Starting /dee2/code/volunteer_pipeline.sh SRR24351043 current disk space = 3055071588352 free memory = 1365877832 SRR24351043 SRAfilesize b8df480a216f8cf579ce3083b8302e4f SRR24351043.sra SRR24351043.sra file validated SRR24351043 is paired end SRR24351043 is conventional basespace SRR24351043 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR24351043_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1155 37.0 37.0 37.0 37.0 37.0 2 36.154 37.0 37.0 37.0 37.0 37.0 3 36.113 37.0 37.0 37.0 37.0 37.0 4 36.1955 37.0 37.0 37.0 37.0 37.0 5 36.1985 37.0 37.0 37.0 37.0 37.0 6 35.9155 37.0 37.0 37.0 37.0 37.0 7 35.969 37.0 37.0 37.0 37.0 37.0 8 36.098 37.0 37.0 37.0 37.0 37.0 9 36.047 37.0 37.0 37.0 37.0 37.0 10-14 36.0209 37.0 37.0 37.0 37.0 37.0 15-19 36.0105 37.0 37.0 37.0 37.0 37.0 20-24 35.9776 37.0 37.0 37.0 37.0 37.0 25-29 35.849399999999996 37.0 37.0 37.0 37.0 37.0 30-34 35.8051 37.0 37.0 37.0 37.0 37.0 35-39 35.762 37.0 37.0 37.0 37.0 37.0 40-44 35.804700000000004 37.0 37.0 37.0 37.0 37.0 45-49 35.705400000000004 37.0 37.0 37.0 37.0 37.0 50-54 35.6837 37.0 37.0 37.0 37.0 37.0 55-59 35.626000000000005 37.0 37.0 37.0 37.0 37.0 60-64 35.5992 37.0 37.0 37.0 37.0 37.0 65-69 35.616200000000006 37.0 37.0 37.0 37.0 37.0 70-74 35.523799999999994 37.0 37.0 37.0 37.0 37.0 75-79 35.339800000000004 37.0 37.0 37.0 34.6 37.0 80-84 35.320899999999995 37.0 37.0 37.0 34.6 37.0 85-89 35.2783 37.0 37.0 37.0 29.8 37.0 90-94 35.345 37.0 37.0 37.0 37.0 37.0 95-99 35.1483 37.0 37.0 37.0 29.8 37.0 100-104 35.28789999999999 37.0 37.0 37.0 32.2 37.0 105-109 35.205400000000004 37.0 37.0 37.0 27.4 37.0 110-114 35.1314 37.0 37.0 37.0 25.0 37.0 115-119 35.1531 37.0 37.0 37.0 25.0 37.0 120-124 35.0741 37.0 37.0 37.0 27.4 37.0 125-129 34.851 37.0 37.0 37.0 25.0 37.0 130-134 34.940799999999996 37.0 37.0 37.0 25.0 37.0 135-139 34.9011 37.0 37.0 37.0 25.0 37.0 140-144 34.778800000000004 37.0 37.0 37.0 25.0 37.0 145-149 34.62 37.0 37.0 37.0 25.0 37.0 150 34.5175 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 1.0 19 0.0 20 1.0 21 4.0 22 5.0 23 4.0 24 5.0 25 7.0 26 8.0 27 15.0 28 26.0 29 43.0 30 59.0 31 102.0 32 148.0 33 237.0 34 302.0 35 615.0 36 2324.0 37 93.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.125 13.575000000000001 13.600000000000001 37.7 2 16.75 25.95 37.05 20.25 3 21.75 27.800000000000004 26.125 24.325 4 24.55 33.475 18.275 23.7 5 22.925 35.5 22.55 19.025 6 18.25 36.825 24.775 20.150000000000002 7 16.975 16.400000000000002 41.9 24.725 8 19.35 22.45 28.025 30.175 9 20.65 23.400000000000002 30.025000000000002 25.924999999999997 10-14 22.040000000000003 29.025000000000002 25.979999999999997 22.955000000000002 15-19 22.165000000000003 27.755000000000003 27.089999999999996 22.99 20-24 22.28 27.865000000000002 26.745 23.11 25-29 22.58 27.189999999999998 27.439999999999998 22.79 30-34 22.075 28.03 26.534999999999997 23.36 35-39 22.37 27.560000000000002 26.915 23.155 40-44 22.759999999999998 27.575 26.640000000000004 23.025000000000002 45-49 21.925 27.565 27.065 23.445 50-54 22.78 27.505000000000003 26.665 23.05 55-59 22.46 27.1 26.805 23.635 60-64 22.675 27.625 26.245 23.455000000000002 65-69 22.725 27.515 26.19 23.57 70-74 22.8 27.13 27.060000000000002 23.01 75-79 22.869999999999997 26.97 26.32 23.84 80-84 22.220000000000002 27.279999999999998 26.979999999999997 23.52 85-89 22.41 27.04 27.16 23.39 90-94 22.365 27.61 26.685 23.34 95-99 22.895 27.325 26.575 23.205000000000002 100-104 23.375 27.22 26.305 23.1 105-109 22.745 27.49 26.445 23.32 110-114 23.815 27.1 26.029999999999998 23.055 115-119 23.16 27.310000000000002 26.865 22.665 120-124 22.31 27.155 27.045 23.49 125-129 22.875 27.49 26.71 22.925 130-134 23.880000000000003 27.3 26.565 22.255 135-139 23.44 27.24 26.525 22.795 140-144 23.125 27.405 26.790000000000003 22.68 145-149 23.155 26.979999999999997 27.415 22.45 150 23.65 27.150000000000002 25.324999999999996 23.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.5 26 3.5 27 4.5 28 5.0 29 9.0 30 13.0 31 12.0 32 16.5 33 29.5 34 43.0 35 54.0 36 74.5 37 91.5 38 109.0 39 139.5 40 165.0 41 188.5 42 207.5 43 227.0 44 246.5 45 250.5 46 244.0 47 238.0 48 218.5 49 206.5 50 185.5 51 162.0 52 147.0 53 125.5 54 100.5 55 84.0 56 78.5 57 62.5 58 56.0 59 49.5 60 38.0 61 24.0 62 19.0 63 15.0 64 13.5 65 15.5 66 8.0 67 3.0 68 2.5 69 3.0 70 2.0 71 1.0 72 0.5 73 0.0 74 0.5 75 1.5 76 2.5 77 1.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.475 #Duplication Level Percentage of deduplicated Percentage of total 1 92.2411462557448 85.3 2 7.4074074074074066 13.700000000000001 3 0.32441200324412006 0.8999999999999999 4 0.027034333603676672 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.875 0.0 0.0 0.0 0.0 110-111 0.9375 0.0 0.0 0.0 0.0 112-113 1.0625 0.0 0.0 0.0 0.0 114-115 1.2125 0.0 0.0 0.0 0.0 116-117 1.275 0.0 0.0 0.0 0.0 118-119 1.3 0.0 0.0 0.0 0.0 120-121 1.3875000000000002 0.0 0.0 0.0 0.0 122-123 1.4500000000000002 0.0 0.0 0.0 0.0 124-125 1.5125000000000002 0.0 0.0 0.0 0.0 126-127 1.625 0.0 0.0 0.0 0.0 128-129 1.7375 0.0 0.0 0.0 0.0 130-131 1.8125 0.0 0.0 0.0 0.0 132-133 2.0125 0.0 0.0 0.0 0.0 134-135 2.1625 0.0 0.0 0.0 0.0 136-137 2.4375 0.0 0.0 0.0 0.0 138 2.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTACAG 10 0.006973645 144.0 7 >>END_MODULE SRR24351043 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR24351043_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.022 37.0 37.0 37.0 25.0 37.0 2 34.692 37.0 37.0 37.0 25.0 37.0 3 35.188 37.0 37.0 37.0 25.0 37.0 4 35.3875 37.0 37.0 37.0 37.0 37.0 5 35.3075 37.0 37.0 37.0 37.0 37.0 6 35.4625 37.0 37.0 37.0 37.0 37.0 7 35.2305 37.0 37.0 37.0 37.0 37.0 8 35.008 37.0 37.0 37.0 25.0 37.0 9 35.1305 37.0 37.0 37.0 25.0 37.0 10-14 35.4401 37.0 37.0 37.0 37.0 37.0 15-19 35.300799999999995 37.0 37.0 37.0 32.2 37.0 20-24 35.2749 37.0 37.0 37.0 29.8 37.0 25-29 35.301199999999994 37.0 37.0 37.0 32.2 37.0 30-34 35.3115 37.0 37.0 37.0 34.6 37.0 35-39 35.247299999999996 37.0 37.0 37.0 32.2 37.0 40-44 35.097899999999996 37.0 37.0 37.0 27.4 37.0 45-49 35.173899999999996 37.0 37.0 37.0 27.4 37.0 50-54 35.2007 37.0 37.0 37.0 27.4 37.0 55-59 35.0218 37.0 37.0 37.0 25.0 37.0 60-64 35.0403 37.0 37.0 37.0 29.8 37.0 65-69 35.0399 37.0 37.0 37.0 25.0 37.0 70-74 34.8466 37.0 37.0 37.0 25.0 37.0 75-79 34.9222 37.0 37.0 37.0 25.0 37.0 80-84 34.8256 37.0 37.0 37.0 25.0 37.0 85-89 34.7429 37.0 37.0 37.0 25.0 37.0 90-94 34.804700000000004 37.0 37.0 37.0 25.0 37.0 95-99 34.762499999999996 37.0 37.0 37.0 25.0 37.0 100-104 34.710699999999996 37.0 37.0 37.0 25.0 37.0 105-109 34.6063 37.0 37.0 37.0 25.0 37.0 110-114 34.6657 37.0 37.0 37.0 25.0 37.0 115-119 34.525400000000005 37.0 37.0 37.0 25.0 37.0 120-124 34.4562 37.0 37.0 37.0 25.0 37.0 125-129 34.3543 37.0 37.0 37.0 25.0 37.0 130-134 34.3301 37.0 37.0 37.0 25.0 37.0 135-139 34.1207 37.0 37.0 37.0 25.0 37.0 140-144 33.9858 37.0 37.0 37.0 25.0 37.0 145-149 33.8637 37.0 37.0 37.0 25.0 37.0 150 34.178 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 4.0 22 7.0 23 10.0 24 14.0 25 14.0 26 23.0 27 27.0 28 50.0 29 61.0 30 119.0 31 133.0 32 195.0 33 261.0 34 409.0 35 990.0 36 1634.0 37 48.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.15 14.499999999999998 12.7 39.65 2 17.925 25.3 37.25 19.525000000000002 3 20.95 28.95 24.175 25.924999999999997 4 25.650000000000002 33.074999999999996 18.875 22.400000000000002 5 22.675 34.65 24.0 18.675 6 18.7 35.8 25.525 19.975 7 17.025000000000002 16.85 42.425000000000004 23.7 8 18.099999999999998 22.1 28.475 31.324999999999996 9 19.75 24.55 29.325000000000003 26.375 10-14 21.825 29.03 25.629999999999995 23.515 15-19 22.264999999999997 27.700000000000003 27.26 22.775000000000002 20-24 22.225 27.485 26.895000000000003 23.395 25-29 21.95 27.450000000000003 27.325 23.275000000000002 30-34 21.435000000000002 28.185 27.584999999999997 22.795 35-39 22.125 28.349999999999998 26.455000000000002 23.07 40-44 21.75 28.095 26.650000000000002 23.505000000000003 45-49 22.205 27.68 26.950000000000003 23.165 50-54 22.625 28.065 26.405 22.905 55-59 22.075 27.955000000000002 26.865 23.105 60-64 21.97 27.97 26.724999999999998 23.335 65-69 22.355 28.225 26.540000000000003 22.88 70-74 22.375 28.585 26.26 22.78 75-79 23.13 27.589999999999996 26.724999999999998 22.555 80-84 22.3 27.515 26.61 23.575 85-89 22.34 27.47 27.065 23.125 90-94 22.55 27.57 26.965 22.915 95-99 22.68 27.365000000000002 26.82 23.135 100-104 23.075000000000003 26.96 27.195000000000004 22.770000000000003 105-109 22.865 27.76 26.474999999999998 22.900000000000002 110-114 23.085 27.675 26.655 22.585 115-119 23.09 26.97 26.63 23.31 120-124 23.165 26.96 26.395000000000003 23.48 125-129 22.855 27.04 26.745 23.36 130-134 23.919999999999998 27.439999999999998 25.825 22.814999999999998 135-139 23.435 26.805 27.055 22.705000000000002 140-144 23.335 27.529999999999998 26.21 22.925 145-149 23.74 27.16 26.565 22.535 150 23.674999999999997 27.500000000000004 26.875 21.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.5 20 0.5 21 0.0 22 1.5 23 3.5 24 6.0 25 7.0 26 5.0 27 4.0 28 5.5 29 9.5 30 14.0 31 22.5 32 32.0 33 38.5 34 48.5 35 63.5 36 75.0 37 88.0 38 106.5 39 126.0 40 161.0 41 191.0 42 212.0 43 225.5 44 241.5 45 262.0 46 242.5 47 218.5 48 231.0 49 219.5 50 170.5 51 147.5 52 140.5 53 116.0 54 106.0 55 92.5 56 68.0 57 61.5 58 50.5 59 35.0 60 29.0 61 27.0 62 25.0 63 19.5 64 11.5 65 8.5 66 6.5 67 5.0 68 3.0 69 3.5 70 2.5 71 0.5 72 2.0 73 1.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.075 #Duplication Level Percentage of deduplicated Percentage of total 1 92.93580445876981 86.5 2 6.7150147730325 12.5 3 0.32232070910556004 0.8999999999999999 4 0.026860059092130004 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.6375 0.0 0.0 0.0 0.0 108-109 0.825 0.0 0.0 0.0 0.0 110-111 0.8875 0.0 0.0 0.0 0.0 112-113 0.9750000000000001 0.0 0.0 0.0 0.0 114-115 1.1125 0.0 0.0 0.0 0.0 116-117 1.15 0.0 0.0 0.0 0.0 118-119 1.175 0.0 0.0 0.0 0.0 120-121 1.275 0.0 0.0 0.0 0.0 122-123 1.35 0.0 0.0 0.0 0.0 124-125 1.4125 0.0 0.0 0.0 0.0 126-127 1.525 0.0 0.0 0.0 0.0 128-129 1.6625 0.0 0.0 0.0 0.0 130-131 1.7374999999999998 0.0 0.0 0.0 0.0 132-133 1.9625 0.0 0.0 0.0 0.0 134-135 2.0875 0.0 0.0 0.0 0.0 136-137 2.3375 0.0 0.0 0.0 0.0 138 2.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTGGAA 10 0.006973645 144.0 6 GGATTGG 10 0.006973645 144.0 4 GGGATTG 10 0.006973645 144.0 3 >>END_MODULE Read 1101435 spots for SRR24351043.sra Written 1101435 spots for SRR24351043.sra Read 1101435 spots for SRR24351043.sra Written 1101435 spots for SRR24351043.sra Read 1101435 spots for SRR24351043.sra Written 1101435 spots for SRR24351043.sra Read 1101435 spots for SRR24351043.sra Written 1101435 spots for SRR24351043.sra Read 1101435 spots for SRR24351043.sra Written 1101435 spots for SRR24351043.sra Read 1101435 spots for SRR24351043.sra Written 1101435 spots for SRR24351043.sra Read 1101435 spots for SRR24351043.sra Written 1101435 spots for SRR24351043.sra Read 1101435 spots for SRR24351043.sra Written 1101435 spots for SRR24351043.sra Read 1101435 spots for SRR24351043.sra Written 1101435 spots for SRR24351043.sra Read 1101435 spots for SRR24351043.sra Written 1101435 spots for SRR24351043.sra Read 1101435 spots for SRR24351043.sra Written 1101435 spots for SRR24351043.sra Read 1101435 spots for SRR24351043.sra Written 1101435 spots for SRR24351043.sra Read 1101435 spots for SRR24351043.sra Written 1101435 spots for SRR24351043.sra Read 1101435 spots for SRR24351043.sra Written 1101435 spots for SRR24351043.sra Read 1101435 spots for SRR24351043.sra Written 1101435 spots for SRR24351043.sra Read 1101435 spots for SRR24351043.sra Written 1101435 spots for SRR24351043.sra Read 1101435 spots for SRR24351043.sra Written 1101435 spots for SRR24351043.sra Read 1101435 spots for SRR24351043.sra Written 1101435 spots for SRR24351043.sra Read 1101435 spots for SRR24351043.sra Written 1101435 spots for SRR24351043.sra Read 1101453 spots for SRR24351043.sra Written 1101453 spots for SRR24351043.sra SRR ids: ['SRR24351043.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_419kx7eo SRR24351043.sra spots: 22028718 blocks: [[1, 1101435], [1101436, 2202870], [2202871, 3304305], [3304306, 4405740], [4405741, 5507175], [5507176, 6608610], [6608611, 7710045], [7710046, 8811480], [8811481, 9912915], [9912916, 11014350], [11014351, 12115785], [12115786, 13217220], [13217221, 14318655], [14318656, 15420090], [15420091, 16521525], [16521526, 17622960], [17622961, 18724395], [18724396, 19825830], [19825831, 20927265], [20927266, 22028718]] SRR24351043 file size 7421596 SRR24351043 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR24351043 SRR24351043_1.fastq SRR24351043_2.fastq Input file: SRR24351043_1.fastq Paired file: SRR24351043_2.fastq trimmed: SRR24351043-trimmed-pair1.fastq, SRR24351043-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 07:33:56 2025 >> started Tue Feb 11 07:34:31 2025 >> done (35.193s) 22028718 read pairs processed; of these: 35 ( 0.00%) short read pairs filtered out after trimming by size control 876 ( 0.00%) empty read pairs filtered out after trimming by size control 22027807 (100.00%) read pairs available; of these: 893509 ( 4.06%) trimmed read pairs available after processing 21134298 (95.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 9 0.00% 20 5 0.00% 21 9 0.00% 22 15 0.00% 23 12 0.00% 24 13 0.00% 25 18 0.00% 26 18 0.00% 27 17 0.00% 28 20 0.00% 29 38 0.00% 30 21 0.00% 31 31 0.00% 32 37 0.00% 33 46 0.00% 34 40 0.00% 35 46 0.00% 36 59 0.00% 37 71 0.00% 38 50 0.00% 39 74 0.00% 40 78 0.00% 41 81 0.00% 42 81 0.00% 43 107 0.00% 44 106 0.00% 45 105 0.00% 46 119 0.00% 47 113 0.00% 48 129 0.00% 49 152 0.00% 50 181 0.00% 51 209 0.00% 52 211 0.00% 53 207 0.00% 54 215 0.00% 55 225 0.00% 56 244 0.00% 57 220 0.00% 58 304 0.00% 59 303 0.00% 60 351 0.00% 61 354 0.00% 62 454 0.00% 63 473 0.00% 64 460 0.00% 65 443 0.00% 66 485 0.00% 67 591 0.00% 68 673 0.00% 69 648 0.00% 70 738 0.00% 71 879 0.00% 72 991 0.00% 73 1053 0.00% 74 1082 0.00% 75 1020 0.00% 76 1113 0.01% 77 1318 0.01% 78 1411 0.01% 79 1620 0.01% 80 1641 0.01% 81 1872 0.01% 82 2203 0.01% 83 2360 0.01% 84 2469 0.01% 85 2493 0.01% 86 2609 0.01% 87 2828 0.01% 88 3000 0.01% 89 3363 0.02% 90 3832 0.02% 91 3980 0.02% 92 4442 0.02% 93 4921 0.02% 94 5256 0.02% 95 5416 0.02% 96 5627 0.03% 97 5861 0.03% 98 6354 0.03% 99 6562 0.03% 100 6908 0.03% 101 7462 0.03% 102 8052 0.04% 103 8697 0.04% 104 9090 0.04% 105 9227 0.04% 106 9536 0.04% 107 9703 0.04% 108 10052 0.05% 109 10484 0.05% 110 10769 0.05% 111 11514 0.05% 112 12079 0.05% 113 12518 0.06% 114 13103 0.06% 115 13208 0.06% 116 13355 0.06% 117 13761 0.06% 118 13767 0.06% 119 14263 0.06% 120 14455 0.07% 121 15089 0.07% 122 15255 0.07% 123 16197 0.07% 124 16390 0.07% 125 16980 0.08% 126 17026 0.08% 127 17269 0.08% 128 17160 0.08% 129 17459 0.08% 130 17583 0.08% 131 17856 0.08% 132 18545 0.08% 133 18988 0.09% 134 19215 0.09% 135 19568 0.09% 136 19660 0.09% 137 20087 0.09% 138 20056 0.09% 139 20299 0.09% 140 20563 0.09% 141 21022 0.10% 142 21474 0.10% 143 22119 0.10% 144 22085 0.10% 145 23342 0.11% 146 23081 0.10% 147 22895 0.10% 148 23403 0.11% 149 23551 0.11% 150 21134298 95.94% 22027807 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.75 fanout-score-rank=23 prefix-density=0.36 prefix-fanout=2.5 sequence=CAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAAGTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTACCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAG criterion=fanout-score sequence-density=0.07 sequence-density-rank=19 fanout-score=31.08 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=10.6 sequence=AAGGCCAAGATCCAGGACAAGGA criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.71 fanout-score-rank=22 prefix-density=0.38 prefix-fanout=2.4 sequence=CAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAAGTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTACCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACA criterion=fanout-score sequence-density=0.02 sequence-density-rank=38 fanout-score=40.58 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=9.0 sequence=AAAAAAAATCTAAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTTGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCC SRR24351043 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 07:35:41 Started mapping on | Feb 11 07:35:41 Finished on | Feb 11 07:43:47 Mapping speed, Million of reads per hour | 163.17 Number of input reads | 22027807 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 17692544 Uniquely mapped reads % | 80.32% Average mapped length | 293.46 Number of splices: Total | 16801203 Number of splices: Annotated (sjdb) | 16414905 Number of splices: GT/AG | 16440739 Number of splices: GC/AG | 254121 Number of splices: AT/AC | 11553 Number of splices: Non-canonical | 94790 Mismatch rate per base, % | 1.36% Deletion rate per base | 0.08% Deletion average length | 3.13 Insertion rate per base | 0.06% Insertion average length | 2.94 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 988951 % of reads mapped to multiple loci | 4.49% Number of reads mapped to too many loci | 189665 % of reads mapped to too many loci | 0.86% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.77% % of reads unmapped: other | 0.56% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3346312 3346312 3346312 N_multimapping 988951 988951 988951 N_noFeature 361475 8896184 8978055 N_ambiguous 359781 90361 90310 UnstrandedReadsAssigned:16971288 PositiveStrandReadsAssigned:8705999 NegativeStrandReadsAssigned:8624179 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR24351043 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR24351043-trimmed-pair1.fastq SRR24351043-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,027,807 reads, 16,818,019 reads pseudoaligned [quant] estimated average fragment length: 263.087 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,057 rounds 52401 SRR24351043.ke.tsv 34699 SRR24351043.se.tsv 87100 total ==> SRR24351043.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1755.91 1517.6 39.2491 Potri.005G024800.1.v4.1 1035 772.913 2986 175.442 Potri.004G059700.1.v4.1 961 698.913 12 0.779708 Potri.007G009000.2.v4.1 1416 1153.91 1 0.0393551 Potri.003G141000.2.v4.1 2943 2680.91 420.905 7.12978 Potri.016G087400.1.v4.1 270 63.052 1697.89 1222.88 Potri.015G069301.1.v4.1 564 302.128 0 0 Potri.010G195200.1.v4.1 1773 1510.91 527 15.8396 Potri.012G127500.1.v4.1 977 714.913 704 44.7192 ==> SRR24351043.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 59 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 117 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 14 SRR24351043 completed mapping pipeline successfully