Starting /dee2/code/volunteer_pipeline.sh SRR26075322 current disk space = 3053514813440 free memory = 1480694000 SRR26075322 SRAfilesize 2addb703484abe9eb7da50102b5bf4d5 SRR26075322.sra SRR26075322.sra file validated SRR26075322 is paired end SRR26075322 is conventional basespace SRR26075322 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR26075322_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.26 37.0 37.0 37.0 37.0 37.0 2 36.3795 37.0 37.0 37.0 37.0 37.0 3 36.5065 37.0 37.0 37.0 37.0 37.0 4 36.473 37.0 37.0 37.0 37.0 37.0 5 36.6335 37.0 37.0 37.0 37.0 37.0 6 36.5845 37.0 37.0 37.0 37.0 37.0 7 36.6795 37.0 37.0 37.0 37.0 37.0 8 36.645 37.0 37.0 37.0 37.0 37.0 9 36.633 37.0 37.0 37.0 37.0 37.0 10-14 36.6365 37.0 37.0 37.0 37.0 37.0 15-19 36.647400000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.58919999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.524699999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.507600000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.413399999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.4634 37.0 37.0 37.0 37.0 37.0 45-49 36.379400000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.34759999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.330999999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.3023 37.0 37.0 37.0 37.0 37.0 65-69 36.221999999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.2467 37.0 37.0 37.0 37.0 37.0 75-79 36.2117 37.0 37.0 37.0 37.0 37.0 80-84 36.185900000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.1858 37.0 37.0 37.0 37.0 37.0 90-94 36.150400000000005 37.0 37.0 37.0 37.0 37.0 95-99 36.07170000000001 37.0 37.0 37.0 37.0 37.0 100-104 35.9991 37.0 37.0 37.0 37.0 37.0 105-109 35.8859 37.0 37.0 37.0 37.0 37.0 110-114 35.9066 37.0 37.0 37.0 37.0 37.0 115-119 35.7731 37.0 37.0 37.0 37.0 37.0 120-124 35.74980000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.7101 37.0 37.0 37.0 37.0 37.0 130-134 35.7022 37.0 37.0 37.0 37.0 37.0 135-139 35.4066 37.0 37.0 37.0 37.0 37.0 140-144 35.3322 37.0 37.0 37.0 37.0 37.0 145-149 35.079499999999996 37.0 37.0 37.0 29.8 37.0 150-151 34.660250000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 2.0 20 1.0 21 1.0 22 0.0 23 2.0 24 7.0 25 6.0 26 6.0 27 15.0 28 23.0 29 25.0 30 37.0 31 51.0 32 60.0 33 101.0 34 152.0 35 269.0 36 2680.0 37 562.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.025 14.549999999999999 9.6 41.825 2 17.0 14.124999999999998 36.125 32.75 3 17.224999999999998 15.950000000000001 27.375 39.45 4 21.65 23.875 22.6 31.874999999999996 5 24.85 28.549999999999997 24.85 21.75 6 21.875 33.275 22.25 22.6 7 14.725 28.075 39.900000000000006 17.299999999999997 8 18.0 26.775 32.025 23.200000000000003 9 18.3 24.05 34.025 23.625 10-14 19.794999999999998 28.735 27.965 23.505000000000003 15-19 20.115 27.235 28.310000000000002 24.34 20-24 19.99 28.02 27.779999999999998 24.21 25-29 19.895 27.51 28.405 24.19 30-34 19.73 27.750000000000004 27.63 24.89 35-39 19.575 27.66 28.310000000000002 24.455 40-44 20.150000000000002 27.935 27.935 23.98 45-49 20.200000000000003 27.77 27.505000000000003 24.525 50-54 19.955000000000002 27.92 27.675 24.45 55-59 19.8 28.435 27.474999999999998 24.29 60-64 20.77 27.185 27.3 24.745 65-69 20.330000000000002 27.815 27.73 24.125 70-74 20.45 26.950000000000003 28.189999999999998 24.41 75-79 19.744999999999997 27.76 27.575 24.92 80-84 20.61 27.98 27.32 24.09 85-89 21.025 27.92 27.310000000000002 23.745 90-94 20.525 27.375 27.655 24.445 95-99 20.54 28.115000000000002 27.57 23.775 100-104 20.21 27.96 27.095000000000002 24.735 105-109 20.365 27.72 28.044999999999998 23.87 110-114 20.885 27.83 26.935 24.349999999999998 115-119 20.615 27.725 27.295 24.365000000000002 120-124 20.990000000000002 27.800000000000004 27.01 24.2 125-129 21.315 28.105000000000004 26.345000000000002 24.235 130-134 20.665 28.15 26.52 24.665 135-139 20.919999999999998 28.04 26.58 24.46 140-144 21.025 28.189999999999998 26.590000000000003 24.195 145-149 21.154999999999998 28.294999999999998 26.119999999999997 24.43 150-151 20.5375 28.237499999999997 27.05 24.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 1.5 23 2.0 24 2.0 25 2.0 26 5.0 27 6.5 28 5.0 29 6.0 30 13.0 31 19.0 32 22.5 33 31.5 34 44.5 35 66.0 36 79.5 37 90.5 38 120.0 39 145.5 40 172.0 41 208.0 42 222.0 43 235.0 44 255.0 45 272.5 46 277.0 47 278.5 48 252.5 49 215.5 50 196.5 51 152.5 52 115.0 53 95.0 54 74.5 55 59.0 56 55.5 57 49.0 58 34.0 59 28.0 60 23.0 61 14.0 62 12.0 63 11.0 64 10.0 65 6.0 66 2.5 67 2.5 68 2.0 69 2.0 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.775 #Duplication Level Percentage of deduplicated Percentage of total 1 96.0584703732707 92.0 2 3.6021926389976504 6.9 3 0.261028452101279 0.75 4 0.026102845210127904 0.1 5 0.05220569042025581 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCATATTTACTGAATGACTCCCTGTCTTGACATATACAATAGAAGAACC 5 0.125 No Hit CTCCGTAAGCTTTATTTCGAACGTAAAAATCAGAAGTAGAACTCTTCGAT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.11249999999999999 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.4 0.0 0.0 0.0 0.0 82-83 0.4875 0.0 0.0 0.0 0.0 84-85 0.5874999999999999 0.0 0.0 0.0 0.0 86-87 0.6625000000000001 0.0 0.0 0.0 0.0 88-89 0.85 0.0 0.0 0.0 0.0 90-91 1.0125 0.0 0.0 0.0 0.0 92-93 1.1 0.0 0.0 0.0 0.0 94-95 1.25 0.0 0.0 0.0 0.0 96-97 1.5 0.0 0.0 0.0 0.0 98-99 1.7875 0.0 0.0 0.0 0.0 100-101 2.1624999999999996 0.0 0.0 0.0 0.0 102-103 2.4625 0.0 0.0 0.0 0.0 104-105 2.75 0.0125 0.0 0.0 0.0 106-107 3.1375 0.025 0.0 0.0 0.0 108-109 3.5875000000000004 0.025 0.0 0.0 0.0 110-111 3.9875 0.025 0.0 0.0 0.0 112-113 4.4625 0.025 0.0 0.0 0.0 114-115 5.075 0.025 0.0 0.0 0.0 116-117 5.5875 0.025 0.0 0.0 0.0 118-119 6.2125 0.025 0.0 0.0 0.0 120-121 6.7125 0.025 0.0 0.0 0.0 122-123 7.2625 0.025 0.0 0.0 0.0 124-125 7.800000000000001 0.025 0.0 0.0 0.0 126-127 8.537500000000001 0.025 0.0 0.0 0.0 128-129 9.375 0.025 0.0 0.0 0.0 130-131 10.087499999999999 0.025 0.0 0.0 0.0 132-133 10.875 0.025 0.0 0.0 0.0 134-135 11.4875 0.025 0.0 0.0 0.0 136-137 12.399999999999999 0.025 0.0 0.0 0.0 138-139 13.125 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCCAGG 10 0.006830828 145.0 1 >>END_MODULE SRR26075322 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR26075322_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3155 37.0 37.0 37.0 37.0 37.0 2 36.285 37.0 37.0 37.0 37.0 37.0 3 36.5015 37.0 37.0 37.0 37.0 37.0 4 36.3895 37.0 37.0 37.0 37.0 37.0 5 36.4005 37.0 37.0 37.0 37.0 37.0 6 36.504 37.0 37.0 37.0 37.0 37.0 7 36.3925 37.0 37.0 37.0 37.0 37.0 8 36.3875 37.0 37.0 37.0 37.0 37.0 9 36.5245 37.0 37.0 37.0 37.0 37.0 10-14 36.392999999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.3623 37.0 37.0 37.0 37.0 37.0 20-24 36.3497 37.0 37.0 37.0 37.0 37.0 25-29 36.314 37.0 37.0 37.0 37.0 37.0 30-34 36.244299999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.1745 37.0 37.0 37.0 37.0 37.0 40-44 36.2 37.0 37.0 37.0 37.0 37.0 45-49 36.09689999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.1152 37.0 37.0 37.0 37.0 37.0 55-59 36.0631 37.0 37.0 37.0 37.0 37.0 60-64 36.0112 37.0 37.0 37.0 37.0 37.0 65-69 35.993700000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.0613 37.0 37.0 37.0 37.0 37.0 75-79 35.9765 37.0 37.0 37.0 37.0 37.0 80-84 35.9014 37.0 37.0 37.0 37.0 37.0 85-89 35.8681 37.0 37.0 37.0 37.0 37.0 90-94 35.799800000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.8338 37.0 37.0 37.0 37.0 37.0 100-104 35.7478 37.0 37.0 37.0 37.0 37.0 105-109 35.707 37.0 37.0 37.0 37.0 37.0 110-114 35.580099999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.598699999999994 37.0 37.0 37.0 37.0 37.0 120-124 35.465700000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.4331 37.0 37.0 37.0 37.0 37.0 130-134 35.4049 37.0 37.0 37.0 34.6 37.0 135-139 35.225 37.0 37.0 37.0 32.2 37.0 140-144 35.175399999999996 37.0 37.0 37.0 25.0 37.0 145-149 34.9203 37.0 37.0 37.0 25.0 37.0 150-151 34.82175 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 2.0 15 1.0 16 3.0 17 2.0 18 2.0 19 0.0 20 2.0 21 1.0 22 4.0 23 11.0 24 13.0 25 9.0 26 15.0 27 15.0 28 18.0 29 33.0 30 32.0 31 40.0 32 40.0 33 72.0 34 165.0 35 499.0 36 2643.0 37 374.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.225 21.349999999999998 14.05 28.375 2 27.250000000000004 25.7 29.65 17.4 3 20.349999999999998 28.449999999999996 31.5 19.7 4 24.175 33.725 23.3 18.8 5 27.175 35.25 20.4 17.175 6 20.674999999999997 38.2 23.400000000000002 17.724999999999998 7 22.075 22.025 37.55 18.35 8 21.8 25.924999999999997 28.349999999999998 23.925 9 22.575 25.55 29.7 22.175 10-14 23.655 29.125 26.145000000000003 21.075 15-19 23.605 28.425 27.04 20.93 20-24 23.369999999999997 28.235 27.650000000000002 20.745 25-29 23.49 27.915 27.224999999999998 21.37 30-34 23.169999999999998 28.28 27.805000000000003 20.745 35-39 23.169999999999998 28.37 27.705000000000002 20.755000000000003 40-44 23.79 28.349999999999998 27.13 20.73 45-49 24.325 27.810000000000002 27.089999999999996 20.775 50-54 24.11 28.595 27.169999999999998 20.125 55-59 23.965 28.4 27.08 20.555 60-64 24.565 28.225 26.834999999999997 20.375 65-69 24.175 28.415000000000003 27.275 20.135 70-74 24.18 28.065 27.12 20.635 75-79 24.05 28.095 27.52 20.335 80-84 24.035 28.46 27.200000000000003 20.305 85-89 24.545 28.110000000000003 26.775 20.57 90-94 23.885 28.854999999999997 26.700000000000003 20.560000000000002 95-99 24.805 28.78 26.365 20.05 100-104 24.92 28.73 26.445 19.905 105-109 24.610000000000003 28.96 26.91 19.52 110-114 24.654999999999998 28.715000000000003 26.284999999999997 20.345 115-119 24.560000000000002 28.95 26.22 20.27 120-124 25.455 28.249999999999996 26.484999999999996 19.81 125-129 24.91 28.57 26.445 20.075000000000003 130-134 25.35 28.015 26.235000000000003 20.4 135-139 26.365 28.249999999999996 25.545 19.84 140-144 26.415 28.23 25.990000000000002 19.365 145-149 26.33 28.525 25.564999999999998 19.580000000000002 150-151 26.487500000000004 28.249999999999996 25.525 19.7375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 1.0 10 1.0 11 0.5 12 0.5 13 0.5 14 0.5 15 2.0 16 2.0 17 0.5 18 0.5 19 1.0 20 0.5 21 1.0 22 1.5 23 1.0 24 1.5 25 2.0 26 2.5 27 2.0 28 4.0 29 7.5 30 9.0 31 11.0 32 17.5 33 27.0 34 42.0 35 60.5 36 82.5 37 107.5 38 128.0 39 161.0 40 192.0 41 221.0 42 263.5 43 279.0 44 279.5 45 276.0 46 274.5 47 259.5 48 228.0 49 186.0 50 161.0 51 154.5 52 121.5 53 87.5 54 60.5 55 56.0 56 52.5 57 35.5 58 27.0 59 19.5 60 11.0 61 14.0 62 13.5 63 9.5 64 8.0 65 3.5 66 3.5 67 3.0 68 1.5 69 2.0 70 1.5 71 1.5 72 1.5 73 1.0 74 1.5 75 1.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.6 #Duplication Level Percentage of deduplicated Percentage of total 1 95.81589958158996 91.60000000000001 2 3.844142259414226 7.35 3 0.2615062761506276 0.75 4 0.07845188284518828 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.11249999999999999 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.42500000000000004 0.0 0.0 0.0 0.0 82-83 0.5125 0.0 0.0 0.0 0.0 84-85 0.5874999999999999 0.0 0.0 0.0 0.0 86-87 0.6625000000000001 0.0 0.0 0.0 0.0 88-89 0.825 0.0 0.0 0.0 0.0 90-91 0.9875 0.0 0.0 0.0 0.0 92-93 1.075 0.0 0.0 0.0 0.0 94-95 1.225 0.0 0.0 0.0 0.0 96-97 1.4875 0.0 0.0 0.0 0.0 98-99 1.7875 0.0 0.0 0.0 0.0 100-101 2.1624999999999996 0.0 0.0 0.0 0.0 102-103 2.4625 0.0 0.0 0.0 0.0 104-105 2.75 0.0 0.0 0.0 0.0 106-107 3.1500000000000004 0.0 0.0 0.0 0.0 108-109 3.625 0.0 0.0 0.0 0.0 110-111 4.0375 0.0 0.0 0.0 0.0 112-113 4.5375 0.0 0.0 0.0 0.0 114-115 5.1375 0.0 0.0 0.0 0.0 116-117 5.6375 0.0 0.0 0.0 0.0 118-119 6.25 0.0 0.0 0.0 0.0 120-121 6.762499999999999 0.0 0.0 0.0 0.0 122-123 7.2875 0.0 0.0 0.0 0.0 124-125 7.824999999999999 0.0 0.0 0.0 0.0 126-127 8.537500000000001 0.0 0.0 0.0 0.0 128-129 9.375 0.0 0.0 0.0 0.0 130-131 10.1125 0.0 0.0 0.0 0.0 132-133 10.925 0.0 0.0 0.0 0.0 134-135 11.5625 0.0 0.0 0.0 0.0 136-137 12.475000000000001 0.0 0.0 0.0 0.0 138-139 13.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTAAGA 10 0.006830828 145.0 7 >>END_MODULE Read 463013 spots for SRR26075322.sra Written 463013 spots for SRR26075322.sra Read 463013 spots for SRR26075322.sra Written 463013 spots for SRR26075322.sra Read 463013 spots for SRR26075322.sra Written 463013 spots for SRR26075322.sra Read 463013 spots for SRR26075322.sra Written 463013 spots for SRR26075322.sra Read 463013 spots for SRR26075322.sra Written 463013 spots for SRR26075322.sra Read 463013 spots for SRR26075322.sra Written 463013 spots for SRR26075322.sra Read 463013 spots for SRR26075322.sra Written 463013 spots for SRR26075322.sra Read 463013 spots for SRR26075322.sra Written 463013 spots for SRR26075322.sra Read 463013 spots for SRR26075322.sra Written 463013 spots for SRR26075322.sra Read 463013 spots for SRR26075322.sra Written 463013 spots for SRR26075322.sra Read 463013 spots for SRR26075322.sra Written 463013 spots for SRR26075322.sra Read 463013 spots for SRR26075322.sra Written 463013 spots for SRR26075322.sra Read 463013 spots for SRR26075322.sra Written 463013 spots for SRR26075322.sra Read 463013 spots for SRR26075322.sra Written 463013 spots for SRR26075322.sra Read 463013 spots for SRR26075322.sra Written 463013 spots for SRR26075322.sra Read 463013 spots for SRR26075322.sra Written 463013 spots for SRR26075322.sra Read 463013 spots for SRR26075322.sra Written 463013 spots for SRR26075322.sra Read 463016 spots for SRR26075322.sra Written 463016 spots for SRR26075322.sra Read 463013 spots for SRR26075322.sra Written 463013 spots for SRR26075322.sra Read 463013 spots for SRR26075322.sra Written 463013 spots for SRR26075322.sra SRR ids: ['SRR26075322.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_20q1z0b9 SRR26075322.sra spots: 9260263 blocks: [[1, 463013], [463014, 926026], [926027, 1389039], [1389040, 1852052], [1852053, 2315065], [2315066, 2778078], [2778079, 3241091], [3241092, 3704104], [3704105, 4167117], [4167118, 4630130], [4630131, 5093143], [5093144, 5556156], [5556157, 6019169], [6019170, 6482182], [6482183, 6945195], [6945196, 7408208], [7408209, 7871221], [7871222, 8334234], [8334235, 8797247], [8797248, 9260263]] SRR26075322 file size 3412429 SRR26075322 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR26075322 SRR26075322_1.fastq SRR26075322_2.fastq Input file: SRR26075322_1.fastq Paired file: SRR26075322_2.fastq trimmed: SRR26075322-trimmed-pair1.fastq, SRR26075322-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 18:44:26 2025 >> started Tue Feb 11 18:44:37 2025 >> done (10.907s) 9260263 read pairs processed; of these: 9 ( 0.00%) short read pairs filtered out after trimming by size control 8043 ( 0.09%) empty read pairs filtered out after trimming by size control 9252211 (99.91%) read pairs available; of these: 1704534 (18.42%) trimmed read pairs available after processing 7547677 (81.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 3 0.00% 21 2 0.00% 22 2 0.00% 23 3 0.00% 24 6 0.00% 25 5 0.00% 26 5 0.00% 27 8 0.00% 28 11 0.00% 29 7 0.00% 30 11 0.00% 31 13 0.00% 32 16 0.00% 33 7 0.00% 34 7 0.00% 35 17 0.00% 36 18 0.00% 37 14 0.00% 38 16 0.00% 39 26 0.00% 40 33 0.00% 41 33 0.00% 42 36 0.00% 43 36 0.00% 44 39 0.00% 45 34 0.00% 46 46 0.00% 47 51 0.00% 48 68 0.00% 49 75 0.00% 50 102 0.00% 51 89 0.00% 52 117 0.00% 53 115 0.00% 54 119 0.00% 55 159 0.00% 56 143 0.00% 57 201 0.00% 58 220 0.00% 59 266 0.00% 60 326 0.00% 61 372 0.00% 62 445 0.00% 63 513 0.01% 64 555 0.01% 65 533 0.01% 66 612 0.01% 67 723 0.01% 68 851 0.01% 69 906 0.01% 70 1081 0.01% 71 1252 0.01% 72 1438 0.02% 73 1837 0.02% 74 1813 0.02% 75 2140 0.02% 76 2437 0.03% 77 2686 0.03% 78 2934 0.03% 79 3102 0.03% 80 3504 0.04% 81 4138 0.04% 82 4495 0.05% 83 4888 0.05% 84 5459 0.06% 85 6060 0.07% 86 6540 0.07% 87 6897 0.07% 88 7500 0.08% 89 8088 0.09% 90 8593 0.09% 91 9378 0.10% 92 9898 0.11% 93 10611 0.11% 94 11467 0.12% 95 12399 0.13% 96 13062 0.14% 97 13958 0.15% 98 14254 0.15% 99 14861 0.16% 100 15804 0.17% 101 16103 0.17% 102 16893 0.18% 103 17625 0.19% 104 18667 0.20% 105 18942 0.20% 106 19780 0.21% 107 20721 0.22% 108 21486 0.23% 109 21919 0.24% 110 22006 0.24% 111 22596 0.24% 112 23445 0.25% 113 24004 0.26% 114 24669 0.27% 115 25593 0.28% 116 26104 0.28% 117 26231 0.28% 118 27544 0.30% 119 27727 0.30% 120 28206 0.30% 121 28540 0.31% 122 28722 0.31% 123 29355 0.32% 124 30324 0.33% 125 30468 0.33% 126 31286 0.34% 127 31466 0.34% 128 32504 0.35% 129 32638 0.35% 130 33060 0.36% 131 33180 0.36% 132 33610 0.36% 133 33962 0.37% 134 34059 0.37% 135 34704 0.38% 136 34899 0.38% 137 35173 0.38% 138 36039 0.39% 139 36529 0.39% 140 36366 0.39% 141 36879 0.40% 142 37314 0.40% 143 36943 0.40% 144 37161 0.40% 145 37780 0.41% 146 37534 0.41% 147 37966 0.41% 148 38531 0.42% 149 38074 0.41% 150 38614 0.42% 151 7547677 81.58% 9252211 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.55 fanout-score-rank=18 prefix-density=0.38 prefix-fanout=2.4 sequence=GGAATTGAATTAATGAACTTGGTGGCAGCAAGGAAGGCGTTGTAGGAGGCTAAATAGCTAACTCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=79.07 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=7.5 sequence=CCACCAAGATCTGCACCGACGGCCGCTCCGCCCGGGCTCGCGCCCCGGGTTTTGCAGCGACCGCCGCGCCCTCCTACTCATCGGGGCCTGGCGCTTGCCCCGACGGCCGGGTATAGGTCGCGCGCTTCAGCGCCATCCATTTTCGGGGCTAGTTGATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGATTTCGACTTCCATGACCACCGTCCTGCTGTCTTAATCGACCAACACCCTTTGTGGGTTCTAGGTTAGCGCGCAGTTGGGCACCGTAACCCGGCTTCCGGTTCATCCCGCATCGCCAGTTCTGCTTACCAAAAATGGCCCACTTGGAGCTCTCGATTCCGTGGCGCGGCTCAACGAAGCAGCCGCGCCGTCCTACCTATTTAAAGTTTGAGAATAGGTCGAGGGCGTTGCGCCCCCGATGCCTCTAATCATTGGCTTTACCCGATAGAACTCGCACCGAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAACCAGCTAC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.54 fanout-score-rank=19 prefix-density=0.44 prefix-fanout=2.5 sequence=ATGTACCCTGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=216.08 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=9.1 sequence=AGAGAAAAGATAAGCTAGGCAAGATGGTTTTACTAGACAAGATGTGGGATGATGTTGTTGCTGGACCTCAGCCAGAACGTGGCCTTGGCAAGCTTAGAAAGATCAGCACCAGACCACTTAACATCAAAGATATTGACGTCGGAGAGGGGAGCAGTCCTGTTAATAAGTTTCAGAGGTCCATGACTATGCCAGGAACTCCAGGGACACCGACGACACCAGTGACCCCTACAACCCCAGTGTCGGCGCGTAGCAATGTTTGGAGGAGCGTGTTCCACCCTGGTAGCAACCTTGCTACTAAGAATATTGGTGCTCATGTTTTTGACAAGCCACAGCCTAACACACCCACTGTCTATGACTGGATGTACAGTGGAGAGACGAAGAGCGAGCATCGTTGATGAGGTTGCCTTCAACCAAGGTTGCCCATGTAAATACGTACTGTGTTTTGTTTTTCAGTACT SRR26075322 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 18:45:24 Started mapping on | Feb 11 18:45:24 Finished on | Feb 11 18:46:49 Mapping speed, Million of reads per hour | 391.86 Number of input reads | 9252211 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 8382582 Uniquely mapped reads % | 90.60% Average mapped length | 290.88 Number of splices: Total | 8115641 Number of splices: Annotated (sjdb) | 7921561 Number of splices: GT/AG | 7961548 Number of splices: GC/AG | 117144 Number of splices: AT/AC | 8676 Number of splices: Non-canonical | 28273 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 3.17 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 237018 % of reads mapped to multiple loci | 2.56% Number of reads mapped to too many loci | 129705 % of reads mapped to too many loci | 1.40% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.16% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 632611 632611 632611 N_multimapping 237018 237018 237018 N_noFeature 220169 8304262 265572 N_ambiguous 81789 493 48549 UnstrandedReadsAssigned:8080624 PositiveStrandReadsAssigned:77827 NegativeStrandReadsAssigned:8068461 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR26075322 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR26075322-trimmed-pair1.fastq SRR26075322-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,252,211 reads, 8,184,439 reads pseudoaligned [quant] estimated average fragment length: 226.821 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 983 rounds 52401 SRR26075322.ke.tsv 34699 SRR26075322.se.tsv 87100 total ==> SRR26075322.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.18 756 52.0227 Potri.005G024800.1.v4.1 1035 809.179 728 110.953 Potri.004G059700.1.v4.1 961 735.245 0 0 Potri.007G009000.2.v4.1 1416 1190.18 0 0 Potri.003G141000.2.v4.1 2943 2717.18 358 16.2487 Potri.016G087400.1.v4.1 270 96.7985 493 628.103 Potri.015G069301.1.v4.1 564 345.933 0 0 Potri.010G195200.1.v4.1 1773 1547.18 236.909 18.8839 Potri.012G127500.1.v4.1 977 751.224 2358 387.104 ==> SRR26075322.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 73 Potri.001G212900.v4.1 9 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 931 SRR26075322 completed mapping pipeline successfully