Starting /dee2/code/volunteer_pipeline.sh SRR24351046 current disk space = 3055672446976 free memory = 1420056552 SRR24351046 SRAfilesize 832de325d1baf26da72635c683eec276 SRR24351046.sra SRR24351046.sra file validated SRR24351046 is paired end SRR24351046 is conventional basespace SRR24351046 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR24351046_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0805 37.0 37.0 37.0 37.0 37.0 2 35.965 37.0 37.0 37.0 37.0 37.0 3 36.2195 37.0 37.0 37.0 37.0 37.0 4 36.1315 37.0 37.0 37.0 37.0 37.0 5 36.1595 37.0 37.0 37.0 37.0 37.0 6 36.137 37.0 37.0 37.0 37.0 37.0 7 35.8975 37.0 37.0 37.0 37.0 37.0 8 36.1095 37.0 37.0 37.0 37.0 37.0 9 36.062 37.0 37.0 37.0 37.0 37.0 10-14 35.9837 37.0 37.0 37.0 37.0 37.0 15-19 36.0148 37.0 37.0 37.0 37.0 37.0 20-24 35.9364 37.0 37.0 37.0 37.0 37.0 25-29 35.9524 37.0 37.0 37.0 37.0 37.0 30-34 35.8411 37.0 37.0 37.0 37.0 37.0 35-39 35.802499999999995 37.0 37.0 37.0 37.0 37.0 40-44 35.8219 37.0 37.0 37.0 37.0 37.0 45-49 35.777 37.0 37.0 37.0 37.0 37.0 50-54 35.760200000000005 37.0 37.0 37.0 37.0 37.0 55-59 35.688100000000006 37.0 37.0 37.0 37.0 37.0 60-64 35.685700000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.657799999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.6177 37.0 37.0 37.0 37.0 37.0 75-79 35.489900000000006 37.0 37.0 37.0 34.6 37.0 80-84 35.4599 37.0 37.0 37.0 37.0 37.0 85-89 35.379599999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.461200000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.2244 37.0 37.0 37.0 32.2 37.0 100-104 35.3824 37.0 37.0 37.0 34.6 37.0 105-109 35.24679999999999 37.0 37.0 37.0 32.2 37.0 110-114 35.2418 37.0 37.0 37.0 29.8 37.0 115-119 35.2136 37.0 37.0 37.0 29.8 37.0 120-124 35.20270000000001 37.0 37.0 37.0 27.4 37.0 125-129 34.910900000000005 37.0 37.0 37.0 25.0 37.0 130-134 34.99570000000001 37.0 37.0 37.0 25.0 37.0 135-139 35.0068 37.0 37.0 37.0 25.0 37.0 140-144 34.8433 37.0 37.0 37.0 25.0 37.0 145-149 34.6999 37.0 37.0 37.0 25.0 37.0 150 34.622 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 5.0 25 2.0 26 12.0 27 25.0 28 31.0 29 49.0 30 56.0 31 94.0 32 148.0 33 179.0 34 306.0 35 597.0 36 2404.0 37 89.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.35 15.25 12.9 39.5 2 17.9 25.4 37.275000000000006 19.425 3 21.224999999999998 27.825 25.874999999999996 25.074999999999996 4 25.25 34.8 17.7 22.25 5 21.05 37.05 22.675 19.225 6 18.075 36.075 24.95 20.9 7 16.8 16.325 43.974999999999994 22.900000000000002 8 18.75 22.275 29.475 29.5 9 20.8 23.75 29.175 26.275 10-14 21.9 28.78 26.0 23.32 15-19 21.740000000000002 27.675 27.58 23.005 20-24 21.965 28.139999999999997 27.24 22.655 25-29 21.645 28.754999999999995 26.83 22.770000000000003 30-34 22.095000000000002 27.665 27.334999999999997 22.905 35-39 22.065 28.075 27.395000000000003 22.465 40-44 21.895 28.23 26.76 23.115 45-49 21.95 28.475 26.645000000000003 22.93 50-54 22.17 27.48 27.584999999999997 22.765 55-59 21.959999999999997 28.134999999999998 26.875 23.03 60-64 21.765 27.74 27.615000000000002 22.88 65-69 22.495 27.775 26.41 23.32 70-74 21.89 28.055000000000003 27.07 22.985 75-79 22.605 27.284999999999997 27.325 22.785 80-84 22.264999999999997 27.96 27.205000000000002 22.57 85-89 22.55 27.265 27.305 22.88 90-94 22.38 27.765 27.07 22.785 95-99 22.259999999999998 28.09 26.740000000000002 22.91 100-104 22.48 27.985 27.3 22.235 105-109 22.715 27.675 27.025 22.585 110-114 22.830000000000002 27.665 27.11 22.395 115-119 22.675 28.01 27.115000000000002 22.2 120-124 22.53 27.785 26.875 22.81 125-129 22.665 27.92 26.55 22.865 130-134 23.200000000000003 27.825 27.22 21.755 135-139 22.855 28.075 25.965 23.105 140-144 22.765 27.67 27.200000000000003 22.365 145-149 22.435 28.155 27.229999999999997 22.18 150 23.05 29.099999999999998 26.474999999999998 21.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.5 26 2.0 27 2.0 28 3.0 29 7.5 30 12.5 31 15.5 32 21.0 33 22.5 34 37.0 35 54.5 36 71.0 37 96.0 38 117.0 39 147.5 40 175.5 41 204.5 42 247.0 43 275.5 44 274.0 45 261.5 46 256.5 47 249.5 48 239.5 49 217.0 50 183.5 51 167.0 52 139.0 53 106.0 54 85.0 55 64.0 56 47.5 57 44.0 58 40.5 59 24.5 60 20.0 61 19.5 62 15.0 63 9.5 64 4.5 65 2.5 66 4.5 67 5.0 68 2.0 69 1.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.0 #Duplication Level Percentage of deduplicated Percentage of total 1 93.06451612903226 86.55000000000001 2 6.397849462365592 11.899999999999999 3 0.4838709677419355 1.35 4 0.053763440860215055 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1625 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.6000000000000001 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.8999999999999999 0.0 0.0 0.0 0.0 108-109 1.1375 0.0 0.0 0.0 0.0 110-111 1.1749999999999998 0.0 0.0 0.0 0.0 112-113 1.3875 0.0 0.0 0.0 0.0 114-115 1.525 0.0 0.0 0.0 0.0 116-117 1.75 0.0 0.0 0.0 0.0 118-119 1.8875 0.0 0.0 0.0 0.0 120-121 2.075 0.0 0.0 0.0 0.0 122-123 2.3375 0.0 0.0 0.0 0.0 124-125 2.5375 0.0 0.0 0.0 0.0 126-127 2.7125 0.0 0.0 0.0 0.0 128-129 2.95 0.0 0.0 0.0 0.0 130-131 3.2 0.0 0.0 0.0 0.0 132-133 3.45 0.0 0.0 0.0 0.0 134-135 3.65 0.0 0.0 0.0 0.0 136-137 3.8125 0.0 0.0 0.0 0.0 138 3.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR24351046 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR24351046_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.8025 37.0 37.0 37.0 37.0 37.0 2 35.6365 37.0 37.0 37.0 37.0 37.0 3 35.7765 37.0 37.0 37.0 37.0 37.0 4 35.8655 37.0 37.0 37.0 37.0 37.0 5 35.925 37.0 37.0 37.0 37.0 37.0 6 35.8605 37.0 37.0 37.0 37.0 37.0 7 35.907 37.0 37.0 37.0 37.0 37.0 8 35.8045 37.0 37.0 37.0 37.0 37.0 9 35.727 37.0 37.0 37.0 37.0 37.0 10-14 35.948699999999995 37.0 37.0 37.0 37.0 37.0 15-19 35.8667 37.0 37.0 37.0 37.0 37.0 20-24 35.7957 37.0 37.0 37.0 37.0 37.0 25-29 35.7857 37.0 37.0 37.0 37.0 37.0 30-34 35.7467 37.0 37.0 37.0 37.0 37.0 35-39 35.759499999999996 37.0 37.0 37.0 37.0 37.0 40-44 35.604600000000005 37.0 37.0 37.0 37.0 37.0 45-49 35.66289999999999 37.0 37.0 37.0 37.0 37.0 50-54 35.6813 37.0 37.0 37.0 37.0 37.0 55-59 35.544799999999995 37.0 37.0 37.0 37.0 37.0 60-64 35.5597 37.0 37.0 37.0 37.0 37.0 65-69 35.5853 37.0 37.0 37.0 37.0 37.0 70-74 35.459799999999994 37.0 37.0 37.0 37.0 37.0 75-79 35.518299999999996 37.0 37.0 37.0 34.6 37.0 80-84 35.4679 37.0 37.0 37.0 37.0 37.0 85-89 35.4006 37.0 37.0 37.0 34.6 37.0 90-94 35.3403 37.0 37.0 37.0 37.0 37.0 95-99 35.361900000000006 37.0 37.0 37.0 32.2 37.0 100-104 35.321000000000005 37.0 37.0 37.0 34.6 37.0 105-109 35.1822 37.0 37.0 37.0 29.8 37.0 110-114 35.309000000000005 37.0 37.0 37.0 32.2 37.0 115-119 35.194399999999995 37.0 37.0 37.0 29.8 37.0 120-124 35.0598 37.0 37.0 37.0 27.4 37.0 125-129 34.9326 37.0 37.0 37.0 25.0 37.0 130-134 35.0033 37.0 37.0 37.0 27.4 37.0 135-139 34.9003 37.0 37.0 37.0 25.0 37.0 140-144 34.73870000000001 37.0 37.0 37.0 25.0 37.0 145-149 34.694100000000006 37.0 37.0 37.0 25.0 37.0 150 34.782 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 1.0 20 3.0 21 2.0 22 0.0 23 4.0 24 4.0 25 6.0 26 14.0 27 21.0 28 20.0 29 45.0 30 75.0 31 85.0 32 136.0 33 194.0 34 322.0 35 735.0 36 2204.0 37 128.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.7 16.150000000000002 12.25 37.9 2 17.1 26.650000000000002 38.9 17.349999999999998 3 20.349999999999998 28.925 25.8 24.925 4 25.174999999999997 32.824999999999996 19.5 22.5 5 22.325 36.675000000000004 21.675 19.325 6 18.3 36.199999999999996 24.925 20.575 7 16.25 17.349999999999998 43.125 23.275000000000002 8 19.900000000000002 21.8 28.249999999999996 30.049999999999997 9 20.9 23.575 30.7 24.825 10-14 21.565 28.754999999999995 26.68 23.0 15-19 21.44 27.875 27.16 23.525 20-24 21.845 28.705000000000002 27.139999999999997 22.31 25-29 21.235 29.165000000000003 26.740000000000002 22.86 30-34 21.495 28.59 27.034999999999997 22.88 35-39 21.81 28.345 26.755000000000003 23.09 40-44 21.725 28.849999999999998 26.875 22.55 45-49 21.575 28.275 27.169999999999998 22.98 50-54 22.245 28.15 27.015 22.59 55-59 21.82 28.03 27.325 22.825 60-64 21.785 28.189999999999998 27.029999999999998 22.994999999999997 65-69 22.125 27.87 27.33 22.675 70-74 21.615000000000002 28.075 27.305 23.005 75-79 21.57 27.655 27.445000000000004 23.330000000000002 80-84 22.16 28.044999999999998 26.845000000000002 22.95 85-89 21.884999999999998 28.02 27.0 23.095 90-94 22.08 27.705000000000002 27.29 22.925 95-99 22.720000000000002 27.755000000000003 27.185 22.34 100-104 23.11 27.794999999999998 27.235 21.86 105-109 22.79 27.544999999999998 27.529999999999998 22.134999999999998 110-114 22.61 27.994999999999997 27.01 22.384999999999998 115-119 23.200000000000003 27.450000000000003 27.205000000000002 22.145 120-124 22.945 27.195000000000004 27.034999999999997 22.825 125-129 23.075000000000003 27.384999999999998 27.395000000000003 22.145 130-134 23.04 28.15 26.450000000000003 22.36 135-139 23.415 27.275 27.1 22.21 140-144 23.24 27.625 27.36 21.775 145-149 23.415 27.36 27.165 22.06 150 23.075000000000003 27.3 27.35 22.275 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 1.0 26 1.5 27 2.0 28 4.0 29 7.5 30 9.5 31 14.5 32 23.0 33 37.0 34 49.0 35 61.5 36 77.0 37 90.0 38 109.5 39 148.0 40 189.5 41 214.0 42 234.5 43 265.0 44 283.0 45 294.5 46 286.0 47 257.5 48 227.5 49 194.5 50 178.0 51 150.0 52 124.5 53 104.5 54 83.5 55 62.0 56 49.5 57 44.0 58 27.0 59 19.5 60 18.0 61 15.5 62 11.5 63 8.0 64 6.5 65 3.5 66 1.0 67 1.0 68 2.0 69 2.0 70 2.0 71 2.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.475 #Duplication Level Percentage of deduplicated Percentage of total 1 93.52768119818134 87.425 2 5.964161540518855 11.15 3 0.5081572612998128 1.425 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1625 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.5375000000000001 0.0 0.0 0.0 0.0 102-103 0.625 0.0 0.0 0.0 0.0 104-105 0.7250000000000001 0.0 0.0 0.0 0.0 106-107 0.925 0.0 0.0 0.0 0.0 108-109 1.1625 0.0 0.0 0.0 0.0 110-111 1.2000000000000002 0.0 0.0 0.0 0.0 112-113 1.3875 0.0 0.0 0.0 0.0 114-115 1.525 0.0 0.0 0.0 0.0 116-117 1.8 0.0 0.0 0.0 0.0 118-119 1.9625 0.0 0.0 0.0 0.0 120-121 2.15 0.0 0.0 0.0 0.0 122-123 2.4375 0.0 0.0 0.0 0.0 124-125 2.6375 0.0 0.0 0.0 0.0 126-127 2.8125 0.0 0.0 0.0 0.0 128-129 3.05 0.0 0.0 0.0 0.0 130-131 3.3125 0.0 0.0 0.0 0.0 132-133 3.6125 0.0 0.0 0.0 0.0 134-135 3.85 0.0 0.0 0.0 0.0 136-137 4.025 0.0 0.0 0.0 0.0 138 4.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGAAGC 10 0.006973645 144.0 7 AAAAAAA 20 0.006139246 28.8 90-94 >>END_MODULE Read 1125513 spots for SRR24351046.sra Written 1125513 spots for SRR24351046.sra Read 1125513 spots for SRR24351046.sra Written 1125513 spots for SRR24351046.sra Read 1125513 spots for SRR24351046.sra Written 1125513 spots for SRR24351046.sra Read 1125513 spots for SRR24351046.sra Written 1125513 spots for SRR24351046.sra Read 1125513 spots for SRR24351046.sra Written 1125513 spots for SRR24351046.sra Read 1125513 spots for SRR24351046.sra Written 1125513 spots for SRR24351046.sra Read 1125513 spots for SRR24351046.sra Written 1125513 spots for SRR24351046.sra Read 1125513 spots for SRR24351046.sra Written 1125513 spots for SRR24351046.sra Read 1125513 spots for SRR24351046.sra Written 1125513 spots for SRR24351046.sra Read 1125513 spots for SRR24351046.sra Written 1125513 spots for SRR24351046.sra Read 1125513 spots for SRR24351046.sra Written 1125513 spots for SRR24351046.sra Read 1125513 spots for SRR24351046.sra Written 1125513 spots for SRR24351046.sra Read 1125513 spots for SRR24351046.sra Written 1125513 spots for SRR24351046.sra Read 1125513 spots for SRR24351046.sra Written 1125513 spots for SRR24351046.sra Read 1125513 spots for SRR24351046.sra Written 1125513 spots for SRR24351046.sra Read 1125513 spots for SRR24351046.sra Written 1125513 spots for SRR24351046.sra Read 1125513 spots for SRR24351046.sra Written 1125513 spots for SRR24351046.sra Read 1125532 spots for SRR24351046.sra Written 1125532 spots for SRR24351046.sra Read 1125513 spots for SRR24351046.sra Written 1125513 spots for SRR24351046.sra Read 1125513 spots for SRR24351046.sra Written 1125513 spots for SRR24351046.sra SRR ids: ['SRR24351046.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rb0rzsoa SRR24351046.sra spots: 22510279 blocks: [[1, 1125513], [1125514, 2251026], [2251027, 3376539], [3376540, 4502052], [4502053, 5627565], [5627566, 6753078], [6753079, 7878591], [7878592, 9004104], [9004105, 10129617], [10129618, 11255130], [11255131, 12380643], [12380644, 13506156], [13506157, 14631669], [14631670, 15757182], [15757183, 16882695], [16882696, 18008208], [18008209, 19133721], [19133722, 20259234], [20259235, 21384747], [21384748, 22510279]] SRR24351046 file size 7584311 SRR24351046 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR24351046 SRR24351046_1.fastq SRR24351046_2.fastq Input file: SRR24351046_1.fastq Paired file: SRR24351046_2.fastq trimmed: SRR24351046-trimmed-pair1.fastq, SRR24351046-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 07:40:01 2025 >> started Tue Feb 11 07:40:26 2025 >> done (25.091s) 22510279 read pairs processed; of these: 81 ( 0.00%) short read pairs filtered out after trimming by size control 928 ( 0.00%) empty read pairs filtered out after trimming by size control 22509270 (100.00%) read pairs available; of these: 1334021 ( 5.93%) trimmed read pairs available after processing 21175249 (94.07%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 11 0.00% 20 7 0.00% 21 13 0.00% 22 13 0.00% 23 13 0.00% 24 20 0.00% 25 23 0.00% 26 19 0.00% 27 20 0.00% 28 27 0.00% 29 31 0.00% 30 41 0.00% 31 59 0.00% 32 42 0.00% 33 53 0.00% 34 43 0.00% 35 47 0.00% 36 56 0.00% 37 55 0.00% 38 58 0.00% 39 76 0.00% 40 92 0.00% 41 109 0.00% 42 134 0.00% 43 108 0.00% 44 117 0.00% 45 148 0.00% 46 147 0.00% 47 165 0.00% 48 144 0.00% 49 169 0.00% 50 195 0.00% 51 247 0.00% 52 242 0.00% 53 294 0.00% 54 276 0.00% 55 282 0.00% 56 309 0.00% 57 344 0.00% 58 392 0.00% 59 423 0.00% 60 493 0.00% 61 521 0.00% 62 587 0.00% 63 617 0.00% 64 590 0.00% 65 670 0.00% 66 581 0.00% 67 739 0.00% 68 783 0.00% 69 933 0.00% 70 964 0.00% 71 1131 0.01% 72 1316 0.01% 73 1338 0.01% 74 1356 0.01% 75 1430 0.01% 76 1601 0.01% 77 1844 0.01% 78 1894 0.01% 79 2215 0.01% 80 2408 0.01% 81 2639 0.01% 82 2895 0.01% 83 3123 0.01% 84 3310 0.01% 85 3528 0.02% 86 3836 0.02% 87 4235 0.02% 88 4582 0.02% 89 4987 0.02% 90 5424 0.02% 91 5902 0.03% 92 6422 0.03% 93 6798 0.03% 94 7396 0.03% 95 7636 0.03% 96 8443 0.04% 97 8707 0.04% 98 9297 0.04% 99 9842 0.04% 100 10794 0.05% 101 11219 0.05% 102 11770 0.05% 103 12674 0.06% 104 12976 0.06% 105 13722 0.06% 106 14160 0.06% 107 14607 0.06% 108 15262 0.07% 109 15807 0.07% 110 16727 0.07% 111 17065 0.08% 112 17965 0.08% 113 18651 0.08% 114 19004 0.08% 115 19814 0.09% 116 20526 0.09% 117 20902 0.09% 118 20759 0.09% 119 21738 0.10% 120 21875 0.10% 121 23056 0.10% 122 23128 0.10% 123 23787 0.11% 124 24639 0.11% 125 24628 0.11% 126 25705 0.11% 127 26161 0.12% 128 26022 0.12% 129 26598 0.12% 130 26769 0.12% 131 27467 0.12% 132 28229 0.13% 133 28538 0.13% 134 28993 0.13% 135 29961 0.13% 136 29980 0.13% 137 30662 0.14% 138 30383 0.13% 139 30871 0.14% 140 31434 0.14% 141 31511 0.14% 142 31970 0.14% 143 32768 0.15% 144 33466 0.15% 145 33632 0.15% 146 34084 0.15% 147 34282 0.15% 148 34701 0.15% 149 34498 0.15% 150 21175249 94.07% 22509270 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.68 fanout-score-rank=31 prefix-density=0.31 prefix-fanout=2.4 sequence=CAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAAGTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTACCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=50.60 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.2 sequence=AAACAGAAAGCGATTGAAAACCATTAAGGATCATACATCATCCACACATTATGCAGTTGCGTGCTTTGCAACCAGTGTTGGCAGGCCATCTTTATCAGCACCCACAGTTTTGTCCACTAATTTTCCATCTTTCAGGAAAATAAAAGTTGGCATTGCCTCCACATTCCACTCCTCAGCAACAGCCTTCAATTCATCCACATCCACCTTCAAGAATGTGACATTGGGAAACTTCTTCGCCAACTCGGCGAAGATTGGAGCAATCATTTTACA criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.91 fanout-score-rank=24 prefix-density=0.33 prefix-fanout=2.6 sequence=CAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAAGTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTACCATGTTTGATGTGGGATTGGGAGTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=67.04 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=9.2 sequence=AAACAGAAAGCGATTGAAAACCATTAAGGATCATACATCATCCACACATTATGCAGTTGCGTGCTTTGCAACCAGTGTTGGCAGGCCATCTTTATCAGCACCCACAGTTTTGTCCACTAATTTTCCATCTTTCAGGAAAATAAAAGTTGGCATTGCCTCCACATTCCACTCCTCAGCAACAGCCTTCAATTCATCCACATCCACCTTCAAGAA SRR24351046 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 07:41:14 Started mapping on | Feb 11 07:41:14 Finished on | Feb 11 07:45:47 Mapping speed, Million of reads per hour | 296.83 Number of input reads | 22509270 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 20215403 Uniquely mapped reads % | 89.81% Average mapped length | 293.15 Number of splices: Total | 20111243 Number of splices: Annotated (sjdb) | 19618165 Number of splices: GT/AG | 19718147 Number of splices: GC/AG | 261641 Number of splices: AT/AC | 13264 Number of splices: Non-canonical | 118191 Mismatch rate per base, % | 1.28% Deletion rate per base | 0.07% Deletion average length | 3.24 Insertion rate per base | 0.05% Insertion average length | 3.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 958136 % of reads mapped to multiple loci | 4.26% Number of reads mapped to too many loci | 52467 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.51% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1335731 1335731 1335731 N_multimapping 958136 958136 958136 N_noFeature 414625 10257337 10213019 N_ambiguous 307151 74041 74188 UnstrandedReadsAssigned:19493627 PositiveStrandReadsAssigned:9884025 NegativeStrandReadsAssigned:9928196 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR24351046 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR24351046-trimmed-pair1.fastq SRR24351046-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,509,270 reads, 18,872,206 reads pseudoaligned [quant] estimated average fragment length: 253.51 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,197 rounds 52401 SRR24351046.ke.tsv 34699 SRR24351046.se.tsv 87100 total ==> SRR24351046.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1765.49 1096 28.4301 Potri.005G024800.1.v4.1 1035 782.49 509 29.7901 Potri.004G059700.1.v4.1 961 708.495 63 4.07227 Potri.007G009000.2.v4.1 1416 1163.49 0 0 Potri.003G141000.2.v4.1 2943 2690.49 615 10.4683 Potri.016G087400.1.v4.1 270 68.9188 1180.99 784.765 Potri.015G069301.1.v4.1 564 311.612 0 0 Potri.010G195200.1.v4.1 1773 1520.49 101 3.04208 Potri.012G127500.1.v4.1 977 724.49 7470 472.195 ==> SRR24351046.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 819 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 130 Potri.001G212900.v4.1 11 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 38 SRR24351046 completed mapping pipeline successfully