Starting /dee2/code/volunteer_pipeline.sh SRR24351045 current disk space = 3055117799424 free memory = 1403769524 SRR24351045 SRAfilesize 2394eb928e666703f1b1c1ade431f063 SRR24351045.sra SRR24351045.sra file validated SRR24351045 is paired end SRR24351045 is conventional basespace SRR24351045 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR24351045_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.042 37.0 37.0 37.0 37.0 37.0 2 36.0435 37.0 37.0 37.0 37.0 37.0 3 36.109 37.0 37.0 37.0 37.0 37.0 4 36.1005 37.0 37.0 37.0 37.0 37.0 5 36.0475 37.0 37.0 37.0 37.0 37.0 6 36.0635 37.0 37.0 37.0 37.0 37.0 7 35.912 37.0 37.0 37.0 37.0 37.0 8 36.0445 37.0 37.0 37.0 37.0 37.0 9 35.9815 37.0 37.0 37.0 37.0 37.0 10-14 36.0206 37.0 37.0 37.0 37.0 37.0 15-19 35.9768 37.0 37.0 37.0 37.0 37.0 20-24 35.95559999999999 37.0 37.0 37.0 37.0 37.0 25-29 35.808800000000005 37.0 37.0 37.0 37.0 37.0 30-34 35.91905 37.0 37.0 37.0 37.0 37.0 35-39 35.8186 37.0 37.0 37.0 37.0 37.0 40-44 35.78515 37.0 37.0 37.0 37.0 37.0 45-49 35.715 37.0 37.0 37.0 37.0 37.0 50-54 35.737649999999995 37.0 37.0 37.0 37.0 37.0 55-59 35.663799999999995 37.0 37.0 37.0 37.0 37.0 60-64 35.526650000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.6393 37.0 37.0 37.0 37.0 37.0 70-74 35.5181 37.0 37.0 37.0 37.0 37.0 75-79 35.369299999999996 37.0 37.0 37.0 34.6 37.0 80-84 35.430899999999994 37.0 37.0 37.0 37.0 37.0 85-89 35.320299999999996 37.0 37.0 37.0 32.2 37.0 90-94 35.3579 37.0 37.0 37.0 37.0 37.0 95-99 35.252599999999994 37.0 37.0 37.0 29.8 37.0 100-104 35.3399 37.0 37.0 37.0 32.2 37.0 105-109 35.2023 37.0 37.0 37.0 29.8 37.0 110-114 35.1268 37.0 37.0 37.0 25.0 37.0 115-119 35.18860000000001 37.0 37.0 37.0 27.4 37.0 120-124 35.0318 37.0 37.0 37.0 27.4 37.0 125-129 34.8118 37.0 37.0 37.0 25.0 37.0 130-134 34.8576 37.0 37.0 37.0 25.0 37.0 135-139 34.9181 37.0 37.0 37.0 25.0 37.0 140-144 34.7023 37.0 37.0 37.0 25.0 37.0 145-149 34.575199999999995 37.0 37.0 37.0 25.0 37.0 150 34.5705 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 2.0 23 0.0 24 4.0 25 8.0 26 9.0 27 18.0 28 27.0 29 43.0 30 61.0 31 109.0 32 169.0 33 185.0 34 369.0 35 617.0 36 2295.0 37 83.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.825 13.8 12.9 38.475 2 17.65 24.95 38.324999999999996 19.075 3 21.175 27.474999999999998 25.275 26.075 4 24.325 34.375 18.725 22.575 5 23.275000000000002 35.449999999999996 21.95 19.325 6 18.05 37.2 25.35 19.400000000000002 7 16.775000000000002 16.925 43.05 23.25 8 18.9 21.55 29.849999999999998 29.7 9 21.525 23.95 29.975 24.55 10-14 21.39 28.7 26.840000000000003 23.07 15-19 22.455 27.76 26.985 22.8 20-24 21.395 28.910000000000004 27.04 22.655 25-29 21.705 28.735 26.82 22.74 30-34 22.046102305115255 27.966398319915996 27.50637531876594 22.481124056202813 35-39 21.85 28.794999999999998 26.779999999999998 22.575 40-44 21.471073553677684 28.841442072103607 26.846342317115855 22.841142057102857 45-49 22.11 27.92 27.310000000000002 22.66 50-54 22.196109805490273 28.131406570328515 27.12635631781589 22.546127306365317 55-59 21.772177217721772 28.032803280328032 27.622762276227625 22.572257225722574 60-64 21.808271240686103 27.904185627844175 27.329099364904735 22.958443766564983 65-69 22.21222122212221 28.192819281928195 26.857685768576857 22.737273727372738 70-74 22.36 27.47 27.18 22.99 75-79 22.627262726272626 27.567756775677566 27.002700270027002 22.802280228022802 80-84 22.21222122212221 28.67286728672867 26.717671767176714 22.397239723972397 85-89 22.39 27.52 27.515 22.575 90-94 21.985 27.265 27.52 23.23 95-99 22.285 27.33 27.375 23.01 100-104 22.245 27.439999999999998 27.235 23.080000000000002 105-109 22.720000000000002 28.384999999999998 26.61 22.285 110-114 22.634999999999998 28.235 26.534999999999997 22.595000000000002 115-119 22.875 27.79 26.82 22.515 120-124 22.495 27.894999999999996 27.48 22.13 125-129 22.16 28.685 27.0 22.155 130-134 22.705000000000002 27.375 27.37 22.55 135-139 22.63 27.615000000000002 27.589999999999996 22.165000000000003 140-144 22.49 27.85 27.08 22.58 145-149 22.705000000000002 27.584999999999997 27.165 22.545 150 23.400000000000002 26.174999999999997 26.375 24.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 2.0 26 3.5 27 5.5 28 4.5 29 9.5 30 15.5 31 16.0 32 13.5 33 23.0 34 46.0 35 59.0 36 75.0 37 98.5 38 128.5 39 151.0 40 175.5 41 219.0 42 235.0 43 249.5 44 273.0 45 266.0 46 248.0 47 252.5 48 246.0 49 218.5 50 192.5 51 162.5 52 139.0 53 105.0 54 78.5 55 62.0 56 43.0 57 37.0 58 37.5 59 28.0 60 19.0 61 15.0 62 12.0 63 9.0 64 3.5 65 2.5 66 4.0 67 4.5 68 1.5 69 0.0 70 1.0 71 1.0 72 0.0 73 1.0 74 1.0 75 0.0 76 0.5 77 2.0 78 1.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.0 40-44 0.005 45-49 0.0 50-54 0.005 55-59 0.01 60-64 0.015 65-69 0.01 70-74 0.0 75-79 0.01 80-84 0.01 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.675 #Duplication Level Percentage of deduplicated Percentage of total 1 92.58160237388724 85.8 2 6.9867817642298355 12.950000000000001 3 0.4046398705152414 1.125 4 0.0 0.0 5 0.02697599136768276 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAATCCCACATCAAACATGGTAGTTGATGTGCTTGCTTAATGACCGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.45 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.6625 0.0 0.0 0.0 0.0 102-103 0.725 0.0 0.0 0.0 0.0 104-105 0.775 0.0 0.0 0.0 0.0 106-107 0.8625 0.0 0.0 0.0 0.0 108-109 0.9125000000000001 0.0 0.0 0.0 0.0 110-111 1.0125 0.0 0.0 0.0 0.0 112-113 1.1125 0.0 0.0 0.0 0.0 114-115 1.3125 0.0 0.0 0.0 0.0 116-117 1.4375 0.0 0.0 0.0 0.0 118-119 1.65 0.0 0.0 0.0 0.0 120-121 1.825 0.0 0.0 0.0 0.0 122-123 2.0625 0.0 0.0 0.0 0.0 124-125 2.2750000000000004 0.0 0.0 0.0 0.0 126-127 2.4749999999999996 0.0 0.0 0.0 0.0 128-129 2.7249999999999996 0.0 0.0 0.0 0.0 130-131 2.8375000000000004 0.0 0.0 0.0 0.0 132-133 2.9375 0.0 0.0 0.0 0.0 134-135 3.15 0.0 0.0 0.0 0.0 136-137 3.375 0.0 0.0 0.0 0.0 138 3.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGCCTC 10 0.006973645 144.0 3 >>END_MODULE SRR24351045 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR24351045_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.974 37.0 37.0 37.0 25.0 37.0 2 34.6305 37.0 37.0 37.0 25.0 37.0 3 35.0245 37.0 37.0 37.0 25.0 37.0 4 35.198 37.0 37.0 37.0 25.0 37.0 5 35.252 37.0 37.0 37.0 25.0 37.0 6 34.9805 37.0 37.0 37.0 25.0 37.0 7 35.316 37.0 37.0 37.0 37.0 37.0 8 35.166 37.0 37.0 37.0 25.0 37.0 9 35.1685 37.0 37.0 37.0 25.0 37.0 10-14 35.264 37.0 37.0 37.0 32.2 37.0 15-19 35.224599999999995 37.0 37.0 37.0 29.8 37.0 20-24 35.1952 37.0 37.0 37.0 27.4 37.0 25-29 35.203500000000005 37.0 37.0 37.0 27.4 37.0 30-34 35.0655 37.0 37.0 37.0 27.4 37.0 35-39 35.028 37.0 37.0 37.0 25.0 37.0 40-44 35.151799999999994 37.0 37.0 37.0 27.4 37.0 45-49 35.073899999999995 37.0 37.0 37.0 27.4 37.0 50-54 35.0484 37.0 37.0 37.0 25.0 37.0 55-59 34.8158 37.0 37.0 37.0 25.0 37.0 60-64 34.87220000000001 37.0 37.0 37.0 25.0 37.0 65-69 34.92399999999999 37.0 37.0 37.0 25.0 37.0 70-74 34.7627 37.0 37.0 37.0 25.0 37.0 75-79 34.906299999999995 37.0 37.0 37.0 25.0 37.0 80-84 34.7776 37.0 37.0 37.0 25.0 37.0 85-89 34.6864 37.0 37.0 37.0 25.0 37.0 90-94 34.6719 37.0 37.0 37.0 25.0 37.0 95-99 34.6101 37.0 37.0 37.0 25.0 37.0 100-104 34.6169 37.0 37.0 37.0 25.0 37.0 105-109 34.3856 37.0 37.0 37.0 25.0 37.0 110-114 34.538000000000004 37.0 37.0 37.0 25.0 37.0 115-119 34.4251 37.0 37.0 37.0 25.0 37.0 120-124 34.3077 37.0 37.0 37.0 25.0 37.0 125-129 34.1277 37.0 37.0 37.0 25.0 37.0 130-134 34.1257 37.0 37.0 37.0 25.0 37.0 135-139 33.9244 37.0 37.0 37.0 25.0 37.0 140-144 33.8686 37.0 37.0 37.0 25.0 37.0 145-149 33.827 37.0 37.0 37.0 25.0 37.0 150 34.1715 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 5.0 23 11.0 24 12.0 25 14.0 26 14.0 27 37.0 28 60.0 29 85.0 30 114.0 31 154.0 32 221.0 33 269.0 34 444.0 35 1055.0 36 1463.0 37 40.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.2 15.0 12.825000000000001 39.975 2 18.175 28.449999999999996 35.925000000000004 17.45 3 21.4 28.249999999999996 25.525 24.825 4 25.224999999999998 33.074999999999996 18.6 23.1 5 23.599999999999998 37.125 20.5 18.775 6 17.849999999999998 37.525 24.55 20.075000000000003 7 16.85 16.650000000000002 43.925 22.575 8 19.475 23.05 29.725 27.750000000000004 9 20.8 24.25 30.575000000000003 24.375 10-14 21.19 29.020000000000003 26.46 23.330000000000002 15-19 21.38 28.544999999999998 27.095000000000002 22.98 20-24 21.81 28.785 27.115000000000002 22.29 25-29 22.400000000000002 28.21 27.04 22.35 30-34 21.145 28.515 27.224999999999998 23.115 35-39 22.085 28.03 27.08 22.805 40-44 21.759999999999998 28.535 27.04 22.665 45-49 21.51 28.43 26.919999999999998 23.14 50-54 21.7 28.53 27.075 22.695 55-59 21.834999999999997 28.134999999999998 27.55 22.48 60-64 22.49 27.305 27.16 23.044999999999998 65-69 21.790000000000003 28.505000000000003 26.735 22.97 70-74 22.145 28.849999999999998 26.515 22.49 75-79 22.185 28.49 26.815 22.509999999999998 80-84 22.71 28.625 26.314999999999998 22.35 85-89 22.165000000000003 28.26 27.13 22.445 90-94 21.83 28.03 27.755000000000003 22.384999999999998 95-99 22.285 27.150000000000002 27.810000000000002 22.755 100-104 23.005 27.77 27.150000000000002 22.075 105-109 22.59 27.79 27.27 22.35 110-114 22.41 28.685 26.845000000000002 22.06 115-119 23.080000000000002 27.644999999999996 26.919999999999998 22.355 120-124 22.945 28.13 27.089999999999996 21.834999999999997 125-129 22.965 27.395000000000003 27.21 22.43 130-134 22.615 27.735 27.21 22.439999999999998 135-139 23.064999999999998 27.534999999999997 26.845000000000002 22.555 140-144 23.54 27.655 26.93 21.875 145-149 23.52 28.01 26.950000000000003 21.52 150 24.425 27.85 26.85 20.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 2.0 24 2.5 25 3.0 26 5.0 27 7.0 28 6.5 29 9.0 30 10.0 31 17.0 32 29.0 33 34.5 34 45.5 35 66.5 36 82.5 37 96.5 38 124.5 39 149.0 40 167.0 41 208.5 42 235.0 43 246.5 44 267.5 45 267.0 46 274.0 47 263.5 48 228.5 49 202.5 50 177.0 51 154.5 52 130.0 53 101.5 54 81.5 55 70.5 56 56.0 57 45.0 58 36.0 59 24.5 60 15.5 61 11.5 62 11.0 63 8.5 64 5.0 65 3.0 66 1.5 67 0.5 68 1.0 69 2.5 70 2.5 71 2.0 72 1.5 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.95 #Duplication Level Percentage of deduplicated Percentage of total 1 93.77328366152209 88.1 2 6.01383714741884 11.3 3 0.21287919105907396 0.6 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.5375 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 0.8625 0.0 0.0 0.0 0.0 108-109 0.9125000000000001 0.0 0.0 0.0 0.0 110-111 1.0125 0.0 0.0 0.0 0.0 112-113 1.1125 0.0 0.0 0.0 0.0 114-115 1.3125 0.0 0.0 0.0 0.0 116-117 1.4375 0.0 0.0 0.0 0.0 118-119 1.675 0.0 0.0 0.0 0.0 120-121 1.9125 0.0 0.0 0.0 0.0 122-123 2.1625 0.0 0.0 0.0 0.0 124-125 2.375 0.0 0.0 0.0 0.0 126-127 2.575 0.0 0.0 0.0 0.0 128-129 2.8125 0.0 0.0 0.0 0.0 130-131 2.9124999999999996 0.0 0.0 0.0 0.0 132-133 3.0125 0.0 0.0 0.0 0.0 134-135 3.225 0.0 0.0 0.0 0.0 136-137 3.425 0.0 0.0 0.0 0.0 138 3.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTCTAG 10 0.006973645 144.0 2 CACAACA 10 0.006973645 144.0 9 >>END_MODULE Read 1003522 spots for SRR24351045.sra Written 1003522 spots for SRR24351045.sra Read 1003522 spots for SRR24351045.sra Written 1003522 spots for SRR24351045.sra Read 1003522 spots for SRR24351045.sra Written 1003522 spots for SRR24351045.sra Read 1003522 spots for SRR24351045.sra Written 1003522 spots for SRR24351045.sra Read 1003522 spots for SRR24351045.sra Written 1003522 spots for SRR24351045.sra Read 1003522 spots for SRR24351045.sra Written 1003522 spots for SRR24351045.sra Read 1003522 spots for SRR24351045.sra Written 1003522 spots for SRR24351045.sra Read 1003528 spots for SRR24351045.sra Written 1003528 spots for SRR24351045.sra Read 1003522 spots for SRR24351045.sra Written 1003522 spots for SRR24351045.sra Read 1003522 spots for SRR24351045.sra Written 1003522 spots for SRR24351045.sra Read 1003522 spots for SRR24351045.sra Written 1003522 spots for SRR24351045.sra Read 1003522 spots for SRR24351045.sra Written 1003522 spots for SRR24351045.sra Read 1003522 spots for SRR24351045.sra Written 1003522 spots for SRR24351045.sra Read 1003522 spots for SRR24351045.sra Written 1003522 spots for SRR24351045.sra Read 1003522 spots for SRR24351045.sra Written 1003522 spots for SRR24351045.sra Read 1003522 spots for SRR24351045.sra Written 1003522 spots for SRR24351045.sra Read 1003522 spots for SRR24351045.sra Written 1003522 spots for SRR24351045.sra Read 1003522 spots for SRR24351045.sra Written 1003522 spots for SRR24351045.sra Read 1003522 spots for SRR24351045.sra Written 1003522 spots for SRR24351045.sra Read 1003522 spots for SRR24351045.sra Written 1003522 spots for SRR24351045.sra SRR ids: ['SRR24351045.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q1mw3q6r SRR24351045.sra spots: 20070446 blocks: [[1, 1003522], [1003523, 2007044], [2007045, 3010566], [3010567, 4014088], [4014089, 5017610], [5017611, 6021132], [6021133, 7024654], [7024655, 8028176], [8028177, 9031698], [9031699, 10035220], [10035221, 11038742], [11038743, 12042264], [12042265, 13045786], [13045787, 14049308], [14049309, 15052830], [15052831, 16056352], [16056353, 17059874], [17059875, 18063396], [18063397, 19066918], [19066919, 20070446]] SRR24351045 file size 6759915 SRR24351045 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR24351045 SRR24351045_1.fastq SRR24351045_2.fastq Input file: SRR24351045_1.fastq Paired file: SRR24351045_2.fastq trimmed: SRR24351045-trimmed-pair1.fastq, SRR24351045-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 07:34:40 2025 >> started Tue Feb 11 07:35:09 2025 >> done (28.984s) 20070446 read pairs processed; of these: 40 ( 0.00%) short read pairs filtered out after trimming by size control 646 ( 0.00%) empty read pairs filtered out after trimming by size control 20069760 (100.00%) read pairs available; of these: 969795 ( 4.83%) trimmed read pairs available after processing 19099965 (95.17%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 8 0.00% 21 11 0.00% 22 11 0.00% 23 7 0.00% 24 17 0.00% 25 20 0.00% 26 30 0.00% 27 15 0.00% 28 24 0.00% 29 30 0.00% 30 36 0.00% 31 50 0.00% 32 49 0.00% 33 41 0.00% 34 55 0.00% 35 44 0.00% 36 43 0.00% 37 48 0.00% 38 68 0.00% 39 93 0.00% 40 113 0.00% 41 121 0.00% 42 129 0.00% 43 104 0.00% 44 126 0.00% 45 127 0.00% 46 125 0.00% 47 151 0.00% 48 165 0.00% 49 167 0.00% 50 203 0.00% 51 233 0.00% 52 228 0.00% 53 221 0.00% 54 272 0.00% 55 248 0.00% 56 293 0.00% 57 315 0.00% 58 337 0.00% 59 359 0.00% 60 384 0.00% 61 437 0.00% 62 479 0.00% 63 473 0.00% 64 488 0.00% 65 524 0.00% 66 602 0.00% 67 612 0.00% 68 659 0.00% 69 747 0.00% 70 765 0.00% 71 919 0.00% 72 960 0.00% 73 1049 0.01% 74 1144 0.01% 75 1135 0.01% 76 1310 0.01% 77 1350 0.01% 78 1465 0.01% 79 1584 0.01% 80 1819 0.01% 81 2016 0.01% 82 2225 0.01% 83 2351 0.01% 84 2541 0.01% 85 2686 0.01% 86 2876 0.01% 87 3038 0.02% 88 3346 0.02% 89 3604 0.02% 90 3828 0.02% 91 4405 0.02% 92 4660 0.02% 93 5220 0.03% 94 5535 0.03% 95 5786 0.03% 96 6031 0.03% 97 6213 0.03% 98 6748 0.03% 99 7140 0.04% 100 7707 0.04% 101 7998 0.04% 102 8699 0.04% 103 9381 0.05% 104 9763 0.05% 105 9997 0.05% 106 10269 0.05% 107 10518 0.05% 108 11116 0.06% 109 11387 0.06% 110 11640 0.06% 111 12291 0.06% 112 13280 0.07% 113 13630 0.07% 114 14209 0.07% 115 14429 0.07% 116 14752 0.07% 117 14846 0.07% 118 14982 0.07% 119 15091 0.08% 120 15822 0.08% 121 16636 0.08% 122 16975 0.08% 123 17467 0.09% 124 17981 0.09% 125 18060 0.09% 126 18257 0.09% 127 18435 0.09% 128 18504 0.09% 129 18828 0.09% 130 19063 0.09% 131 19640 0.10% 132 20240 0.10% 133 20622 0.10% 134 21207 0.11% 135 21594 0.11% 136 21682 0.11% 137 22124 0.11% 138 21917 0.11% 139 22352 0.11% 140 22268 0.11% 141 22873 0.11% 142 23502 0.12% 143 24041 0.12% 144 24392 0.12% 145 24841 0.12% 146 24730 0.12% 147 24856 0.12% 148 25387 0.13% 149 25615 0.13% 150 19099965 95.17% 20069760 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.60 fanout-score-rank=30 prefix-density=0.66 prefix-fanout=2.4 sequence=CAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAAGTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTACCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCG criterion=fanout-score sequence-density=0.06 sequence-density-rank=22 fanout-score=25.04 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=9.0 sequence=AAGGCCAAGATCCAGGACAAGGA criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.46 fanout-score-rank=28 prefix-density=0.67 prefix-fanout=2.3 sequence=CAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAAGTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTACCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=46.78 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.0 sequence=AGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGGTAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCACTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTG SRR24351045 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 07:35:58 Started mapping on | Feb 11 07:35:58 Finished on | Feb 11 07:39:48 Mapping speed, Million of reads per hour | 314.14 Number of input reads | 20069760 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 17926637 Uniquely mapped reads % | 89.32% Average mapped length | 293.33 Number of splices: Total | 17776691 Number of splices: Annotated (sjdb) | 17363001 Number of splices: GT/AG | 17430570 Number of splices: GC/AG | 239035 Number of splices: AT/AC | 11387 Number of splices: Non-canonical | 95699 Mismatch rate per base, % | 1.34% Deletion rate per base | 0.08% Deletion average length | 3.15 Insertion rate per base | 0.05% Insertion average length | 2.91 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 838309 % of reads mapped to multiple loci | 4.18% Number of reads mapped to too many loci | 46595 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.08% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1304814 1304814 1304814 N_multimapping 838309 838309 838309 N_noFeature 347496 9039499 9011451 N_ambiguous 366791 71854 72486 UnstrandedReadsAssigned:17212350 PositiveStrandReadsAssigned:8815284 NegativeStrandReadsAssigned:8842700 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR24351045 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR24351045-trimmed-pair1.fastq SRR24351045-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,069,760 reads, 16,763,589 reads pseudoaligned [quant] estimated average fragment length: 259.238 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,140 rounds 52401 SRR24351045.ke.tsv 34699 SRR24351045.se.tsv 87100 total ==> SRR24351045.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.76 1169 29.5334 Potri.005G024800.1.v4.1 1035 776.762 2128 121.797 Potri.004G059700.1.v4.1 961 702.778 13 0.822392 Potri.007G009000.2.v4.1 1416 1157.76 0 0 Potri.003G141000.2.v4.1 2943 2684.76 532.429 8.81676 Potri.016G087400.1.v4.1 270 66.329 1311.97 879.373 Potri.015G069301.1.v4.1 564 305.892 0 0 Potri.010G195200.1.v4.1 1773 1514.76 260 7.63101 Potri.012G127500.1.v4.1 977 718.768 2908 179.87 ==> SRR24351045.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 401 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 124 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 39 SRR24351045 completed mapping pipeline successfully