0 34.6 37.0 85-89 35.2857 37.0 37.0 37.0 32.2 37.0 90-94 35.4691 37.0 37.0 37.0 37.0 37.0 95-99 35.18920000000001 37.0 37.0 37.0 29.8 37.0 100-104 35.2463 37.0 37.0 37.0 32.2 37.0 105-109 35.1171 37.0 37.0 37.0 27.4 37.0 110-114 35.049400000000006 37.0 37.0 37.0 25.0 37.0 115-119 35.169200000000004 37.0 37.0 37.0 27.4 37.0 120-124 35.113800000000005 37.0 37.0 37.0 27.4 37.0 125-129 34.856899999999996 37.0 37.0 37.0 25.0 37.0 130-134 34.9032 37.0 37.0 37.0 25.0 37.0 135-139 34.8718 37.0 37.0 37.0 25.0 37.0 140-144 34.7154 37.0 37.0 37.0 25.0 37.0 145-149 34.5774 37.0 37.0 37.0 25.0 37.0 150 34.745 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 1.0 21 0.0 22 2.0 23 3.0 24 5.0 25 8.0 26 12.0 27 18.0 28 28.0 29 38.0 30 84.0 31 97.0 32 171.0 33 218.0 34 312.0 35 603.0 36 2308.0 37 91.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.55 13.55 11.700000000000001 39.2 2 18.275 24.85 37.075 19.8 3 23.95 25.974999999999998 23.925 26.150000000000002 4 26.275 31.8 17.675 24.25 5 23.775 34.725 19.925 21.575 6 19.75 36.3 24.0 19.950000000000003 7 17.45 15.425 42.6 24.525 8 21.125 21.275 26.950000000000003 30.65 9 20.9 22.05 28.525 28.525 10-14 22.025 27.725 25.555 24.695 15-19 23.255 26.584999999999997 26.540000000000003 23.62 20-24 22.84 26.86 26.105 24.195 25-29 22.720000000000002 27.029999999999998 25.650000000000002 24.6 30-34 22.96 27.224999999999998 26.150000000000002 23.665 35-39 22.86 26.76 26.415 23.965 40-44 22.919999999999998 27.075 25.974999999999998 24.03 45-49 23.435 26.834999999999997 25.75 23.98 50-54 23.419999999999998 26.534999999999997 26.035000000000004 24.01 55-59 23.16 26.919999999999998 25.669999999999998 24.25 60-64 23.415 26.445 25.95 24.19 65-69 23.5 27.155 25.419999999999998 23.925 70-74 23.200000000000003 27.0 25.230000000000004 24.57 75-79 23.665 26.44 25.82 24.075 80-84 23.365 26.655 25.840000000000003 24.14 85-89 23.39 26.865 25.474999999999998 24.27 90-94 23.96 26.740000000000002 25.45 23.849999999999998 95-99 24.095 26.640000000000004 25.385 23.880000000000003 100-104 23.815 26.584999999999997 25.580000000000002 24.02 105-109 24.465 26.290000000000003 25.515 23.73 110-114 24.325 26.27 25.840000000000003 23.565 115-119 23.990000000000002 26.76 25.419999999999998 23.830000000000002 120-124 24.115000000000002 26.5 25.419999999999998 23.965 125-129 23.845 26.015 25.695 24.445 130-134 23.775 25.915 26.200000000000003 24.11 135-139 24.5 25.56 26.125 23.815 140-144 24.115000000000002 26.705000000000002 25.580000000000002 23.599999999999998 145-149 24.55 26.245 25.19 24.015 150 23.375 27.125 25.624999999999996 23.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 2.5 27 4.5 28 4.5 29 8.0 30 12.5 31 13.0 32 17.0 33 24.0 34 37.0 35 41.5 36 58.5 37 77.0 38 82.5 39 99.5 40 123.0 41 152.0 42 181.0 43 193.5 44 210.0 45 221.5 46 218.0 47 220.0 48 217.0 49 209.0 50 183.5 51 170.5 52 156.5 53 136.0 54 130.5 55 118.0 56 102.5 57 103.5 58 92.0 59 73.0 60 64.5 61 50.5 62 45.0 63 39.5 64 29.5 65 23.0 66 14.5 67 9.0 68 8.5 69 6.0 70 4.0 71 2.5 72 3.5 73 3.0 74 0.5 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.5 #Duplication Level Percentage of deduplicated Percentage of total 1 93.44919786096256 87.375 2 6.176470588235294 11.55 3 0.34759358288770054 0.975 4 0.026737967914438502 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.425 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.6125 0.0 0.0 0.0 0.0 104-105 0.7375 0.0 0.0 0.0 0.0 106-107 0.8125 0.0 0.0 0.0 0.0 108-109 0.875 0.0 0.0 0.0 0.0 110-111 0.9125000000000001 0.0 0.0 0.0 0.0 112-113 1.0 0.0 0.0 0.0 0.0 114-115 1.1375 0.0 0.0 0.0 0.0 116-117 1.275 0.0 0.0 0.0 0.0 118-119 1.5625 0.0 0.0 0.0 0.0 120-121 1.7125 0.0 0.0 0.0 0.0 122-123 1.825 0.0 0.0 0.0 0.0 124-125 2.125 0.0 0.0 0.0 0.0 126-127 2.2375 0.0 0.0 0.0 0.0 128-129 2.3875 0.0 0.0 0.0 0.0 130-131 2.6375 0.0 0.0 0.0 0.0 132-133 2.8 0.0 0.0 0.0 0.0 134-135 2.9875 0.0 0.0 0.0 0.0 136-137 3.05 0.0 0.0 0.0 0.0 138 3.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGACTG 10 0.006973645 144.0 8 >>END_MODULE SRR24351042 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR24351042_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.9835 37.0 37.0 37.0 25.0 37.0 2 34.6355 37.0 37.0 37.0 25.0 37.0 3 35.1065 37.0 37.0 37.0 25.0 37.0 4 35.344 37.0 37.0 37.0 37.0 37.0 5 35.118 37.0 37.0 37.0 25.0 37.0 6 35.3035 37.0 37.0 37.0 37.0 37.0 7 35.2105 37.0 37.0 37.0 25.0 37.0 8 35.134 37.0 37.0 37.0 25.0 37.0 9 35.0495 37.0 37.0 37.0 25.0 37.0 10-14 35.3491 37.0 37.0 37.0 34.6 37.0 15-19 35.2549 37.0 37.0 37.0 32.2 37.0 20-24 35.260000000000005 37.0 37.0 37.0 29.8 37.0 25-29 35.130199999999995 37.0 37.0 37.0 25.0 37.0 30-34 35.116 37.0 37.0 37.0 29.8 37.0 35-39 35.170100000000005 37.0 37.0 37.0 27.4 37.0 40-44 35.0335 37.0 37.0 37.0 27.4 37.0 45-49 35.0823 37.0 37.0 37.0 27.4 37.0 50-54 35.079100000000004 37.0 37.0 37.0 25.0 37.0 55-59 34.9296 37.0 37.0 37.0 25.0 37.0 60-64 34.8326 37.0 37.0 37.0 25.0 37.0 65-69 34.9009 37.0 37.0 37.0 25.0 37.0 70-74 34.771699999999996 37.0 37.0 37.0 25.0 37.0 75-79 34.849900000000005 37.0 37.0 37.0 25.0 37.0 80-84 34.77890000000001 37.0 37.0 37.0 25.0 37.0 85-89 34.7451 37.0 37.0 37.0 25.0 37.0 90-94 34.7446 37.0 37.0 37.0 25.0 37.0 95-99 34.6383 37.0 37.0 37.0 25.0 37.0 100-104 34.6421 37.0 37.0 37.0 25.0 37.0 105-109 34.469699999999996 37.0 37.0 37.0 25.0 37.0 110-114 34.604299999999995 37.0 37.0 37.0 25.0 37.0 115-119 34.491400000000006 37.0 37.0 37.0 25.0 37.0 120-124 34.41369999999999 37.0 37.0 37.0 25.0 37.0 125-129 34.1756 37.0 37.0 37.0 25.0 37.0 130-134 34.2282 37.0 37.0 37.0 25.0 37.0 135-139 34.0848 37.0 37.0 37.0 25.0 37.0 140-144 33.9116 37.0 37.0 37.0 25.0 37.0 145-149 33.948 37.0 37.0 37.0 25.0 37.0 150 33.9925 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 4.0 22 5.0 23 5.0 24 10.0 25 12.0 26 30.0 27 35.0 28 53.0 29 89.0 30 106.0 31 147.0 32 193.0 33 268.0 34 447.0 35 1016.0 36 1534.0 37 42.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.849999999999994 14.224999999999998 12.55 38.375 2 18.725 26.625 34.725 19.925 3 24.3 27.35 23.0 25.35 4 26.950000000000003 31.0 19.475 22.575 5 23.849999999999998 35.325 21.7 19.125 6 19.5 36.3 22.575 21.625 7 17.724999999999998 16.25 42.175000000000004 23.849999999999998 8 21.4 21.025 27.3 30.275000000000002 9 22.425 22.475 28.925 26.174999999999997 10-14 22.585 28.144999999999996 25.290000000000003 23.98 15-19 23.189999999999998 25.919999999999998 26.825 24.065 20-24 23.05 27.229999999999997 25.71 24.01 25-29 22.355 27.700000000000003 25.580000000000002 24.365000000000002 30-34 22.42 27.474999999999998 25.7 24.404999999999998 35-39 23.26 27.115000000000002 25.465 24.16 40-44 23.41 27.205000000000002 25.480000000000004 23.905 45-49 22.715 27.485 25.96 23.84 50-54 23.04 26.979999999999997 25.69 24.29 55-59 23.494999999999997 26.465 25.715 24.325 60-64 23.325000000000003 26.91 25.545 24.22 65-69 23.815 26.834999999999997 25.555 23.794999999999998 70-74 23.335 26.795 25.97 23.9 75-79 23.155 27.055 26.005 23.785 80-84 23.66 26.810000000000002 25.305 24.224999999999998 85-89 23.535 26.424999999999997 26.22 23.82 90-94 23.525 25.905 25.974999999999998 24.595 95-99 23.54 26.490000000000002 26.125 23.845 100-104 23.665 26.3 26.115 23.919999999999998 105-109 23.849999999999998 26.35 25.945 23.855 110-114 23.849999999999998 26.22 26.405 23.525 115-119 24.55 26.465 25.380000000000003 23.605 120-124 24.355 26.25 25.88 23.515 125-129 24.315 26.21 25.39 24.085 130-134 24.22 26.595000000000002 25.905 23.28 135-139 24.425 26.005 26.179999999999996 23.39 140-144 25.419999999999998 26.424999999999997 25.16 22.994999999999997 145-149 25.05 26.169999999999998 25.485000000000003 23.294999999999998 150 24.2 26.0 25.624999999999996 24.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 0.5 23 0.5 24 2.0 25 2.0 26 1.0 27 2.0 28 3.5 29 6.5 30 9.5 31 16.0 32 28.0 33 34.0 34 43.0 35 58.5 36 63.0 37 66.5 38 88.5 39 120.0 40 142.0 41 167.0 42 190.0 43 183.5 44 188.0 45 199.0 46 196.0 47 192.0 48 185.5 49 179.5 50 182.5 51 180.5 52 161.0 53 151.0 54 135.0 55 116.0 56 114.5 57 109.5 58 101.0 59 82.0 60 65.5 61 62.0 62 45.5 63 28.5 64 19.5 65 18.0 66 16.0 67 11.5 68 7.5 69 4.5 70 4.5 71 3.0 72 1.5 73 1.5 74 1.0 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.1 #Duplication Level Percentage of deduplicated Percentage of total 1 94.04888416578109 88.5 2 5.63230605738576 10.6 3 0.3188097768331562 0.8999999999999999 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.5625 0.0 0.0 0.0 0.0 102-103 0.6625 0.0 0.0 0.0 0.0 104-105 0.7875000000000001 0.0 0.0 0.0 0.0 106-107 0.8625 0.0 0.0 0.0 0.0 108-109 0.9375 0.0 0.0 0.0 0.0 110-111 1.0125 0.0 0.0 0.0 0.0 112-113 1.1375 0.0 0.0 0.0 0.0 114-115 1.2999999999999998 0.0 0.0 0.0 0.0 116-117 1.4249999999999998 0.0 0.0 0.0 0.0 118-119 1.725 0.0 0.0 0.0 0.0 120-121 1.8875 0.0 0.0 0.0 0.0 122-123 2.0 0.0 0.0 0.0 0.0 124-125 2.275 0.0 0.0 0.0 0.0 126-127 2.4125 0.0 0.0 0.0 0.0 128-129 2.5625 0.0 0.0 0.0 0.0 130-131 2.8 0.0 0.0 0.0 0.0 132-133 2.9749999999999996 0.0 0.0 0.0 0.0 134-135 3.1625 0.0 0.0 0.0 0.0 136-137 3.25 0.0 0.0 0.0 0.0 138 3.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGCACA 10 0.006973645 144.0 8 >>END_MODULE Read 1172340 spots for SRR24351042.sra Written 1172340 spots for SRR24351042.sra Read 1172340 spots for SRR24351042.sra Written 1172340 spots for SRR24351042.sra Read 1172340 spots for SRR24351042.sra Written 1172340 spots for SRR24351042.sra Read 1172340 spots for SRR24351042.sra Written 1172340 spots for SRR24351042.sra Read 1172340 spots for SRR24351042.sra Written 1172340 spots for SRR24351042.sra Read 1172340 spots for SRR24351042.sra Written 1172340 spots for SRR24351042.sra Read 1172340 spots for SRR24351042.sra Written 1172340 spots for SRR24351042.sra Read 1172340 spots for SRR24351042.sra Written 1172340 spots for SRR24351042.sra Read 1172340 spots for SRR24351042.sra Written 1172340 spots for SRR24351042.sra Read 1172340 spots for SRR24351042.sra Written 1172340 spots for SRR24351042.sra Read 1172340 spots for SRR24351042.sra Written 1172340 spots for SRR24351042.sra Read 1172340 spots for SRR24351042.sra Written 1172340 spots for SRR24351042.sra Read 1172340 spots for SRR24351042.sra Written 1172340 spots for SRR24351042.sra Read 1172340 spots for SRR24351042.sra Written 1172340 spots for SRR24351042.sra Read 1172340 spots for SRR24351042.sra Written 1172340 spots for SRR24351042.sra Read 1172340 spots for SRR24351042.sra Written 1172340 spots for SRR24351042.sra Read 1172340 spots for SRR24351042.sra Written 1172340 spots for SRR24351042.sra Read 1172340 spots for SRR24351042.sra Written 1172340 spots for SRR24351042.sra Read 1172356 spots for SRR24351042.sra Written 1172356 spots for SRR24351042.sra Read 1172340 spots for SRR24351042.sra Written 1172340 spots for SRR24351042.sra SRR ids: ['SRR24351042.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z01b58ca SRR24351042.sra spots: 23446816 blocks: [[1, 1172340], [1172341, 2344680], [2344681, 3517020], [3517021, 4689360], [4689361, 5861700], [5861701, 7034040], [7034041, 8206380], [8206381, 9378720], [9378721, 10551060], [10551061, 11723400], [11723401, 12895740], [12895741, 14068080], [14068081, 15240420], [15240421, 16412760], [16412761, 17585100], [17585101, 18757440], [18757441, 19929780], [19929781, 21102120], [21102121, 22274460], [22274461, 23446816]] SRR24351042 file size 7900758 SRR24351042 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR24351042 SRR24351042_1.fastq SRR24351042_2.fastq Input file: SRR24351042_1.fastq Paired file: SRR24351042_2.fastq trimmed: SRR24351042-trimmed-pair1.fastq, SRR24351042-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 07:29:54 2025 >> started Tue Feb 11 07:33:34 2025 >> done (219.798s) 23446816 read pairs processed; of these: 42 ( 0.00%) short read pairs filtered out after trimming by size control 774 ( 0.00%) empty read pairs filtered out after trimming by size control 23446000 (100.00%) read pairs available; of these: 965623 ( 4.12%) trimmed read pairs available after processing 22480377 (95.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 6 0.00% 20 8 0.00% 21 8 0.00% 22 6 0.00% 23 19 0.00% 24 18 0.00% 25 21 0.00% 26 16 0.00% 27 26 0.00% 28 27 0.00% 29 24 0.00% 30 29 0.00% 31 49 0.00% 32 54 0.00% 33 39 0.00% 34 58 0.00% 35 50 0.00% 36 61 0.00% 37 76 0.00% 38 83 0.00% 39 85 0.00% 40 100 0.00% 41 102 0.00% 42 123 0.00% 43 104 0.00% 44 123 0.00% 45 136 0.00% 46 140 0.00% 47 197 0.00% 48 136 0.00% 49 187 0.00% 50 254 0.00% 51 231 0.00% 52 231 0.00% 53 281 0.00% 54 263 0.00% 55 334 0.00% 56 277 0.00% 57 305 0.00% 58 321 0.00% 59 381 0.00% 60 438 0.00% 61 447 0.00% 62 549 0.00% 63 559 0.00% 64 561 0.00% 65 607 0.00% 66 661 0.00% 67 636 0.00% 68 728 0.00% 69 730 0.00% 70 912 0.00% 71 986 0.00% 72 1130 0.00% 73 1245 0.01% 74 1252 0.01% 75 1241 0.01% 76 1299 0.01% 77 1356 0.01% 78 1605 0.01% 79 1701 0.01% 80 1936 0.01% 81 2185 0.01% 82 2470 0.01% 83 2646 0.01% 84 2762 0.01% 85 2877 0.01% 86 3041 0.01% 87 3182 0.01% 88 3536 0.02% 89 3835 0.02% 90 4218 0.02% 91 4474 0.02% 92 4780 0.02% 93 5309 0.02% 94 5733 0.02% 95 5966 0.03% 96 6137 0.03% 97 6395 0.03% 98 6676 0.03% 99 7049 0.03% 100 7617 0.03% 101 8125 0.03% 102 8717 0.04% 103 9345 0.04% 104 9648 0.04% 105 9968 0.04% 106 10368 0.04% 107 10525 0.04% 108 10918 0.05% 109 11035 0.05% 110 11918 0.05% 111 12331 0.05% 112 13262 0.06% 113 13748 0.06% 114 13919 0.06% 115 14448 0.06% 116 14723 0.06% 117 14708 0.06% 118 14972 0.06% 119 15128 0.06% 120 15678 0.07% 121 16221 0.07% 122 16863 0.07% 123 17438 0.07% 124 17658 0.08% 125 17987 0.08% 126 17958 0.08% 127 18114 0.08% 128 18541 0.08% 129 18480 0.08% 130 19105 0.08% 131 19496 0.08% 132 19802 0.08% 133 20563 0.09% 134 21116 0.09% 135 21301 0.09% 136 21072 0.09% 137 21400 0.09% 138 21542 0.09% 139 21862 0.09% 140 22078 0.09% 141 22301 0.10% 142 23380 0.10% 143 23601 0.10% 144 23988 0.10% 145 24406 0.10% 146 24483 0.10% 147 24788 0.11% 148 24916 0.11% 149 25217 0.11% 150 22480377 95.88% 23446000 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.83 fanout-score-rank=18 prefix-density=0.67 prefix-fanout=2.5 sequence=CAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAAGTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTACCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAG criterion=fanout-score sequence-density=0.06 sequence-density-rank=34 fanout-score=59.50 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=13.1 sequence=AAGGCCAAGATCCAGGACAAGGA criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.82 fanout-score-rank=21 prefix-density=0.70 prefix-fanout=2.5 sequence=CAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAAGTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTACCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTG criterion=fanout-score sequence-density=0.05 sequence-density-rank=34 fanout-score=68.24 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=13.5 sequence=AAGGCCAAGATCCAGGACAAGGA SRR24351042 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 07:35:14 Started mapping on | Feb 11 07:35:14 Finished on | Feb 11 07:51:27 Mapping speed, Million of reads per hour | 86.75 Number of input reads | 23446000 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 15498610 Uniquely mapped reads % | 66.10% Average mapped length | 293.41 Number of splices: Total | 15285929 Number of splices: Annotated (sjdb) | 14937964 Number of splices: GT/AG | 14964548 Number of splices: GC/AG | 235867 Number of splices: AT/AC | 11016 Number of splices: Non-canonical | 74498 Mismatch rate per base, % | 1.36% Deletion rate per base | 0.08% Deletion average length | 3.19 Insertion rate per base | 0.05% Insertion average length | 2.79 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 700065 % of reads mapped to multiple loci | 2.99% Number of reads mapped to too many loci | 73021 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 30.30% % of reads unmapped: other | 0.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 7247325 7247325 7247325 N_multimapping 700065 700065 700065 N_noFeature 298527 7778168 7767959 N_ambiguous 373448 61226 61608 UnstrandedReadsAssigned:14826635 PositiveStrandReadsAssigned:7659216 NegativeStrandReadsAssigned:7669043 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR24351042 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR24351042-trimmed-pair1.fastq SRR24351042-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,446,000 reads, 14,519,660 reads pseudoaligned [quant] estimated average fragment length: 259.309 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,082 rounds 52401 SRR24351042.ke.tsv 34699 SRR24351042.se.tsv 87100 total ==> SRR24351042.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.69 737 19.7607 Potri.005G024800.1.v4.1 1035 776.691 936 56.8588 Potri.004G059700.1.v4.1 961 702.698 3 0.201429 Potri.007G009000.2.v4.1 1416 1157.69 0 0 Potri.003G141000.2.v4.1 2943 2684.69 273 4.79776 Potri.016G087400.1.v4.1 270 63.9002 1183.98 874.2 Potri.015G069301.1.v4.1 564 305.823 0 0 Potri.010G195200.1.v4.1 1773 1514.69 86 2.67883 Potri.012G127500.1.v4.1 977 718.691 576 37.8138 ==> SRR24351042.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 86 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 148 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 19 SRR24351042 completed mapping pipeline successfully