Starting /dee2/code/volunteer_pipeline.sh SRR26075324 current disk space = 3053450817536 free memory = 1403706340 SRR26075324 SRAfilesize b8e294b8d7e215577ef900d7679b4425 SRR26075324.sra SRR26075324.sra file validated SRR26075324 is paired end SRR26075324 is conventional basespace SRR26075324 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR26075324_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2905 37.0 37.0 37.0 37.0 37.0 2 36.411 37.0 37.0 37.0 37.0 37.0 3 36.5655 37.0 37.0 37.0 37.0 37.0 4 36.574 37.0 37.0 37.0 37.0 37.0 5 36.6515 37.0 37.0 37.0 37.0 37.0 6 36.745 37.0 37.0 37.0 37.0 37.0 7 36.6625 37.0 37.0 37.0 37.0 37.0 8 36.7165 37.0 37.0 37.0 37.0 37.0 9 36.6685 37.0 37.0 37.0 37.0 37.0 10-14 36.712599999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.6791 37.0 37.0 37.0 37.0 37.0 20-24 36.6712 37.0 37.0 37.0 37.0 37.0 25-29 36.59590000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.5792 37.0 37.0 37.0 37.0 37.0 35-39 36.5144 37.0 37.0 37.0 37.0 37.0 40-44 36.5033 37.0 37.0 37.0 37.0 37.0 45-49 36.4593 37.0 37.0 37.0 37.0 37.0 50-54 36.4301 37.0 37.0 37.0 37.0 37.0 55-59 36.406 37.0 37.0 37.0 37.0 37.0 60-64 36.3938 37.0 37.0 37.0 37.0 37.0 65-69 36.3849 37.0 37.0 37.0 37.0 37.0 70-74 36.344300000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.31680000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.254000000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.2605 37.0 37.0 37.0 37.0 37.0 90-94 36.17900000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.1325 37.0 37.0 37.0 37.0 37.0 100-104 36.098800000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.9976 37.0 37.0 37.0 37.0 37.0 110-114 36.0245 37.0 37.0 37.0 37.0 37.0 115-119 35.8727 37.0 37.0 37.0 37.0 37.0 120-124 35.823800000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.877700000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.805099999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.6048 37.0 37.0 37.0 37.0 37.0 140-144 35.469100000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.190000000000005 37.0 37.0 37.0 27.4 37.0 150-151 34.938 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 2.0 23 3.0 24 3.0 25 4.0 26 6.0 27 14.0 28 17.0 29 19.0 30 26.0 31 48.0 32 65.0 33 83.0 34 99.0 35 315.0 36 2661.0 37 633.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.725 13.675 9.825000000000001 39.775 2 19.0 12.575 35.8 32.625 3 18.325 17.95 27.075 36.65 4 21.925 24.675 23.375 30.025000000000002 5 24.05 30.3 24.775 20.875 6 22.225 33.45 23.225 21.099999999999998 7 15.174999999999999 28.349999999999998 39.25 17.224999999999998 8 18.05 27.400000000000002 30.4 24.15 9 18.025 24.075 34.75 23.150000000000002 10-14 19.62 30.185000000000002 27.22 22.975 15-19 20.095 27.089999999999996 28.439999999999998 24.375 20-24 20.135 28.285 27.334999999999997 24.245 25-29 20.51 28.310000000000002 27.325 23.855 30-34 19.64 28.610000000000003 27.24 24.51 35-39 20.105 28.09 27.950000000000003 23.855 40-44 20.115 28.765 27.275 23.845 45-49 19.935 28.345 27.67 24.05 50-54 20.195 28.24 27.48 24.085 55-59 20.445 27.705000000000002 27.87 23.98 60-64 20.349999999999998 28.38 27.169999999999998 24.099999999999998 65-69 20.044999999999998 28.155 27.794999999999998 24.005000000000003 70-74 20.64 28.155 27.0 24.205 75-79 20.265 28.24 27.705000000000002 23.79 80-84 20.79 27.900000000000002 27.565 23.745 85-89 20.505000000000003 27.925 27.685 23.885 90-94 20.974999999999998 27.384999999999998 27.744999999999997 23.895 95-99 20.735 27.310000000000002 27.675 24.279999999999998 100-104 21.12 27.925 27.43 23.525 105-109 21.029999999999998 27.950000000000003 27.334999999999997 23.685000000000002 110-114 20.86 28.005000000000003 27.185 23.95 115-119 21.33 28.325 27.13 23.215 120-124 21.92 27.955000000000002 26.290000000000003 23.835 125-129 21.165 28.105000000000004 26.455000000000002 24.275 130-134 21.435000000000002 27.779999999999998 26.83 23.955000000000002 135-139 21.224999999999998 28.09 26.26 24.425 140-144 21.745 27.73 26.775 23.75 145-149 21.625 28.349999999999998 25.874999999999996 24.15 150-151 21.275 27.712500000000002 25.525 25.4875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 0.5 18 0.0 19 1.0 20 1.5 21 1.5 22 2.0 23 2.0 24 3.0 25 3.5 26 3.5 27 6.0 28 6.0 29 5.5 30 10.0 31 16.0 32 24.0 33 33.5 34 43.0 35 64.0 36 86.0 37 100.5 38 122.0 39 149.5 40 189.5 41 215.5 42 238.5 43 253.0 44 270.0 45 287.0 46 278.0 47 237.5 48 211.5 49 206.5 50 173.0 51 151.5 52 128.5 53 100.5 54 76.5 55 60.5 56 50.5 57 40.5 58 27.5 59 21.5 60 24.0 61 17.0 62 8.5 63 7.0 64 9.5 65 8.0 66 4.0 67 5.0 68 5.0 69 2.5 70 2.5 71 1.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.25 #Duplication Level Percentage of deduplicated Percentage of total 1 95.30183727034121 90.77499999999999 2 4.435695538057742 8.450000000000001 3 0.23622047244094488 0.675 4 0.026246719160104987 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0125 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.4375 0.0 0.0 0.0 0.0 86-87 0.6125 0.0 0.0 0.0 0.0 88-89 0.7124999999999999 0.0 0.0 0.0 0.0 90-91 0.875 0.0 0.0 0.0 0.0 92-93 1.025 0.0 0.0 0.0 0.0 94-95 1.2375 0.0 0.0 0.0 0.0 96-97 1.4 0.0 0.0 0.0 0.0 98-99 1.5875 0.0 0.0 0.0 0.0 100-101 1.8 0.0 0.0 0.0 0.0 102-103 2.15 0.0 0.0 0.0 0.0 104-105 2.6375 0.0 0.0 0.0 0.0 106-107 2.9875 0.0 0.0 0.0 0.0 108-109 3.3 0.0 0.0 0.0 0.0 110-111 3.7625 0.0 0.0 0.0 0.0 112-113 4.3 0.0 0.0 0.0 0.0 114-115 4.8125 0.0 0.0 0.0 0.0 116-117 5.275 0.0 0.0 0.0 0.0 118-119 5.8375 0.0 0.0 0.0 0.0 120-121 6.449999999999999 0.0 0.0 0.0 0.0 122-123 7.25 0.0 0.0 0.0 0.0 124-125 7.9375 0.0 0.0 0.0 0.0 126-127 8.6625 0.0 0.0 0.0 0.0 128-129 9.25 0.0 0.0 0.0 0.0 130-131 9.8125 0.0 0.0 0.0 0.0 132-133 10.462499999999999 0.0 0.0 0.0 0.0 134-135 11.0625 0.0 0.0 0.0 0.0 136-137 11.8125 0.0 0.0 0.0 0.0 138-139 12.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR26075324 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR26075324_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.334 37.0 37.0 37.0 37.0 37.0 2 36.402 37.0 37.0 37.0 37.0 37.0 3 36.4005 37.0 37.0 37.0 37.0 37.0 4 36.3615 37.0 37.0 37.0 37.0 37.0 5 36.395 37.0 37.0 37.0 37.0 37.0 6 36.491 37.0 37.0 37.0 37.0 37.0 7 36.4135 37.0 37.0 37.0 37.0 37.0 8 36.4635 37.0 37.0 37.0 37.0 37.0 9 36.5095 37.0 37.0 37.0 37.0 37.0 10-14 36.454600000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.4269 37.0 37.0 37.0 37.0 37.0 20-24 36.360699999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.305600000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.2275 37.0 37.0 37.0 37.0 37.0 35-39 36.217200000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.224000000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.160399999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.1374 37.0 37.0 37.0 37.0 37.0 55-59 36.055899999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.0281 37.0 37.0 37.0 37.0 37.0 65-69 35.9815 37.0 37.0 37.0 37.0 37.0 70-74 36.0201 37.0 37.0 37.0 37.0 37.0 75-79 35.9342 37.0 37.0 37.0 37.0 37.0 80-84 35.8868 37.0 37.0 37.0 37.0 37.0 85-89 35.8698 37.0 37.0 37.0 37.0 37.0 90-94 35.8587 37.0 37.0 37.0 37.0 37.0 95-99 35.7558 37.0 37.0 37.0 37.0 37.0 100-104 35.6579 37.0 37.0 37.0 37.0 37.0 105-109 35.573899999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.5637 37.0 37.0 37.0 37.0 37.0 115-119 35.584500000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.39659999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.416599999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.259699999999995 37.0 37.0 37.0 34.6 37.0 135-139 35.2004 37.0 37.0 37.0 34.6 37.0 140-144 35.0741 37.0 37.0 37.0 27.4 37.0 145-149 34.900999999999996 37.0 37.0 37.0 25.0 37.0 150-151 34.786500000000004 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 5.0 14 5.0 15 6.0 16 1.0 17 0.0 18 4.0 19 0.0 20 2.0 21 9.0 22 6.0 23 9.0 24 6.0 25 13.0 26 7.0 27 11.0 28 16.0 29 21.0 30 38.0 31 34.0 32 43.0 33 81.0 34 143.0 35 514.0 36 2664.0 37 362.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.35 22.1 13.675 26.875 2 27.925 25.95 27.825 18.3 3 21.15 28.525 30.475 19.85 4 23.575 34.599999999999994 24.025 17.8 5 25.124999999999996 36.175000000000004 21.825 16.875 6 20.25 40.0 21.475 18.275 7 21.25 22.25 37.0 19.5 8 22.3 25.5 27.525 24.675 9 22.85 25.2 28.475 23.474999999999998 10-14 23.29 29.459999999999997 25.679999999999996 21.57 15-19 23.13 28.125 27.395000000000003 21.349999999999998 20-24 24.0 28.675 26.625 20.7 25-29 23.985 27.77 26.950000000000003 21.295 30-34 23.395 28.07 27.265 21.27 35-39 23.665 28.265 27.29 20.78 40-44 23.575 27.52 27.88 21.025 45-49 23.52 27.63 27.37 21.48 50-54 23.244999999999997 28.494999999999997 27.325 20.935000000000002 55-59 23.815 27.915 27.325 20.945 60-64 23.645 28.21 27.625 20.52 65-69 23.465 28.34 27.029999999999998 21.165 70-74 23.79 28.275 27.27 20.665 75-79 23.465 28.065 27.650000000000002 20.82 80-84 23.995 28.125 27.01 20.87 85-89 24.2 28.865000000000002 27.015 19.919999999999998 90-94 23.94 28.535 27.22 20.305 95-99 23.815 28.525 27.26 20.4 100-104 24.525 28.525 26.634999999999998 20.315 105-109 24.32 27.805000000000003 27.675 20.200000000000003 110-114 24.895 28.915000000000003 26.450000000000003 19.74 115-119 24.57 28.48 26.415 20.535 120-124 25.369999999999997 28.23 26.855 19.545 125-129 25.569999999999997 28.470000000000002 26.505000000000003 19.455 130-134 25.919999999999998 27.72 27.015 19.345000000000002 135-139 26.314999999999998 28.235 25.869999999999997 19.580000000000002 140-144 26.295 28.310000000000002 26.205000000000002 19.189999999999998 145-149 27.21 28.025 25.995 18.77 150-151 27.275 28.275 25.9625 18.4875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 1.0 5 1.0 6 0.5 7 0.5 8 1.5 9 1.5 10 0.5 11 0.0 12 0.5 13 2.0 14 2.5 15 1.0 16 0.0 17 0.5 18 1.5 19 1.5 20 1.0 21 2.0 22 2.5 23 2.5 24 2.5 25 3.5 26 5.5 27 5.0 28 4.5 29 5.0 30 8.0 31 16.5 32 22.5 33 26.0 34 45.5 35 64.0 36 72.5 37 98.5 38 133.5 39 172.5 40 218.0 41 228.5 42 233.0 43 257.5 44 257.0 45 250.5 46 254.0 47 250.5 48 232.0 49 205.0 50 168.0 51 141.0 52 120.0 53 100.0 54 78.5 55 59.5 56 53.5 57 38.0 58 24.5 59 20.5 60 18.5 61 12.5 62 11.5 63 11.5 64 9.0 65 8.0 66 4.0 67 2.0 68 3.0 69 3.0 70 2.5 71 1.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.5 82 1.0 83 0.5 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 1.0 91 1.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.125 #Duplication Level Percentage of deduplicated Percentage of total 1 95.34822601839684 90.7 2 4.283837056504599 8.15 3 0.31537450722733246 0.8999999999999999 4 0.026281208935611037 0.1 5 0.0 0.0 6 0.026281208935611037 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0125 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.4375 0.0 0.0 0.0 0.0 86-87 0.6125 0.0 0.0 0.0 0.0 88-89 0.7124999999999999 0.0 0.0 0.0 0.0 90-91 0.85 0.0 0.0 0.0 0.0 92-93 1.0 0.0 0.0 0.0 0.0 94-95 1.2125 0.0 0.0 0.0 0.0 96-97 1.375 0.0 0.0 0.0 0.0 98-99 1.5625 0.0 0.0 0.0 0.0 100-101 1.7375 0.0 0.0 0.0 0.0 102-103 2.0875 0.0 0.0 0.0 0.0 104-105 2.55 0.0 0.0 0.0 0.0 106-107 2.8875 0.0 0.0 0.0 0.0 108-109 3.2 0.0 0.0 0.0 0.0 110-111 3.6875 0.0 0.0 0.0 0.0 112-113 4.225 0.0 0.0 0.0 0.0 114-115 4.737500000000001 0.0 0.0 0.0 0.0 116-117 5.175 0.0 0.0 0.0 0.0 118-119 5.737500000000001 0.0 0.0 0.0 0.0 120-121 6.35 0.0 0.0 0.0 0.0 122-123 7.15 0.0 0.0 0.0 0.0 124-125 7.825 0.0 0.0 0.0 0.0 126-127 8.5625 0.0 0.0 0.0 0.0 128-129 9.1375 0.0 0.0 0.0 0.0 130-131 9.675 0.0 0.0 0.0 0.0 132-133 10.35 0.0 0.0 0.0 0.0 134-135 10.9625 0.0 0.0 0.0 0.0 136-137 11.675 0.0 0.0 0.0 0.0 138-139 12.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 452287 spots for SRR26075324.sra Written 452287 spots for SRR26075324.sra Read 452287 spots for SRR26075324.sra Written 452287 spots for SRR26075324.sra Read 452287 spots for SRR26075324.sra Written 452287 spots for SRR26075324.sra Read 452287 spots for SRR26075324.sra Written 452287 spots for SRR26075324.sra Read 452287 spots for SRR26075324.sra Written 452287 spots for SRR26075324.sra Read 452287 spots for SRR26075324.sra Written 452287 spots for SRR26075324.sra Read 452295 spots for SRR26075324.sra Written 452295 spots for SRR26075324.sra Read 452287 spots for SRR26075324.sra Written 452287 spots for SRR26075324.sra Read 452287 spots for SRR26075324.sra Written 452287 spots for SRR26075324.sra Read 452287 spots for SRR26075324.sra Written 452287 spots for SRR26075324.sra Read 452287 spots for SRR26075324.sra Written 452287 spots for SRR26075324.sra Read 452287 spots for SRR26075324.sra Written 452287 spots for SRR26075324.sra Read 452287 spots for SRR26075324.sra Written 452287 spots for SRR26075324.sra Read 452287 spots for SRR26075324.sra Written 452287 spots for SRR26075324.sra Read 452287 spots for SRR26075324.sra Written 452287 spots for SRR26075324.sra Read 452287 spots for SRR26075324.sra Written 452287 spots for SRR26075324.sra Read 452287 spots for SRR26075324.sra Written 452287 spots for SRR26075324.sra Read 452287 spots for SRR26075324.sra Written 452287 spots for SRR26075324.sra Read 452287 spots for SRR26075324.sra Written 452287 spots for SRR26075324.sra Read 452287 spots for SRR26075324.sra Written 452287 spots for SRR26075324.sra SRR ids: ['SRR26075324.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_y_gbpk8a SRR26075324.sra spots: 9045748 blocks: [[1, 452287], [452288, 904574], [904575, 1356861], [1356862, 1809148], [1809149, 2261435], [2261436, 2713722], [2713723, 3166009], [3166010, 3618296], [3618297, 4070583], [4070584, 4522870], [4522871, 4975157], [4975158, 5427444], [5427445, 5879731], [5879732, 6332018], [6332019, 6784305], [6784306, 7236592], [7236593, 7688879], [7688880, 8141166], [8141167, 8593453], [8593454, 9045748]] SRR26075324 file size 3333355 SRR26075324 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR26075324 SRR26075324_1.fastq SRR26075324_2.fastq Input file: SRR26075324_1.fastq Paired file: SRR26075324_2.fastq trimmed: SRR26075324-trimmed-pair1.fastq, SRR26075324-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 18:24:21 2025 >> started Tue Feb 11 18:24:32 2025 >> done (10.862s) 9045748 read pairs processed; of these: 12 ( 0.00%) short read pairs filtered out after trimming by size control 12838 ( 0.14%) empty read pairs filtered out after trimming by size control 9032898 (99.86%) read pairs available; of these: 1577681 (17.47%) trimmed read pairs available after processing 7455217 (82.53%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 1 0.00% 21 3 0.00% 22 3 0.00% 23 5 0.00% 24 4 0.00% 25 6 0.00% 26 5 0.00% 27 3 0.00% 28 5 0.00% 29 8 0.00% 30 6 0.00% 31 10 0.00% 32 9 0.00% 33 8 0.00% 34 20 0.00% 35 16 0.00% 36 15 0.00% 37 12 0.00% 38 19 0.00% 39 29 0.00% 40 19 0.00% 41 26 0.00% 42 28 0.00% 43 21 0.00% 44 38 0.00% 45 31 0.00% 46 33 0.00% 47 40 0.00% 48 62 0.00% 49 72 0.00% 50 76 0.00% 51 75 0.00% 52 86 0.00% 53 96 0.00% 54 106 0.00% 55 113 0.00% 56 127 0.00% 57 152 0.00% 58 204 0.00% 59 209 0.00% 60 255 0.00% 61 300 0.00% 62 328 0.00% 63 345 0.00% 64 394 0.00% 65 463 0.01% 66 535 0.01% 67 546 0.01% 68 662 0.01% 69 792 0.01% 70 847 0.01% 71 1019 0.01% 72 1226 0.01% 73 1379 0.02% 74 1534 0.02% 75 1660 0.02% 76 1955 0.02% 77 2097 0.02% 78 2395 0.03% 79 2601 0.03% 80 2928 0.03% 81 3206 0.04% 82 3761 0.04% 83 4137 0.05% 84 4599 0.05% 85 5016 0.06% 86 5360 0.06% 87 5989 0.07% 88 6356 0.07% 89 6674 0.07% 90 7299 0.08% 91 8134 0.09% 92 8394 0.09% 93 9324 0.10% 94 10153 0.11% 95 10710 0.12% 96 11350 0.13% 97 12061 0.13% 98 12234 0.14% 99 12942 0.14% 100 13393 0.15% 101 14098 0.16% 102 14784 0.16% 103 15797 0.17% 104 16219 0.18% 105 17110 0.19% 106 18133 0.20% 107 18565 0.21% 108 19469 0.22% 109 19747 0.22% 110 20230 0.22% 111 20705 0.23% 112 21261 0.24% 113 21877 0.24% 114 22186 0.25% 115 23529 0.26% 116 24041 0.27% 117 24620 0.27% 118 24997 0.28% 119 25469 0.28% 120 25493 0.28% 121 26233 0.29% 122 26501 0.29% 123 27301 0.30% 124 28280 0.31% 125 28526 0.32% 126 29034 0.32% 127 29858 0.33% 128 30160 0.33% 129 30671 0.34% 130 31025 0.34% 131 31543 0.35% 132 31635 0.35% 133 32126 0.36% 134 32125 0.36% 135 32961 0.36% 136 33238 0.37% 137 33737 0.37% 138 34221 0.38% 139 34755 0.38% 140 34949 0.39% 141 35230 0.39% 142 35405 0.39% 143 35497 0.39% 144 35636 0.39% 145 36246 0.40% 146 36252 0.40% 147 36925 0.41% 148 36965 0.41% 149 37573 0.42% 150 37586 0.42% 151 7455217 82.53% 9032898 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=6.34 fanout-score-rank=16 prefix-density=0.34 prefix-fanout=3.9 sequence=TCCTTGTCCTGGATCTTGGCCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=33 fanout-score=130.99 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=10.4 sequence=CATCACCATCCCTGATTGATCTTTGATTCACAACAAGACCAACCAACCGTACAATGTTTACATAACTTGGGATAATCTCACAAGAAAGAAAGATCAATACAAAACTAGTCAGCTCAGGATGTTCCAGGCACGGTAGAACCGTAGAACCATAACAACAAGAGACATATTGCAGATGAGTACTGAAAAACAAAACACAGTACGTATTTACATGGGCAACCTTGGTTGAAGGCAACCTCATCAACGATGCTCGCTCTTCGTCTCTCCACTGTACATCCAGTCATAGACAGTGGGTGTGTTAGGCTGTGGCTTGTCAAAAACATGAGCACCAATATTCTTAGTAGCAAGGTTGCTACCAGGGTGGAACACGCTCCTCCAAACATTGCTACGCGCCGACACTGGGGTTGTAGGGGTCACTGGTGTCGTCGGTGTCCCTGGAGTTCCTGGCATAGTCATGGACCTCTGAAACTTATTAACAGGACTGCTCCCCTCTCCGACGTCAATATCTTT criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.53 fanout-score-rank=32 prefix-density=0.24 prefix-fanout=2.5 sequence=ATGTACCCTGAC criterion=fanout-score sequence-density=0.12 sequence-density-rank=16 fanout-score=26.95 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=5.7 sequence=TGATTTTGATCAGTATGGCTGAGGAAAACAAGAGCCATGAGTATGAGACCAAAGTTGGTGAAGAGAGTGGTGCTGTTGAGACCAAGGATCGCGGGTTGTTTGATTTCCTGGGGAAGAAAGAA SRR26075324 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 18:25:21 Started mapping on | Feb 11 18:25:21 Finished on | Feb 11 18:26:52 Mapping speed, Million of reads per hour | 357.35 Number of input reads | 9032898 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 8107144 Uniquely mapped reads % | 89.75% Average mapped length | 291.49 Number of splices: Total | 6766039 Number of splices: Annotated (sjdb) | 6593278 Number of splices: GT/AG | 6634155 Number of splices: GC/AG | 100618 Number of splices: AT/AC | 8072 Number of splices: Non-canonical | 23194 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 3.13 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 243659 % of reads mapped to multiple loci | 2.70% Number of reads mapped to too many loci | 22232 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.10% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 682095 682095 682095 N_multimapping 243659 243659 243659 N_noFeature 253307 8024743 302560 N_ambiguous 85297 526 51851 UnstrandedReadsAssigned:7768540 PositiveStrandReadsAssigned:81875 NegativeStrandReadsAssigned:7752733 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR26075324 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR26075324-trimmed-pair1.fastq SRR26075324-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,032,898 reads, 7,864,557 reads pseudoaligned [quant] estimated average fragment length: 226.561 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 938 rounds 52401 SRR26075324.ke.tsv 34699 SRR26075324.se.tsv 87100 total ==> SRR26075324.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.44 1360 94.7069 Potri.005G024800.1.v4.1 1035 809.439 1832 282.507 Potri.004G059700.1.v4.1 961 735.471 6 1.01829 Potri.007G009000.2.v4.1 1416 1190.44 0 0 Potri.003G141000.2.v4.1 2943 2717.44 413.429 18.9902 Potri.016G087400.1.v4.1 270 95.006 444 583.336 Potri.015G069301.1.v4.1 564 345.193 0 0 Potri.010G195200.1.v4.1 1773 1547.44 85 6.85634 Potri.012G127500.1.v4.1 977 751.455 1700 282.379 ==> SRR26075324.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 6 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 67 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 521 SRR26075324 completed mapping pipeline successfully