Starting /dee2/code/volunteer_pipeline.sh SRR24351044 current disk space = 3055109439488 free memory = 1181043784 SRR24351044 SRAfilesize f4a36628f615cd4126a1ec8e2b42d56f SRR24351044.sra SRR24351044.sra file validated SRR24351044 is paired end SRR24351044 is conventional basespace SRR24351044 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR24351044_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1005 37.0 37.0 37.0 37.0 37.0 2 36.0375 37.0 37.0 37.0 37.0 37.0 3 36.10725 37.0 37.0 37.0 37.0 37.0 4 36.1075 37.0 37.0 37.0 37.0 37.0 5 36.1125 37.0 37.0 37.0 37.0 37.0 6 36.1 37.0 37.0 37.0 37.0 37.0 7 36.0535 37.0 37.0 37.0 37.0 37.0 8 36.005 37.0 37.0 37.0 37.0 37.0 9 36.033 37.0 37.0 37.0 37.0 37.0 10-14 36.063399999999994 37.0 37.0 37.0 37.0 37.0 15-19 35.9857 37.0 37.0 37.0 37.0 37.0 20-24 35.9737 37.0 37.0 37.0 37.0 37.0 25-29 35.9328 37.0 37.0 37.0 37.0 37.0 30-34 35.8817 37.0 37.0 37.0 37.0 37.0 35-39 35.7556 37.0 37.0 37.0 37.0 37.0 40-44 35.7673 37.0 37.0 37.0 37.0 37.0 45-49 35.7577 37.0 37.0 37.0 37.0 37.0 50-54 35.76405 37.0 37.0 37.0 37.0 37.0 55-59 35.65315 37.0 37.0 37.0 37.0 37.0 60-64 35.5946 37.0 37.0 37.0 37.0 37.0 65-69 35.55535 37.0 37.0 37.0 37.0 37.0 70-74 35.5655 37.0 37.0 37.0 37.0 37.0 75-79 35.41055 37.0 37.0 37.0 34.6 37.0 80-84 35.416650000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.285199999999996 37.0 37.0 37.0 32.2 37.0 90-94 35.4488 37.0 37.0 37.0 37.0 37.0 95-99 35.2862 37.0 37.0 37.0 34.6 37.0 100-104 35.3606 37.0 37.0 37.0 32.2 37.0 105-109 35.294599999999996 37.0 37.0 37.0 29.8 37.0 110-114 35.213100000000004 37.0 37.0 37.0 29.8 37.0 115-119 35.1513 37.0 37.0 37.0 27.4 37.0 120-124 35.0501 37.0 37.0 37.0 27.4 37.0 125-129 34.794000000000004 37.0 37.0 37.0 25.0 37.0 130-134 34.9641 37.0 37.0 37.0 25.0 37.0 135-139 34.8534 37.0 37.0 37.0 25.0 37.0 140-144 34.688900000000004 37.0 37.0 37.0 25.0 37.0 145-149 34.560700000000004 37.0 37.0 37.0 25.0 37.0 150 34.5795 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 5.0 24 2.0 25 6.0 26 8.0 27 13.0 28 30.0 29 48.0 30 55.0 31 94.0 32 144.0 33 244.0 34 343.0 35 600.0 36 2332.0 37 75.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.75 14.975 12.725 38.550000000000004 2 17.4 25.75 38.25 18.6 3 21.405351337834457 28.032008002000502 24.356089022255563 26.206551637909474 4 24.099999999999998 34.125 18.475 23.3 5 22.75 36.575 22.525000000000002 18.15 6 19.3 36.55 24.575 19.575 7 17.525 18.525 41.65 22.3 8 19.525000000000002 22.1 30.15 28.225 9 20.3 24.875 28.65 26.174999999999997 10-14 22.42 29.2 25.405 22.975 15-19 21.6 28.325 26.815 23.26 20-24 21.45 27.694999999999997 27.66 23.195 25-29 21.997199719971995 28.092809280928094 27.282728272827285 22.627262726272626 30-34 21.734346869373873 28.015603120624128 27.335467093418686 22.914582916583317 35-39 21.419283856771354 28.335667133426686 27.455491098219643 22.789557911582317 40-44 22.244448889777956 28.300660132026405 26.615323064612923 22.839567913582716 45-49 22.22222222222222 28.497849784978495 26.61766176617662 22.662266226622663 50-54 22.090522630657663 28.40710177544386 26.646661665416353 22.85571392848212 55-59 22.545636409102276 27.781945486371594 27.346836709177296 22.325581395348838 60-64 21.664332866573314 27.725545109021805 27.645529105821165 22.96459291858372 65-69 22.465616404101024 28.047011752938232 26.791697924481124 22.69567391847962 70-74 22.399479895979198 27.690538107621528 26.690338067613524 23.219643928785757 75-79 22.61565391347837 28.072018004501125 26.39659914978745 22.91572893223306 80-84 22.500625156289072 27.526881720430108 27.376844211052763 22.595648912228057 85-89 22.814562912582517 27.830566113222645 26.74534906981396 22.609521904380873 90-94 22.805 27.46 27.884999999999998 21.85 95-99 22.6 27.72 27.0 22.68 100-104 22.755 27.900000000000002 26.895000000000003 22.45 105-109 23.255 27.255000000000003 26.740000000000002 22.75 110-114 23.115 28.22 26.200000000000003 22.465 115-119 23.015 27.49 27.065 22.43 120-124 22.365 27.99 26.85 22.795 125-129 22.79 27.150000000000002 27.57 22.49 130-134 22.82 27.715 26.765 22.7 135-139 23.435 27.675 26.505000000000003 22.384999999999998 140-144 22.905 27.525 26.924999999999997 22.645 145-149 22.994999999999997 27.38 27.26 22.365 150 22.725 26.75 26.075 24.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 2.0 25 1.5 26 2.0 27 3.0 28 3.0 29 7.0 30 10.5 31 12.5 32 14.5 33 34.0 34 52.5 35 57.5 36 65.0 37 89.0 38 113.5 39 140.0 40 176.5 41 197.0 42 225.0 43 254.5 44 272.5 45 277.0 46 262.5 47 253.0 48 246.5 49 226.0 50 197.5 51 174.5 52 136.5 53 107.0 54 92.5 55 70.5 56 54.5 57 37.5 58 32.0 59 30.5 60 20.5 61 13.0 62 8.5 63 5.0 64 3.5 65 2.0 66 2.0 67 2.0 68 2.5 69 3.0 70 3.0 71 2.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.01 30-34 0.02 35-39 0.02 40-44 0.02 45-49 0.01 50-54 0.025 55-59 0.025 60-64 0.02 65-69 0.025 70-74 0.02 75-79 0.025 80-84 0.025 85-89 0.02 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.25 #Duplication Level Percentage of deduplicated Percentage of total 1 93.27077747989276 86.97500000000001 2 6.327077747989277 11.799999999999999 3 0.37533512064343166 1.05 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.026809651474530835 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCCCAATCCCACATCAAACATGGTAGTTGATGTGCTTGCTTAATGACCG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.925 0.0 0.0 0.0 0.0 102-103 1.1 0.0 0.0 0.0 0.0 104-105 1.225 0.0 0.0 0.0 0.0 106-107 1.3875000000000002 0.0 0.0 0.0 0.0 108-109 1.5125 0.0 0.0 0.0 0.0 110-111 1.6625 0.0 0.0 0.0 0.0 112-113 1.975 0.0 0.0 0.0 0.0 114-115 2.2125 0.0 0.0 0.0 0.0 116-117 2.4125 0.0 0.0 0.0 0.0 118-119 2.55 0.0 0.0 0.0 0.0 120-121 2.5875 0.0 0.0 0.0 0.0 122-123 2.8125 0.0 0.0 0.0 0.0 124-125 2.9875 0.0 0.0 0.0 0.0 126-127 3.25 0.0 0.0 0.0 0.0 128-129 3.3625 0.0 0.0 0.0 0.0 130-131 3.6125 0.0 0.0 0.0 0.0 132-133 3.9375 0.0 0.0 0.0 0.0 134-135 4.175000000000001 0.0 0.0 0.0 0.0 136-137 4.449999999999999 0.0 0.0 0.0 0.0 138 4.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGCCCT 10 0.006973645 144.0 3 CAGAAGT 10 0.006973645 144.0 1 GAGATGA 10 0.006973645 144.0 3 AGCCCTA 10 0.006973645 144.0 4 TTTTTTT 25 5.183459E-4 28.8 140-144 >>END_MODULE SRR24351044 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR24351044_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.6595 37.0 37.0 37.0 37.0 37.0 2 35.5135 37.0 37.0 37.0 37.0 37.0 3 35.681 37.0 37.0 37.0 37.0 37.0 4 35.8425 37.0 37.0 37.0 37.0 37.0 5 35.983 37.0 37.0 37.0 37.0 37.0 6 35.7645 37.0 37.0 37.0 37.0 37.0 7 35.757 37.0 37.0 37.0 37.0 37.0 8 35.76 37.0 37.0 37.0 37.0 37.0 9 35.676 37.0 37.0 37.0 37.0 37.0 10-14 35.895500000000006 37.0 37.0 37.0 37.0 37.0 15-19 35.839099999999995 37.0 37.0 37.0 37.0 37.0 20-24 35.7638 37.0 37.0 37.0 37.0 37.0 25-29 35.7786 37.0 37.0 37.0 37.0 37.0 30-34 35.7208 37.0 37.0 37.0 37.0 37.0 35-39 35.737 37.0 37.0 37.0 37.0 37.0 40-44 35.6721 37.0 37.0 37.0 37.0 37.0 45-49 35.6715 37.0 37.0 37.0 37.0 37.0 50-54 35.7119 37.0 37.0 37.0 37.0 37.0 55-59 35.52740000000001 37.0 37.0 37.0 37.0 37.0 60-64 35.5522 37.0 37.0 37.0 37.0 37.0 65-69 35.6015 37.0 37.0 37.0 37.0 37.0 70-74 35.370799999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.540800000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.3892 37.0 37.0 37.0 34.6 37.0 85-89 35.440900000000006 37.0 37.0 37.0 34.6 37.0 90-94 35.397 37.0 37.0 37.0 34.6 37.0 95-99 35.3451 37.0 37.0 37.0 34.6 37.0 100-104 35.3745 37.0 37.0 37.0 34.6 37.0 105-109 35.2632 37.0 37.0 37.0 32.2 37.0 110-114 35.195100000000004 37.0 37.0 37.0 29.8 37.0 115-119 35.175 37.0 37.0 37.0 27.4 37.0 120-124 35.034299999999995 37.0 37.0 37.0 25.0 37.0 125-129 34.9718 37.0 37.0 37.0 25.0 37.0 130-134 34.9713 37.0 37.0 37.0 27.4 37.0 135-139 34.7995 37.0 37.0 37.0 25.0 37.0 140-144 34.6571 37.0 37.0 37.0 25.0 37.0 145-149 34.5011 37.0 37.0 37.0 25.0 37.0 150 34.7155 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 1.0 16 0.0 17 0.0 18 1.0 19 1.0 20 1.0 21 3.0 22 2.0 23 4.0 24 5.0 25 6.0 26 11.0 27 17.0 28 29.0 29 40.0 30 56.0 31 84.0 32 131.0 33 204.0 34 357.0 35 779.0 36 2161.0 37 106.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.875 14.45 11.625 39.050000000000004 2 17.95 25.224999999999998 36.55 20.275000000000002 3 21.85 29.025000000000002 24.675 24.45 4 26.825 33.1 16.775000000000002 23.3 5 23.3 36.525 20.825 19.35 6 17.625 38.45 24.325 19.6 7 16.725 16.55 43.925 22.8 8 19.7 22.175 28.349999999999998 29.775000000000002 9 19.950000000000003 24.099999999999998 30.25 25.7 10-14 21.73 28.98 26.32 22.97 15-19 21.8 28.105000000000004 27.185 22.91 20-24 21.97 28.615000000000002 26.334999999999997 23.080000000000002 25-29 22.345000000000002 27.705000000000002 27.169999999999998 22.78 30-34 22.21 27.82 26.77 23.200000000000003 35-39 21.855 28.78 26.955000000000002 22.41 40-44 22.54 28.38 26.529999999999998 22.55 45-49 22.32 28.835 26.479999999999997 22.365 50-54 21.51 28.575 26.950000000000003 22.965 55-59 22.215 28.735 26.82 22.23 60-64 21.97 28.035 27.224999999999998 22.770000000000003 65-69 22.305 27.084999999999997 27.61 23.0 70-74 22.15 27.47 27.36 23.02 75-79 22.1 27.785 26.950000000000003 23.165 80-84 22.145 27.62 26.965 23.27 85-89 22.59 28.07 26.655 22.685 90-94 22.365 27.97 26.865 22.8 95-99 22.595000000000002 27.395000000000003 27.1 22.91 100-104 22.75 27.105 27.634999999999998 22.509999999999998 105-109 23.415 27.275 26.900000000000002 22.41 110-114 23.305 27.915 26.855 21.925 115-119 23.48 27.565 26.295 22.66 120-124 23.35 27.715 26.924999999999997 22.009999999999998 125-129 23.01 27.735 26.974999999999998 22.28 130-134 23.845 27.089999999999996 27.115000000000002 21.95 135-139 23.21 27.155 26.924999999999997 22.71 140-144 23.71 26.76 27.115000000000002 22.415 145-149 23.685000000000002 27.775 26.179999999999996 22.36 150 24.474999999999998 27.200000000000003 26.6 21.725 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 1.0 26 1.5 27 2.0 28 4.0 29 7.0 30 12.0 31 19.5 32 21.0 33 27.0 34 47.5 35 62.5 36 74.5 37 90.5 38 109.0 39 121.5 40 158.5 41 202.5 42 221.0 43 255.5 44 284.5 45 287.0 46 269.0 47 259.0 48 233.0 49 197.0 50 190.5 51 165.0 52 135.0 53 113.5 54 95.0 55 85.5 56 60.0 57 38.5 58 33.5 59 26.0 60 18.5 61 17.5 62 13.5 63 6.5 64 8.0 65 9.0 66 4.0 67 1.0 68 0.5 69 1.0 70 2.0 71 2.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.375 #Duplication Level Percentage of deduplicated Percentage of total 1 93.46720214190094 87.275 2 6.07764390896921 11.35 3 0.34805890227576974 0.975 4 0.107095046854083 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.075 0.0 0.0 0.0 0.0 104-105 1.225 0.0 0.0 0.0 0.0 106-107 1.4 0.0 0.0 0.0 0.0 108-109 1.5375 0.0 0.0 0.0 0.0 110-111 1.6875 0.0 0.0 0.0 0.0 112-113 1.975 0.0 0.0 0.0 0.0 114-115 2.175 0.0 0.0 0.0 0.0 116-117 2.3625 0.0 0.0 0.0 0.0 118-119 2.475 0.0 0.0 0.0 0.0 120-121 2.5125 0.0 0.0 0.0 0.0 122-123 2.7375 0.0 0.0 0.0 0.0 124-125 2.9125 0.0 0.0 0.0 0.0 126-127 3.175 0.0 0.0 0.0 0.0 128-129 3.3125 0.0 0.0 0.0 0.0 130-131 3.5250000000000004 0.0 0.0 0.0 0.0 132-133 3.8375 0.0 0.0 0.0 0.0 134-135 4.075 0.0 0.0 0.0 0.0 136-137 4.35 0.0 0.0 0.0 0.0 138 4.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGTTGC 10 0.006973645 144.0 3 ATTGGAG 10 0.006973645 144.0 5 >>END_MODULE Read 1157543 spots for SRR24351044.sra Written 1157543 spots for SRR24351044.sra Read 1157543 spots for SRR24351044.sra Written 1157543 spots for SRR24351044.sra Read 1157543 spots for SRR24351044.sra Written 1157543 spots for SRR24351044.sra Read 1157543 spots for SRR24351044.sra Written 1157543 spots for SRR24351044.sra Read 1157543 spots for SRR24351044.sra Written 1157543 spots for SRR24351044.sra Read 1157543 spots for SRR24351044.sra Written 1157543 spots for SRR24351044.sra Read 1157543 spots for SRR24351044.sra Written 1157543 spots for SRR24351044.sra Read 1157543 spots for SRR24351044.sra Written 1157543 spots for SRR24351044.sra Read 1157543 spots for SRR24351044.sra Written 1157543 spots for SRR24351044.sra Read 1157543 spots for SRR24351044.sra Written 1157543 spots for SRR24351044.sra Read 1157543 spots for SRR24351044.sra Written 1157543 spots for SRR24351044.sra Read 1157543 spots for SRR24351044.sra Written 1157543 spots for SRR24351044.sra Read 1157543 spots for SRR24351044.sra Written 1157543 spots for SRR24351044.sra Read 1157543 spots for SRR24351044.sra Written 1157543 spots for SRR24351044.sra Read 1157543 spots for SRR24351044.sra Written 1157543 spots for SRR24351044.sra Read 1157543 spots for SRR24351044.sra Written 1157543 spots for SRR24351044.sra Read 1157543 spots for SRR24351044.sra Written 1157543 spots for SRR24351044.sra Read 1157543 spots for SRR24351044.sra Written 1157543 spots for SRR24351044.sra Read 1157543 spots for SRR24351044.sra Written 1157543 spots for SRR24351044.sra Read 1157557 spots for SRR24351044.sra Written 1157557 spots for SRR24351044.sra SRR ids: ['SRR24351044.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u3jzwk19 SRR24351044.sra spots: 23150874 blocks: [[1, 1157543], [1157544, 2315086], [2315087, 3472629], [3472630, 4630172], [4630173, 5787715], [5787716, 6945258], [6945259, 8102801], [8102802, 9260344], [9260345, 10417887], [10417888, 11575430], [11575431, 12732973], [12732974, 13890516], [13890517, 15048059], [15048060, 16205602], [16205603, 17363145], [17363146, 18520688], [18520689, 19678231], [19678232, 20835774], [20835775, 21993317], [21993318, 23150874]] SRR24351044 file size 7800762 SRR24351044 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR24351044 SRR24351044_1.fastq SRR24351044_2.fastq Input file: SRR24351044_1.fastq Paired file: SRR24351044_2.fastq trimmed: SRR24351044-trimmed-pair1.fastq, SRR24351044-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 07:34:59 2025 >> started Tue Feb 11 07:35:25 2025 >> done (26.265s) 23150874 read pairs processed; of these: 18 ( 0.00%) short read pairs filtered out after trimming by size control 502 ( 0.00%) empty read pairs filtered out after trimming by size control 23150354 (100.00%) read pairs available; of these: 1572837 ( 6.79%) trimmed read pairs available after processing 21577517 (93.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 4 0.00% 21 8 0.00% 22 4 0.00% 23 18 0.00% 24 12 0.00% 25 13 0.00% 26 17 0.00% 27 26 0.00% 28 19 0.00% 29 36 0.00% 30 38 0.00% 31 44 0.00% 32 44 0.00% 33 59 0.00% 34 63 0.00% 35 44 0.00% 36 70 0.00% 37 76 0.00% 38 102 0.00% 39 117 0.00% 40 129 0.00% 41 107 0.00% 42 147 0.00% 43 158 0.00% 44 156 0.00% 45 180 0.00% 46 192 0.00% 47 216 0.00% 48 212 0.00% 49 272 0.00% 50 274 0.00% 51 320 0.00% 52 369 0.00% 53 346 0.00% 54 341 0.00% 55 353 0.00% 56 400 0.00% 57 395 0.00% 58 443 0.00% 59 486 0.00% 60 601 0.00% 61 680 0.00% 62 749 0.00% 63 827 0.00% 64 749 0.00% 65 820 0.00% 66 905 0.00% 67 961 0.00% 68 1037 0.00% 69 1132 0.00% 70 1295 0.01% 71 1495 0.01% 72 1678 0.01% 73 1916 0.01% 74 1886 0.01% 75 2138 0.01% 76 2201 0.01% 77 2400 0.01% 78 2539 0.01% 79 2909 0.01% 80 3201 0.01% 81 3729 0.02% 82 4050 0.02% 83 4235 0.02% 84 4721 0.02% 85 4870 0.02% 86 5068 0.02% 87 5512 0.02% 88 5993 0.03% 89 6493 0.03% 90 7113 0.03% 91 7772 0.03% 92 8529 0.04% 93 9348 0.04% 94 9948 0.04% 95 10298 0.04% 96 10583 0.05% 97 11066 0.05% 98 11595 0.05% 99 12287 0.05% 100 13196 0.06% 101 14014 0.06% 102 15186 0.07% 103 16119 0.07% 104 16705 0.07% 105 17418 0.08% 106 17719 0.08% 107 17881 0.08% 108 18521 0.08% 109 18919 0.08% 110 19643 0.08% 111 21106 0.09% 112 22006 0.10% 113 22976 0.10% 114 23727 0.10% 115 23976 0.10% 116 24608 0.11% 117 24868 0.11% 118 24838 0.11% 119 24832 0.11% 120 26178 0.11% 121 26662 0.12% 122 27625 0.12% 123 28325 0.12% 124 29228 0.13% 125 29333 0.13% 126 29720 0.13% 127 29782 0.13% 128 30110 0.13% 129 30153 0.13% 130 30498 0.13% 131 31311 0.14% 132 31623 0.14% 133 32919 0.14% 134 32908 0.14% 135 33983 0.15% 136 34355 0.15% 137 34575 0.15% 138 34285 0.15% 139 34456 0.15% 140 34922 0.15% 141 35524 0.15% 142 36079 0.16% 143 36669 0.16% 144 38077 0.16% 145 38348 0.17% 146 38332 0.17% 147 38830 0.17% 148 38864 0.17% 149 39258 0.17% 150 21577517 93.21% 23150354 reads passed initial QC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=31 prefix-density=0.80 prefix-fanout=2.2 sequence=CAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAAGTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTACCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAG criterion=fanout-score sequence-density=0.11 sequence-density-rank=9 fanout-score=63.24 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=16.5 sequence=CAGCAGCAACAA criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=29 prefix-density=0.83 prefix-fanout=2.2 sequence=CAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAAGTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTACCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=76.29 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=4.6 sequence=CAAGCAGCTGACTCGGCTTAAGACTTGATACTAGAGAGGAAGCCCCAGAGCTGCAAATCCAAGAAGATTTGCAGAAAACAAGTCATGAATATATACTAGCTACTTTATTGAAACTTGCTGAAGACAAGAGACAACCCTTATAAACGCCTAGTAGATGAAATATTATTTCTTGTCAATCCGTCGATGCGATGATCATTTCTTGAATCAACGCAGCCATCGGATCGCTCTCATTTACAAGTGCAAGGATCGCAGGTACAGTTGGCTCCACACTTACAGCCACTCTCGGCTCCCACGACCGTCTCAGCAGCTCCCTCAA SRR24351044 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 07:36:17 Started mapping on | Feb 11 07:36:18 Finished on | Feb 11 07:41:05 Mapping speed, Million of reads per hour | 290.39 Number of input reads | 23150354 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 20888376 Uniquely mapped reads % | 90.23% Average mapped length | 292.62 Number of splices: Total | 21106331 Number of splices: Annotated (sjdb) | 20674299 Number of splices: GT/AG | 20700932 Number of splices: GC/AG | 289292 Number of splices: AT/AC | 13304 Number of splices: Non-canonical | 102803 Mismatch rate per base, % | 1.29% Deletion rate per base | 0.07% Deletion average length | 3.13 Insertion rate per base | 0.05% Insertion average length | 2.78 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 855605 % of reads mapped to multiple loci | 3.70% Number of reads mapped to too many loci | 33582 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.82% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1406373 1406373 1406373 N_multimapping 855605 855605 855605 N_noFeature 346581 10478740 10438212 N_ambiguous 482130 82269 82567 UnstrandedReadsAssigned:20059665 PositiveStrandReadsAssigned:10327367 NegativeStrandReadsAssigned:10367597 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR24351044 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR24351044-trimmed-pair1.fastq SRR24351044-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,150,354 reads, 19,294,758 reads pseudoaligned [quant] estimated average fragment length: 245.889 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,203 rounds 52401 SRR24351044.ke.tsv 34699 SRR24351044.se.tsv 87100 total ==> SRR24351044.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.11 877.449 18.2131 Potri.005G024800.1.v4.1 1035 790.111 1074 50.0281 Potri.004G059700.1.v4.1 961 716.111 25 1.28486 Potri.007G009000.2.v4.1 1416 1171.11 0 0 Potri.003G141000.2.v4.1 2943 2698.11 442 6.02921 Potri.016G087400.1.v4.1 270 70.9815 1469.81 762.105 Potri.015G069301.1.v4.1 564 319.195 0 0 Potri.010G195200.1.v4.1 1773 1528.11 102 2.45665 Potri.012G127500.1.v4.1 977 732.111 2062 103.66 ==> SRR24351044.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 304 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 165 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 16 SRR24351044 completed mapping pipeline successfully