Starting /dee2/code/volunteer_pipeline.sh SRR24351047 current disk space = 3055659466752 free memory = 1562145600 SRR24351047 SRAfilesize 862f72342511ce7de2344047f462e9c7 SRR24351047.sra SRR24351047.sra file validated SRR24351047 is paired end SRR24351047 is conventional basespace SRR24351047 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR24351047_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1175 37.0 37.0 37.0 37.0 37.0 2 35.9895 37.0 37.0 37.0 37.0 37.0 3 36.207 37.0 37.0 37.0 37.0 37.0 4 35.946 37.0 37.0 37.0 37.0 37.0 5 36.279 37.0 37.0 37.0 37.0 37.0 6 36.0825 37.0 37.0 37.0 37.0 37.0 7 36.0215 37.0 37.0 37.0 37.0 37.0 8 36.0875 37.0 37.0 37.0 37.0 37.0 9 35.928 37.0 37.0 37.0 37.0 37.0 10-14 36.058499999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.0308 37.0 37.0 37.0 37.0 37.0 20-24 35.9057 37.0 37.0 37.0 37.0 37.0 25-29 35.8812 37.0 37.0 37.0 37.0 37.0 30-34 35.870000000000005 37.0 37.0 37.0 37.0 37.0 35-39 35.79690000000001 37.0 37.0 37.0 37.0 37.0 40-44 35.7894 37.0 37.0 37.0 37.0 37.0 45-49 35.7217 37.0 37.0 37.0 37.0 37.0 50-54 35.74980000000001 37.0 37.0 37.0 37.0 37.0 55-59 35.6591 37.0 37.0 37.0 37.0 37.0 60-64 35.680600000000005 37.0 37.0 37.0 37.0 37.0 65-69 35.695899999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.629 37.0 37.0 37.0 37.0 37.0 75-79 35.4126 37.0 37.0 37.0 34.6 37.0 80-84 35.395799999999994 37.0 37.0 37.0 37.0 37.0 85-89 35.3264 37.0 37.0 37.0 32.2 37.0 90-94 35.37910000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.28189999999999 37.0 37.0 37.0 32.2 37.0 100-104 35.3255 37.0 37.0 37.0 34.6 37.0 105-109 35.2793 37.0 37.0 37.0 34.6 37.0 110-114 35.197199999999995 37.0 37.0 37.0 32.2 37.0 115-119 35.208800000000004 37.0 37.0 37.0 32.2 37.0 120-124 35.0986 37.0 37.0 37.0 27.4 37.0 125-129 34.933400000000006 37.0 37.0 37.0 25.0 37.0 130-134 35.0409 37.0 37.0 37.0 25.0 37.0 135-139 34.9243 37.0 37.0 37.0 25.0 37.0 140-144 34.792500000000004 37.0 37.0 37.0 25.0 37.0 145-149 34.7208 37.0 37.0 37.0 25.0 37.0 150 34.715 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 4.0 25 7.0 26 9.0 27 13.0 28 28.0 29 42.0 30 76.0 31 91.0 32 127.0 33 229.0 34 330.0 35 608.0 36 2368.0 37 65.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.050000000000004 16.150000000000002 13.25 36.55 2 18.775 24.349999999999998 37.025000000000006 19.85 3 21.099999999999998 28.675 26.325 23.9 4 23.9 33.975 18.9 23.225 5 22.0 36.75 21.65 19.6 6 17.575 37.075 24.85 20.5 7 15.675 16.475 44.95 22.900000000000002 8 19.6 22.15 29.2 29.049999999999997 9 21.224999999999998 24.099999999999998 28.675 26.0 10-14 21.38 29.470000000000002 25.990000000000002 23.16 15-19 21.58 28.48 27.425 22.515 20-24 21.709999999999997 28.88 27.0 22.41 25-29 22.455 28.895 26.14 22.509999999999998 30-34 21.725 28.79 26.889999999999997 22.595000000000002 35-39 22.09 28.845 26.795 22.27 40-44 21.965 28.89 26.58 22.564999999999998 45-49 21.6 28.57 27.515 22.314999999999998 50-54 21.5 28.165000000000003 27.36 22.975 55-59 21.645 28.77 27.245 22.34 60-64 22.259999999999998 28.310000000000002 27.0 22.43 65-69 22.18 28.68 26.85 22.29 70-74 21.37 28.249999999999996 27.61 22.770000000000003 75-79 21.845 27.93 26.810000000000002 23.415 80-84 21.855 27.860000000000003 27.12 23.165 85-89 22.62 27.61 27.295 22.475 90-94 22.81 28.24 26.91 22.040000000000003 95-99 22.134999999999998 27.99 26.924999999999997 22.95 100-104 21.995 27.99 27.584999999999997 22.43 105-109 22.8 28.63 26.729999999999997 21.84 110-114 22.095000000000002 27.939999999999998 27.529999999999998 22.435 115-119 22.745 27.700000000000003 27.26 22.295 120-124 22.14 28.249999999999996 27.065 22.545 125-129 22.74 27.58 27.150000000000002 22.53 130-134 22.445 27.925 27.33 22.3 135-139 22.615 27.500000000000004 26.784999999999997 23.1 140-144 22.46 27.52 27.884999999999998 22.134999999999998 145-149 22.05 27.229999999999997 27.665 23.055 150 23.5 26.275 27.175 23.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.5 26 3.0 27 2.5 28 5.5 29 9.0 30 16.5 31 22.5 32 24.5 33 35.0 34 50.5 35 61.0 36 70.0 37 95.0 38 122.5 39 163.0 40 199.0 41 211.0 42 238.5 43 255.5 44 260.0 45 252.0 46 265.0 47 273.5 48 246.5 49 213.0 50 171.0 51 149.5 52 128.0 53 107.0 54 84.5 55 60.0 56 44.0 57 37.0 58 32.0 59 25.5 60 18.5 61 11.5 62 9.5 63 6.0 64 3.0 65 3.0 66 3.5 67 1.5 68 1.0 69 1.0 70 1.0 71 2.0 72 1.0 73 1.5 74 1.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 92.80517380759903 86.1 2 6.655887900835354 12.35 3 0.4850444624090542 1.35 4 0.05389382915656157 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.425 0.0 0.0 0.0 0.0 106-107 0.5125 0.0 0.0 0.0 0.0 108-109 0.6125 0.0 0.0 0.0 0.0 110-111 0.775 0.0 0.0 0.0 0.0 112-113 0.9125 0.0 0.0 0.0 0.0 114-115 1.05 0.0 0.0 0.0 0.0 116-117 1.1625 0.0 0.0 0.0 0.0 118-119 1.2125 0.0 0.0 0.0 0.0 120-121 1.3250000000000002 0.0 0.0 0.0 0.0 122-123 1.6124999999999998 0.0 0.0 0.0 0.0 124-125 1.8250000000000002 0.0 0.0 0.0 0.0 126-127 1.975 0.0 0.0 0.0 0.0 128-129 2.125 0.0 0.0 0.0 0.0 130-131 2.325 0.0 0.0 0.0 0.0 132-133 2.4375 0.0 0.0 0.0 0.0 134-135 2.6125 0.0 0.0 0.0 0.0 136-137 2.7874999999999996 0.0 0.0 0.0 0.0 138 2.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTGTCA 10 0.006973645 144.0 3 AAAAGAT 10 0.006973645 144.0 1 >>END_MODULE SRR24351047 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR24351047_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.738 37.0 37.0 37.0 37.0 37.0 2 35.5835 37.0 37.0 37.0 37.0 37.0 3 35.6575 37.0 37.0 37.0 37.0 37.0 4 35.7205 37.0 37.0 37.0 37.0 37.0 5 35.847 37.0 37.0 37.0 37.0 37.0 6 35.783 37.0 37.0 37.0 37.0 37.0 7 35.7485 37.0 37.0 37.0 37.0 37.0 8 35.654 37.0 37.0 37.0 37.0 37.0 9 35.5945 37.0 37.0 37.0 37.0 37.0 10-14 35.8135 37.0 37.0 37.0 37.0 37.0 15-19 35.724900000000005 37.0 37.0 37.0 37.0 37.0 20-24 35.6883 37.0 37.0 37.0 37.0 37.0 25-29 35.64 37.0 37.0 37.0 37.0 37.0 30-34 35.6379 37.0 37.0 37.0 37.0 37.0 35-39 35.5026 37.0 37.0 37.0 37.0 37.0 40-44 35.4968 37.0 37.0 37.0 34.6 37.0 45-49 35.544799999999995 37.0 37.0 37.0 37.0 37.0 50-54 35.5801 37.0 37.0 37.0 37.0 37.0 55-59 35.3944 37.0 37.0 37.0 32.2 37.0 60-64 35.4529 37.0 37.0 37.0 37.0 37.0 65-69 35.432300000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.2759 37.0 37.0 37.0 34.6 37.0 75-79 35.3746 37.0 37.0 37.0 34.6 37.0 80-84 35.2801 37.0 37.0 37.0 32.2 37.0 85-89 35.2094 37.0 37.0 37.0 29.8 37.0 90-94 35.2197 37.0 37.0 37.0 27.4 37.0 95-99 35.185 37.0 37.0 37.0 27.4 37.0 100-104 35.1816 37.0 37.0 37.0 27.4 37.0 105-109 34.9955 37.0 37.0 37.0 25.0 37.0 110-114 35.1117 37.0 37.0 37.0 25.0 37.0 115-119 34.9572 37.0 37.0 37.0 25.0 37.0 120-124 34.87 37.0 37.0 37.0 25.0 37.0 125-129 34.7212 37.0 37.0 37.0 25.0 37.0 130-134 34.8217 37.0 37.0 37.0 25.0 37.0 135-139 34.616699999999994 37.0 37.0 37.0 25.0 37.0 140-144 34.5775 37.0 37.0 37.0 25.0 37.0 145-149 34.396100000000004 37.0 37.0 37.0 25.0 37.0 150 34.758 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 0.0 20 0.0 21 2.0 22 3.0 23 4.0 24 7.0 25 10.0 26 20.0 27 19.0 28 27.0 29 44.0 30 57.0 31 105.0 32 168.0 33 227.0 34 373.0 35 839.0 36 2029.0 37 64.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.725 15.725 13.3 36.25 2 19.0 26.025 36.449999999999996 18.525 3 21.575 27.3 25.775 25.35 4 24.725 34.825 17.974999999999998 22.475 5 21.825 36.375 22.375 19.425 6 17.7 37.8 23.9 20.599999999999998 7 16.825000000000003 16.825000000000003 42.925000000000004 23.425 8 19.675 22.95 29.45 27.925 9 21.625 24.349999999999998 28.675 25.35 10-14 21.37 29.335 26.85 22.445 15-19 22.11 28.32 27.145000000000003 22.425 20-24 21.52 28.265 27.62 22.595000000000002 25-29 21.82 28.810000000000002 27.305 22.065 30-34 21.8 28.744999999999997 26.88 22.575 35-39 21.87 28.52 27.52 22.09 40-44 21.575 28.415000000000003 26.955000000000002 23.055 45-49 21.985 28.21 27.29 22.515 50-54 21.34 28.03 27.634999999999998 22.994999999999997 55-59 22.15 28.075 28.060000000000002 21.715 60-64 22.09 28.575 26.52 22.814999999999998 65-69 22.515 28.455000000000002 26.97 22.06 70-74 21.57 28.515 27.61 22.305 75-79 22.605 27.73 27.045 22.62 80-84 22.0 28.37 27.71 21.92 85-89 22.465 28.02 27.389999999999997 22.125 90-94 22.035 28.235 27.250000000000004 22.48 95-99 21.85 28.525 27.29 22.335 100-104 22.814999999999998 27.905 27.05 22.23 105-109 22.35 27.825 27.51 22.314999999999998 110-114 22.99 27.71 26.91 22.39 115-119 23.505000000000003 27.73 26.83 21.935 120-124 23.01 27.935 27.315 21.740000000000002 125-129 22.425 28.110000000000003 27.295 22.17 130-134 22.73 28.144999999999996 27.0 22.125 135-139 22.295 28.15 27.52 22.035 140-144 22.93 28.455000000000002 27.345000000000002 21.27 145-149 23.465 27.675 27.279999999999998 21.58 150 23.549999999999997 28.15 27.450000000000003 20.849999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 1.5 23 1.5 24 2.0 25 1.5 26 3.5 27 8.0 28 10.0 29 8.0 30 14.5 31 24.5 32 27.5 33 41.5 34 56.5 35 57.5 36 71.5 37 104.0 38 131.5 39 164.0 40 190.5 41 214.0 42 243.5 43 247.0 44 250.5 45 266.0 46 253.0 47 246.5 48 231.0 49 212.0 50 194.5 51 155.5 52 127.0 53 96.5 54 73.0 55 60.5 56 52.5 57 40.5 58 27.0 59 20.5 60 17.0 61 12.5 62 7.5 63 4.0 64 3.5 65 5.0 66 3.0 67 2.0 68 2.0 69 0.5 70 1.5 71 1.0 72 2.0 73 2.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.65 #Duplication Level Percentage of deduplicated Percentage of total 1 93.56647090229579 87.625 2 6.139882541377469 11.5 3 0.2402562733582488 0.675 4 0.05339028296849973 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.037500000000000006 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.45 0.0 0.0 0.0 0.0 104-105 0.45 0.0 0.0 0.0 0.0 106-107 0.5375000000000001 0.0 0.0 0.0 0.0 108-109 0.6375 0.0 0.0 0.0 0.0 110-111 0.8125 0.0 0.0 0.0 0.0 112-113 0.9625 0.0 0.0 0.0 0.0 114-115 1.1 0.0 0.0 0.0 0.0 116-117 1.2125 0.0 0.0 0.0 0.0 118-119 1.2375 0.0 0.0 0.0 0.0 120-121 1.35 0.0 0.0 0.0 0.0 122-123 1.6375000000000002 0.0 0.0 0.0 0.0 124-125 1.85 0.0 0.0 0.0 0.0 126-127 2.0 0.0 0.0 0.0 0.0 128-129 2.1500000000000004 0.0 0.0 0.0 0.0 130-131 2.3375 0.0 0.0 0.0 0.0 132-133 2.4875 0.0 0.0 0.0 0.0 134-135 2.6625 0.0 0.0 0.0 0.0 136-137 2.8125 0.0 0.0 0.0 0.0 138 2.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1039226 spots for SRR24351047.sra Written 1039226 spots for SRR24351047.sra Read 1039226 spots for SRR24351047.sra Written 1039226 spots for SRR24351047.sra Read 1039226 spots for SRR24351047.sra Written 1039226 spots for SRR24351047.sra Read 1039226 spots for SRR24351047.sra Written 1039226 spots for SRR24351047.sra Read 1039226 spots for SRR24351047.sra Written 1039226 spots for SRR24351047.sra Read 1039226 spots for SRR24351047.sra Written 1039226 spots for SRR24351047.sra Read 1039226 spots for SRR24351047.sra Written 1039226 spots for SRR24351047.sra Read 1039226 spots for SRR24351047.sra Written 1039226 spots for SRR24351047.sra Read 1039226 spots for SRR24351047.sra Written 1039226 spots for SRR24351047.sra Read 1039226 spots for SRR24351047.sra Written 1039226 spots for SRR24351047.sra Read 1039226 spots for SRR24351047.sra Written 1039226 spots for SRR24351047.sra Read 1039226 spots for SRR24351047.sra Written 1039226 spots for SRR24351047.sra Read 1039226 spots for SRR24351047.sra Written 1039226 spots for SRR24351047.sra Read 1039226 spots for SRR24351047.sra Written 1039226 spots for SRR24351047.sra Read 1039226 spots for SRR24351047.sra Written 1039226 spots for SRR24351047.sra Read 1039226 spots for SRR24351047.sra Written 1039226 spots for SRR24351047.sra Read 1039226 spots for SRR24351047.sra Written 1039226 spots for SRR24351047.sra Read 1039243 spots for SRR24351047.sra Written 1039243 spots for SRR24351047.sra Read 1039226 spots for SRR24351047.sra Written 1039226 spots for SRR24351047.sra Read 1039226 spots for SRR24351047.sra Written 1039226 spots for SRR24351047.sra SRR ids: ['SRR24351047.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uoq17jcb SRR24351047.sra spots: 20784537 blocks: [[1, 1039226], [1039227, 2078452], [2078453, 3117678], [3117679, 4156904], [4156905, 5196130], [5196131, 6235356], [6235357, 7274582], [7274583, 8313808], [8313809, 9353034], [9353035, 10392260], [10392261, 11431486], [11431487, 12470712], [12470713, 13509938], [13509939, 14549164], [14549165, 15588390], [15588391, 16627616], [16627617, 17666842], [17666843, 18706068], [18706069, 19745294], [19745295, 20784537]] SRR24351047 file size 7001199 SRR24351047 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR24351047 SRR24351047_1.fastq SRR24351047_2.fastq Input file: SRR24351047_1.fastq Paired file: SRR24351047_2.fastq trimmed: SRR24351047-trimmed-pair1.fastq, SRR24351047-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 07:37:35 2025 >> started Tue Feb 11 07:38:08 2025 >> done (32.589s) 20784537 read pairs processed; of these: 33 ( 0.00%) short read pairs filtered out after trimming by size control 783 ( 0.00%) empty read pairs filtered out after trimming by size control 20783721 (100.00%) read pairs available; of these: 828496 ( 3.99%) trimmed read pairs available after processing 19955225 (96.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 7 0.00% 21 12 0.00% 22 7 0.00% 23 16 0.00% 24 19 0.00% 25 15 0.00% 26 10 0.00% 27 24 0.00% 28 16 0.00% 29 22 0.00% 30 37 0.00% 31 31 0.00% 32 24 0.00% 33 38 0.00% 34 32 0.00% 35 55 0.00% 36 42 0.00% 37 49 0.00% 38 63 0.00% 39 66 0.00% 40 65 0.00% 41 72 0.00% 42 100 0.00% 43 97 0.00% 44 64 0.00% 45 100 0.00% 46 90 0.00% 47 125 0.00% 48 104 0.00% 49 154 0.00% 50 154 0.00% 51 172 0.00% 52 188 0.00% 53 188 0.00% 54 197 0.00% 55 202 0.00% 56 214 0.00% 57 236 0.00% 58 231 0.00% 59 253 0.00% 60 332 0.00% 61 331 0.00% 62 408 0.00% 63 395 0.00% 64 442 0.00% 65 437 0.00% 66 402 0.00% 67 528 0.00% 68 529 0.00% 69 596 0.00% 70 679 0.00% 71 792 0.00% 72 885 0.00% 73 959 0.00% 74 1052 0.01% 75 941 0.00% 76 956 0.00% 77 1083 0.01% 78 1280 0.01% 79 1414 0.01% 80 1510 0.01% 81 1750 0.01% 82 1979 0.01% 83 2137 0.01% 84 2287 0.01% 85 2352 0.01% 86 2442 0.01% 87 2626 0.01% 88 2858 0.01% 89 2989 0.01% 90 3523 0.02% 91 3655 0.02% 92 4206 0.02% 93 4586 0.02% 94 4863 0.02% 95 4965 0.02% 96 5036 0.02% 97 5221 0.03% 98 5426 0.03% 99 5811 0.03% 100 6448 0.03% 101 6877 0.03% 102 7336 0.04% 103 7981 0.04% 104 8382 0.04% 105 8560 0.04% 106 8654 0.04% 107 8755 0.04% 108 9161 0.04% 109 9612 0.05% 110 9801 0.05% 111 10333 0.05% 112 11272 0.05% 113 11557 0.06% 114 12010 0.06% 115 12326 0.06% 116 12658 0.06% 117 12365 0.06% 118 12670 0.06% 119 12727 0.06% 120 13150 0.06% 121 13607 0.07% 122 14226 0.07% 123 14869 0.07% 124 15783 0.08% 125 15407 0.07% 126 15782 0.08% 127 15810 0.08% 128 15895 0.08% 129 15964 0.08% 130 16402 0.08% 131 16771 0.08% 132 17125 0.08% 133 17612 0.08% 134 18242 0.09% 135 18715 0.09% 136 18784 0.09% 137 18811 0.09% 138 18855 0.09% 139 18922 0.09% 140 18844 0.09% 141 19567 0.09% 142 19940 0.10% 143 20644 0.10% 144 21091 0.10% 145 21819 0.10% 146 21943 0.11% 147 21819 0.10% 148 22111 0.11% 149 22242 0.11% 150 19955225 96.01% 20783721 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=32 prefix-density=0.20 prefix-fanout=2.0 sequence=CGGAGAATCAAGATACTCCTGCAAGCCCTCCAGATCATCAAAGGTAGTTTCAAAAGCATGAGTATATCCGAAATTGAGGTCGTGAATACCCAGATTA criterion=fanout-score sequence-density=0.02 sequence-density-rank=36 fanout-score=46.85 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=7.4 sequence=AAACAGAAAGCGATTGAAAACCATTAAGGATCATACATCATCCACACATTATGCAGTTGCGTGCTTTGCAACCAGTGTTGGCAGGCCATCTTTATCAGCACCCACAGTTTTGTCCACTAATTTTCCATCTTTCAGGAAAATAAAAGTTGGCATTGCCTCCACATTCCACTCCTCAGCAACAGCCTTCAATTCATCCACATCCACCTTCAAGAATGTGACATTGGGAAACTTCTTCGCCAACTCGGCGAAGATTGGAGCAATCATTTTACA criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=38 prefix-density=0.20 prefix-fanout=2.0 sequence=CGGAGAATCAAGATACTCCTGCAAGCCCTCCAGATCATCAAAGGTAGTTTCAAAAGCATGAGTATATCCGAAATTGAGGTCGTGAATACCCAGATTA criterion=fanout-score sequence-density=0.07 sequence-density-rank=25 fanout-score=23.46 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=8.2 sequence=AAGGCCAAGATCCAGGACAAGGA SRR24351047 testing PE reads STAR mapping to Ensembl genome Unpaired reads removal Started job on | Feb 11 07:51:32 Started mapping on | Feb 11 07:51:32 Finished on | Feb 11 07:54:45 Mapping speed, Million of reads per hour | 387.67 Number of input reads | 20783260 Average input read length | 277 UNIQUE READS: Uniquely mapped reads number | 18026161 Uniquely mapped reads % | 86.73% Average mapped length | 274.44 Number of splices: Total | 15572812 Number of splices: Annotated (sjdb) | 15158970 Number of splices: GT/AG | 15267166 Number of splices: GC/AG | 189186 Number of splices: AT/AC | 11334 Number of splices: Non-canonical | 105126 Mismatch rate per base, % | 1.38% Deletion rate per base | 0.08% Deletion average length | 3.05 Insertion rate per base | 0.06% Insertion average length | 2.81 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 918954 % of reads mapped to multiple loci | 4.42% Number of reads mapped to too many loci | 60053 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.37% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1838286 1838286 1838286 N_multimapping 918954 918954 918954 N_noFeature 319683 9099287 9062131 N_ambiguous 364886 90231 91418 UnstrandedReadsAssigned:17341592 PositiveStrandReadsAssigned:8836643 NegativeStrandReadsAssigned:8872612 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR24351047 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR24351047-trimmed-pair1.fastq SRR24351047-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,783,260 reads, 17,683,214 reads pseudoaligned [quant] estimated average fragment length: 243.085 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,247 rounds 52401 SRR24351047.ke.tsv 34699 SRR24351047.se.tsv 87100 total ==> SRR24351047.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1775.92 884.415 22.6649 Potri.005G024800.1.v4.1 1035 792.915 850 48.7878 Potri.004G059700.1.v4.1 961 718.924 48 3.03863 Potri.007G009000.2.v4.1 1416 1173.92 0 0 Potri.003G141000.2.v4.1 2943 2700.92 492.394 8.297 Potri.016G087400.1.v4.1 270 68.2916 1474.46 982.617 Potri.015G069301.1.v4.1 564 322.081 0 0 Potri.010G195200.1.v4.1 1773 1530.92 57 1.69451 Potri.012G127500.1.v4.1 977 734.924 7341 454.602 ==> SRR24351047.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 467 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 112 Potri.001G212900.v4.1 26 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 26 SRR24351047 completed mapping pipeline successfully