Starting /dee2/code/volunteer_pipeline.sh SRR26075323 current disk space = 3053182222336 free memory = 1579874736 SRR26075323 SRAfilesize 644e2331326eae2cdcf38b26a56668cf SRR26075323.sra SRR26075323.sra file validated SRR26075323 is paired end SRR26075323 is conventional basespace SRR26075323 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR26075323_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2485 37.0 37.0 37.0 37.0 37.0 2 36.2465 37.0 37.0 37.0 37.0 37.0 3 36.554 37.0 37.0 37.0 37.0 37.0 4 36.5165 37.0 37.0 37.0 37.0 37.0 5 36.6115 37.0 37.0 37.0 37.0 37.0 6 36.63 37.0 37.0 37.0 37.0 37.0 7 36.6005 37.0 37.0 37.0 37.0 37.0 8 36.6745 37.0 37.0 37.0 37.0 37.0 9 36.656 37.0 37.0 37.0 37.0 37.0 10-14 36.665099999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.600100000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.580600000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.5555 37.0 37.0 37.0 37.0 37.0 30-34 36.52140000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.494299999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.43149999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.3996 37.0 37.0 37.0 37.0 37.0 50-54 36.4288 37.0 37.0 37.0 37.0 37.0 55-59 36.3389 37.0 37.0 37.0 37.0 37.0 60-64 36.355 37.0 37.0 37.0 37.0 37.0 65-69 36.28530000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.2501 37.0 37.0 37.0 37.0 37.0 75-79 36.23989999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.1805 37.0 37.0 37.0 37.0 37.0 85-89 36.2042 37.0 37.0 37.0 37.0 37.0 90-94 36.1114 37.0 37.0 37.0 37.0 37.0 95-99 36.0967 37.0 37.0 37.0 37.0 37.0 100-104 36.0636 37.0 37.0 37.0 37.0 37.0 105-109 35.981700000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.859500000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.838100000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.7486 37.0 37.0 37.0 37.0 37.0 125-129 35.805 37.0 37.0 37.0 37.0 37.0 130-134 35.7468 37.0 37.0 37.0 37.0 37.0 135-139 35.4987 37.0 37.0 37.0 37.0 37.0 140-144 35.369 37.0 37.0 37.0 37.0 37.0 145-149 35.18059999999999 37.0 37.0 37.0 29.8 37.0 150-151 34.92075 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 1.0 20 2.0 21 1.0 22 0.0 23 1.0 24 0.0 25 7.0 26 13.0 27 16.0 28 27.0 29 20.0 30 38.0 31 42.0 32 57.0 33 76.0 34 124.0 35 313.0 36 2686.0 37 575.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.125000000000004 13.350000000000001 8.825 46.7 2 17.9 13.875000000000002 37.05 31.175000000000004 3 17.974999999999998 15.525 28.125 38.375 4 21.349999999999998 24.15 24.45 30.049999999999997 5 25.124999999999996 29.7 25.025 20.150000000000002 6 21.45 34.125 21.875 22.55 7 15.525 27.900000000000002 39.725 16.85 8 18.05 26.35 32.2 23.400000000000002 9 18.15 22.675 35.5 23.674999999999997 10-14 19.470000000000002 29.635 28.355000000000004 22.54 15-19 19.375 28.060000000000002 27.985 24.58 20-24 20.34 27.765 27.939999999999998 23.955000000000002 25-29 20.150000000000002 28.310000000000002 27.694999999999997 23.845 30-34 20.095 28.4 27.169999999999998 24.335 35-39 20.23 27.884999999999998 27.85 24.035 40-44 19.835 28.525 27.445000000000004 24.195 45-49 20.575 27.865000000000002 27.295 24.265 50-54 20.305 27.439999999999998 28.335 23.919999999999998 55-59 20.294999999999998 27.139999999999997 28.565 24.0 60-64 20.48 27.33 27.825 24.365000000000002 65-69 20.18 28.075 27.605 24.14 70-74 19.89 27.92 27.99 24.2 75-79 20.59 27.855 27.935 23.62 80-84 20.735 28.294999999999998 27.725 23.244999999999997 85-89 20.885 27.755000000000003 27.855 23.505000000000003 90-94 20.68 27.805000000000003 27.625 23.89 95-99 20.605 27.66 27.345000000000002 24.39 100-104 20.465 27.639999999999997 28.005000000000003 23.89 105-109 20.830000000000002 28.07 27.084999999999997 24.015 110-114 20.28 28.53 27.43 23.76 115-119 20.865000000000002 28.585 26.884999999999998 23.665 120-124 21.295 27.61 27.05 24.044999999999998 125-129 21.0 27.425 27.150000000000002 24.425 130-134 20.835 28.28 26.02 24.865000000000002 135-139 20.685000000000002 27.6 27.034999999999997 24.68 140-144 21.16 27.639999999999997 26.995 24.205 145-149 21.240000000000002 27.685 27.07 24.005000000000003 150-151 22.025 27.187499999999996 26.0 24.7875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 1.5 25 2.5 26 2.0 27 4.5 28 8.5 29 11.0 30 15.5 31 25.5 32 30.5 33 35.0 34 49.5 35 65.0 36 82.0 37 95.5 38 119.0 39 163.0 40 194.0 41 204.0 42 230.5 43 263.0 44 277.5 45 262.0 46 247.0 47 246.5 48 237.0 49 210.5 50 177.0 51 159.0 52 129.5 53 96.0 54 73.5 55 53.5 56 42.5 57 39.5 58 34.5 59 28.0 60 21.5 61 15.0 62 11.0 63 10.0 64 7.0 65 5.0 66 5.0 67 2.5 68 1.0 69 0.5 70 0.5 71 1.0 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.125 #Duplication Level Percentage of deduplicated Percentage of total 1 96.33289986996098 92.60000000000001 2 3.355006501950585 6.45 3 0.26007802340702213 0.75 4 0.05201560468140442 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.3 0.0 0.0 0.0 0.0 78-79 0.475 0.0 0.0 0.0 0.0 80-81 0.6125 0.0 0.0 0.0 0.0 82-83 0.675 0.0 0.0 0.0 0.0 84-85 0.775 0.0 0.0 0.0 0.0 86-87 0.95 0.0 0.0 0.0 0.0 88-89 1.0875 0.0 0.0 0.0 0.0 90-91 1.325 0.0 0.0 0.0 0.0 92-93 1.6625 0.0 0.0 0.0 0.0 94-95 1.9874999999999998 0.0 0.0 0.0 0.0 96-97 2.2874999999999996 0.0 0.0 0.0 0.0 98-99 2.625 0.0 0.0 0.0 0.0 100-101 2.9875 0.0 0.0 0.0 0.0 102-103 3.25 0.0 0.0 0.0 0.0 104-105 3.675 0.0 0.0 0.0 0.0 106-107 4.175 0.0 0.0 0.0 0.0 108-109 4.6 0.0 0.0 0.0 0.0 110-111 5.2125 0.0 0.0 0.0 0.0 112-113 5.7625 0.0 0.0 0.0 0.0 114-115 6.3625 0.0 0.0 0.0 0.0 116-117 7.025 0.0 0.0 0.0 0.0 118-119 7.775 0.0 0.0 0.0 0.0 120-121 8.600000000000001 0.0 0.0 0.0 0.0 122-123 9.3 0.0 0.0 0.0 0.0 124-125 9.912500000000001 0.0 0.0 0.0 0.0 126-127 10.4875 0.0 0.0 0.0 0.0 128-129 11.125 0.0 0.0 0.0 0.0 130-131 11.7625 0.0 0.0 0.0 0.0 132-133 12.3875 0.0 0.0 0.0 0.0 134-135 13.0625 0.0 0.0 0.0 0.0 136-137 13.6375 0.0 0.0 0.0 0.0 138-139 14.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGTTTT 10 0.006830828 145.0 2 >>END_MODULE SRR26075323 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR26075323_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.312 37.0 37.0 37.0 37.0 37.0 2 36.476 37.0 37.0 37.0 37.0 37.0 3 36.4535 37.0 37.0 37.0 37.0 37.0 4 36.5165 37.0 37.0 37.0 37.0 37.0 5 36.4875 37.0 37.0 37.0 37.0 37.0 6 36.536 37.0 37.0 37.0 37.0 37.0 7 36.4775 37.0 37.0 37.0 37.0 37.0 8 36.6085 37.0 37.0 37.0 37.0 37.0 9 36.599 37.0 37.0 37.0 37.0 37.0 10-14 36.4919 37.0 37.0 37.0 37.0 37.0 15-19 36.502300000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.445899999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.4014 37.0 37.0 37.0 37.0 37.0 30-34 36.4406 37.0 37.0 37.0 37.0 37.0 35-39 36.3561 37.0 37.0 37.0 37.0 37.0 40-44 36.3613 37.0 37.0 37.0 37.0 37.0 45-49 36.312200000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.3219 37.0 37.0 37.0 37.0 37.0 55-59 36.2374 37.0 37.0 37.0 37.0 37.0 60-64 36.20870000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.1728 37.0 37.0 37.0 37.0 37.0 70-74 36.1401 37.0 37.0 37.0 37.0 37.0 75-79 36.106700000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.0751 37.0 37.0 37.0 37.0 37.0 85-89 35.9962 37.0 37.0 37.0 37.0 37.0 90-94 35.976600000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.916900000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.8899 37.0 37.0 37.0 37.0 37.0 105-109 35.810500000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.7548 37.0 37.0 37.0 37.0 37.0 115-119 35.7941 37.0 37.0 37.0 37.0 37.0 120-124 35.6564 37.0 37.0 37.0 37.0 37.0 125-129 35.545 37.0 37.0 37.0 37.0 37.0 130-134 35.4863 37.0 37.0 37.0 34.6 37.0 135-139 35.392 37.0 37.0 37.0 37.0 37.0 140-144 35.2796 37.0 37.0 37.0 34.6 37.0 145-149 35.1002 37.0 37.0 37.0 27.4 37.0 150-151 34.80625 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 2.0 14 2.0 15 0.0 16 2.0 17 0.0 18 1.0 19 1.0 20 4.0 21 4.0 22 0.0 23 2.0 24 6.0 25 9.0 26 12.0 27 16.0 28 16.0 29 21.0 30 21.0 31 39.0 32 48.0 33 77.0 34 143.0 35 460.0 36 2667.0 37 445.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.35 20.974999999999998 13.875000000000002 29.799999999999997 2 26.650000000000002 25.525 32.525 15.299999999999999 3 19.975 27.85 33.1 19.075 4 24.8 32.300000000000004 24.2 18.7 5 25.4 34.475 23.25 16.875 6 21.525 38.25 22.375 17.849999999999998 7 20.1 23.35 38.375 18.175 8 21.8 24.625 28.95 24.625 9 23.925 25.025 29.525000000000002 21.525 10-14 23.48 28.925 26.169999999999998 21.425 15-19 23.62 27.779999999999998 27.425 21.175 20-24 23.375 28.194999999999997 27.12 21.310000000000002 25-29 23.185 28.315 27.785 20.715 30-34 23.080000000000002 27.775 28.025 21.12 35-39 23.525 28.515 27.405 20.555 40-44 22.615 28.48 28.255000000000003 20.65 45-49 23.395 28.345 27.62 20.64 50-54 23.830000000000002 28.23 27.615000000000002 20.325 55-59 23.880000000000003 27.97 27.38 20.77 60-64 23.515 28.34 27.16 20.985 65-69 24.01 28.01 27.36 20.62 70-74 23.44 28.58 27.235 20.745 75-79 24.310000000000002 28.599999999999998 26.745 20.345 80-84 23.465 28.4 27.339999999999996 20.794999999999998 85-89 23.695 28.515 27.255000000000003 20.535 90-94 24.235 28.215 27.250000000000004 20.3 95-99 24.45 29.005 26.66 19.885 100-104 24.745 28.785 26.740000000000002 19.73 105-109 24.915000000000003 27.935 26.935 20.215 110-114 24.490000000000002 28.625 26.52 20.365 115-119 25.224999999999998 28.299999999999997 26.525 19.950000000000003 120-124 25.72 28.57 26.58 19.13 125-129 26.090000000000003 27.950000000000003 26.474999999999998 19.485 130-134 25.895000000000003 27.93 26.295 19.88 135-139 25.955000000000002 28.15 26.450000000000003 19.445 140-144 25.929999999999996 28.08 26.6 19.39 145-149 26.61 27.474999999999998 26.695 19.220000000000002 150-151 27.0125 27.962500000000002 26.400000000000002 18.625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.5 11 1.0 12 0.5 13 0.5 14 0.5 15 1.0 16 1.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 0.0 25 1.0 26 3.5 27 4.5 28 5.5 29 9.0 30 13.5 31 20.0 32 28.5 33 36.5 34 44.5 35 65.5 36 92.5 37 111.0 38 128.5 39 178.0 40 219.5 41 218.5 42 243.5 43 274.5 44 288.0 45 276.5 46 252.5 47 235.0 48 209.5 49 194.5 50 163.0 51 124.5 52 98.5 53 94.0 54 81.5 55 58.5 56 43.0 57 36.0 58 32.5 59 18.5 60 16.0 61 11.5 62 9.0 63 11.5 64 9.0 65 7.0 66 6.0 67 4.0 68 2.5 69 1.5 70 1.0 71 0.0 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.875 #Duplication Level Percentage of deduplicated Percentage of total 1 96.11473272490223 92.15 2 3.572359843546284 6.8500000000000005 3 0.20860495436766624 0.6 4 0.10430247718383312 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.07500000000000001 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.325 0.0 0.0 0.0 0.0 78-79 0.5 0.0 0.0 0.0 0.0 80-81 0.6375 0.0 0.0 0.0 0.0 82-83 0.7 0.0 0.0 0.0 0.0 84-85 0.8 0.0 0.0 0.0 0.0 86-87 0.975 0.0 0.0 0.0 0.0 88-89 1.1124999999999998 0.0 0.0 0.0 0.0 90-91 1.35 0.0 0.0 0.0 0.0 92-93 1.6875 0.0 0.0 0.0 0.0 94-95 1.9874999999999998 0.0 0.0 0.0 0.0 96-97 2.2625 0.0 0.0 0.0 0.0 98-99 2.6125 0.0 0.0 0.0 0.0 100-101 2.9875 0.0 0.0 0.0 0.0 102-103 3.2625 0.0 0.0 0.0 0.0 104-105 3.7 0.0 0.0 0.0 0.0 106-107 4.2125 0.0 0.0 0.0 0.0 108-109 4.65 0.0 0.0 0.0 0.0 110-111 5.25 0.0 0.0 0.0 0.0 112-113 5.7875 0.0 0.0 0.0 0.0 114-115 6.375 0.0 0.0 0.0 0.0 116-117 7.0375 0.0 0.0 0.0 0.0 118-119 7.825 0.0 0.0 0.0 0.0 120-121 8.6125 0.0 0.0 0.0 0.0 122-123 9.2625 0.0 0.0 0.0 0.0 124-125 9.9 0.0 0.0 0.0 0.0 126-127 10.4875 0.0 0.0 0.0 0.0 128-129 11.125 0.0 0.0 0.0 0.0 130-131 11.825 0.0 0.0 0.0 0.0 132-133 12.525 0.0 0.0 0.0 0.0 134-135 13.1875 0.0 0.0 0.0 0.0 136-137 13.75 0.0 0.0 0.0 0.0 138-139 14.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 412453 spots for SRR26075323.sra Written 412453 spots for SRR26075323.sra Read 412453 spots for SRR26075323.sra Written 412453 spots for SRR26075323.sra Read 412453 spots for SRR26075323.sra Written 412453 spots for SRR26075323.sra Read 412453 spots for SRR26075323.sra Written 412453 spots for SRR26075323.sra Read 412453 spots for SRR26075323.sra Written 412453 spots for SRR26075323.sra Read 412453 spots for SRR26075323.sra Written 412453 spots for SRR26075323.sra Read 412453 spots for SRR26075323.sra Written 412453 spots for SRR26075323.sra Read 412453 spots for SRR26075323.sra Written 412453 spots for SRR26075323.sra Read 412453 spots for SRR26075323.sra Written 412453 spots for SRR26075323.sra Read 412453 spots for SRR26075323.sra Written 412453 spots for SRR26075323.sra Read 412453 spots for SRR26075323.sra Written 412453 spots for SRR26075323.sra Read 412453 spots for SRR26075323.sra Written 412453 spots for SRR26075323.sra Read 412453 spots for SRR26075323.sra Written 412453 spots for SRR26075323.sra Read 412453 spots for SRR26075323.sra Written 412453 spots for SRR26075323.sra Read 412453 spots for SRR26075323.sra Written 412453 spots for SRR26075323.sra Read 412457 spots for SRR26075323.sra Written 412457 spots for SRR26075323.sra Read 412453 spots for SRR26075323.sra Written 412453 spots for SRR26075323.sra Read 412453 spots for SRR26075323.sra Written 412453 spots for SRR26075323.sra Read 412453 spots for SRR26075323.sra Written 412453 spots for SRR26075323.sra Read 412453 spots for SRR26075323.sra Written 412453 spots for SRR26075323.sra SRR ids: ['SRR26075323.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cp734i8e SRR26075323.sra spots: 8249064 blocks: [[1, 412453], [412454, 824906], [824907, 1237359], [1237360, 1649812], [1649813, 2062265], [2062266, 2474718], [2474719, 2887171], [2887172, 3299624], [3299625, 3712077], [3712078, 4124530], [4124531, 4536983], [4536984, 4949436], [4949437, 5361889], [5361890, 5774342], [5774343, 6186795], [6186796, 6599248], [6599249, 7011701], [7011702, 7424154], [7424155, 7836607], [7836608, 8249064]] SRR26075323 file size 3039680 SRR26075323 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR26075323 SRR26075323_1.fastq SRR26075323_2.fastq Input file: SRR26075323_1.fastq Paired file: SRR26075323_2.fastq trimmed: SRR26075323-trimmed-pair1.fastq, SRR26075323-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 20:13:16 2025 >> started Tue Feb 11 20:13:25 2025 >> done (9.365s) 8249064 read pairs processed; of these: 10 ( 0.00%) short read pairs filtered out after trimming by size control 3760 ( 0.05%) empty read pairs filtered out after trimming by size control 8245294 (99.95%) read pairs available; of these: 1602564 (19.44%) trimmed read pairs available after processing 6642730 (80.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 1 0.00% 22 1 0.00% 23 2 0.00% 24 5 0.00% 25 2 0.00% 26 3 0.00% 27 4 0.00% 28 11 0.00% 29 6 0.00% 30 8 0.00% 31 8 0.00% 32 10 0.00% 33 4 0.00% 34 12 0.00% 35 7 0.00% 36 12 0.00% 37 18 0.00% 38 8 0.00% 39 29 0.00% 40 29 0.00% 41 39 0.00% 42 31 0.00% 43 39 0.00% 44 42 0.00% 45 41 0.00% 46 30 0.00% 47 35 0.00% 48 67 0.00% 49 98 0.00% 50 108 0.00% 51 123 0.00% 52 143 0.00% 53 139 0.00% 54 146 0.00% 55 141 0.00% 56 199 0.00% 57 196 0.00% 58 231 0.00% 59 296 0.00% 60 319 0.00% 61 417 0.01% 62 419 0.01% 63 494 0.01% 64 575 0.01% 65 653 0.01% 66 717 0.01% 67 781 0.01% 68 920 0.01% 69 1100 0.01% 70 1330 0.02% 71 1372 0.02% 72 1629 0.02% 73 1809 0.02% 74 2007 0.02% 75 2328 0.03% 76 2609 0.03% 77 2777 0.03% 78 3210 0.04% 79 3377 0.04% 80 3733 0.05% 81 4219 0.05% 82 4727 0.06% 83 5317 0.06% 84 5833 0.07% 85 6320 0.08% 86 6869 0.08% 87 7357 0.09% 88 7801 0.09% 89 8299 0.10% 90 8926 0.11% 91 9555 0.12% 92 10109 0.12% 93 10856 0.13% 94 11680 0.14% 95 12497 0.15% 96 13073 0.16% 97 13929 0.17% 98 13979 0.17% 99 14920 0.18% 100 15555 0.19% 101 16072 0.19% 102 16716 0.20% 103 17354 0.21% 104 17830 0.22% 105 18792 0.23% 106 19643 0.24% 107 20316 0.25% 108 20770 0.25% 109 21101 0.26% 110 21540 0.26% 111 22178 0.27% 112 22609 0.27% 113 22709 0.28% 114 23530 0.29% 115 24487 0.30% 116 24953 0.30% 117 25360 0.31% 118 26179 0.32% 119 26377 0.32% 120 26741 0.32% 121 27118 0.33% 122 27256 0.33% 123 27667 0.34% 124 28166 0.34% 125 28463 0.35% 126 28795 0.35% 127 29564 0.36% 128 29854 0.36% 129 30074 0.36% 130 30802 0.37% 131 30612 0.37% 132 30908 0.37% 133 31104 0.38% 134 30947 0.38% 135 31560 0.38% 136 32228 0.39% 137 32140 0.39% 138 32617 0.40% 139 32765 0.40% 140 33164 0.40% 141 32969 0.40% 142 33031 0.40% 143 33388 0.40% 144 33263 0.40% 145 33107 0.40% 146 33131 0.40% 147 33569 0.41% 148 33798 0.41% 149 34098 0.41% 150 34427 0.42% 151 6642730 80.56% 8245294 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.14 fanout-score-rank=30 prefix-density=0.28 prefix-fanout=2.2 sequence=CACTTGCAGCCATTCTC criterion=fanout-score sequence-density=0.07 sequence-density-rank=20 fanout-score=385.89 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=36.7 sequence=TTCTTCTTCTCTG criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.61 fanout-score-rank=32 prefix-density=0.25 prefix-fanout=2.5 sequence=ATGTACCCTGAC criterion=fanout-score sequence-density=0.09 sequence-density-rank=14 fanout-score=370.21 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=35.8 sequence=AAGAAGAAGAAA SRR26075323 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 20:15:11 Started mapping on | Feb 11 20:15:11 Finished on | Feb 11 20:16:43 Mapping speed, Million of reads per hour | 322.64 Number of input reads | 8245294 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 7542635 Uniquely mapped reads % | 91.48% Average mapped length | 289.95 Number of splices: Total | 6665150 Number of splices: Annotated (sjdb) | 6502512 Number of splices: GT/AG | 6538399 Number of splices: GC/AG | 98334 Number of splices: AT/AC | 6315 Number of splices: Non-canonical | 22102 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 3.07 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 193109 % of reads mapped to multiple loci | 2.34% Number of reads mapped to too many loci | 19744 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.83% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 509550 509550 509550 N_multimapping 193109 193109 193109 N_noFeature 290276 7471560 328332 N_ambiguous 78118 366 44915 UnstrandedReadsAssigned:7174241 PositiveStrandReadsAssigned:70709 NegativeStrandReadsAssigned:7169388 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR26075323 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR26075323-trimmed-pair1.fastq SRR26075323-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,245,294 reads, 7,198,009 reads pseudoaligned [quant] estimated average fragment length: 227.783 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,006 rounds 52401 SRR26075323.ke.tsv 34699 SRR26075323.se.tsv 87100 total ==> SRR26075323.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.22 1022 84.7745 Potri.005G024800.1.v4.1 1035 808.217 495 90.9997 Potri.004G059700.1.v4.1 961 734.329 3 0.607007 Potri.007G009000.2.v4.1 1416 1189.22 0 0 Potri.003G141000.2.v4.1 2943 2716.22 364 19.9113 Potri.016G087400.1.v4.1 270 98.8164 451 678.126 Potri.015G069301.1.v4.1 564 346.249 0 0 Potri.010G195200.1.v4.1 1773 1546.22 194 18.6421 Potri.012G127500.1.v4.1 977 750.304 913 180.799 ==> SRR26075323.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 33 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 85 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 561 SRR26075323 completed mapping pipeline successfully