Starting /dee2/code/volunteer_pipeline.sh SRR26075378 current disk space = 3051670310912 free memory = 1574598980 SRR26075378 SRAfilesize 499cfe8d9c1c9cc5727c5d669dae8599 SRR26075378.sra SRR26075378.sra file validated SRR26075378 is paired end SRR26075378 is conventional basespace SRR26075378 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR26075378_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3755 37.0 37.0 37.0 37.0 37.0 2 36.3255 37.0 37.0 37.0 37.0 37.0 3 36.402 37.0 37.0 37.0 37.0 37.0 4 36.4915 37.0 37.0 37.0 37.0 37.0 5 36.493 37.0 37.0 37.0 37.0 37.0 6 36.446 37.0 37.0 37.0 37.0 37.0 7 36.3925 37.0 37.0 37.0 37.0 37.0 8 36.3855 37.0 37.0 37.0 37.0 37.0 9 36.3465 37.0 37.0 37.0 37.0 37.0 10-14 36.46079999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.3722 37.0 37.0 37.0 37.0 37.0 20-24 36.319 37.0 37.0 37.0 37.0 37.0 25-29 36.243700000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.189899999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.1294 37.0 37.0 37.0 37.0 37.0 40-44 36.106899999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.107800000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.009 37.0 37.0 37.0 37.0 37.0 55-59 35.949600000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.9121 37.0 37.0 37.0 37.0 37.0 65-69 35.8341 37.0 37.0 37.0 37.0 37.0 70-74 35.8137 37.0 37.0 37.0 37.0 37.0 75-79 35.80290000000001 37.0 37.0 37.0 37.0 37.0 80-84 35.797200000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.731 37.0 37.0 37.0 37.0 37.0 90-94 35.572799999999994 37.0 37.0 37.0 37.0 37.0 95-99 35.5112 37.0 37.0 37.0 37.0 37.0 100-104 35.52460000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.4419 37.0 37.0 37.0 37.0 37.0 110-114 35.37 37.0 37.0 37.0 37.0 37.0 115-119 35.15259999999999 37.0 37.0 37.0 29.8 37.0 120-124 35.2398 37.0 37.0 37.0 32.2 37.0 125-129 35.177499999999995 37.0 37.0 37.0 27.4 37.0 130-134 34.9584 37.0 37.0 37.0 25.0 37.0 135-139 34.7856 37.0 37.0 37.0 25.0 37.0 140-144 34.612 37.0 37.0 37.0 25.0 37.0 145-149 34.5233 37.0 37.0 37.0 25.0 37.0 150-151 34.33175 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 2.0 22 3.0 23 2.0 24 7.0 25 8.0 26 20.0 27 25.0 28 31.0 29 36.0 30 41.0 31 72.0 32 92.0 33 136.0 34 222.0 35 533.0 36 2633.0 37 135.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.07310966449675 12.969454181271908 12.368552829243866 42.58888332498748 2 19.05 15.525 36.725 28.7 3 19.15 19.75 28.075 33.025 4 20.825 28.65 24.175 26.35 5 23.0 33.800000000000004 25.074999999999996 18.125 6 19.8 35.975 23.875 20.349999999999998 7 15.35 26.700000000000003 40.699999999999996 17.25 8 17.875 27.675 32.425 22.025 9 18.325 22.8 36.525 22.35 10-14 19.161916191619163 29.98799879987999 27.102710271027103 23.74737473747375 15-19 19.465 28.449999999999996 29.075 23.01 20-24 19.98 28.689999999999998 27.88 23.45 25-29 19.31 28.605000000000004 28.21 23.875 30-34 19.365 28.904999999999998 28.025 23.705000000000002 35-39 19.78 29.065 27.310000000000002 23.845 40-44 19.3 29.42 27.6 23.68 45-49 19.86 28.549999999999997 27.355 24.235 50-54 19.895 29.060000000000002 26.724999999999998 24.32 55-59 19.759999999999998 28.744999999999997 27.994999999999997 23.5 60-64 19.325 28.53 28.000000000000004 24.145 65-69 20.165 28.165000000000003 27.939999999999998 23.73 70-74 20.380000000000003 28.389999999999997 27.98 23.25 75-79 20.595 28.575 27.839999999999996 22.99 80-84 19.91 28.895 27.255000000000003 23.94 85-89 20.84 28.185 27.395000000000003 23.580000000000002 90-94 20.669999999999998 28.285 27.755000000000003 23.29 95-99 20.69 28.46 27.534999999999997 23.315 100-104 20.685000000000002 27.925 27.155 24.235 105-109 20.369999999999997 28.915000000000003 27.400000000000002 23.315 110-114 20.72 28.660000000000004 26.529999999999998 24.09 115-119 20.555 28.794999999999998 27.02 23.630000000000003 120-124 20.77 28.599999999999998 26.495 24.135 125-129 21.285 29.04 26.1 23.575 130-134 20.955 28.685 26.055 24.305 135-139 22.145 28.425 25.96 23.47 140-144 21.625 27.825 26.534999999999997 24.015 145-149 22.185 27.715 26.105 23.995 150-151 21.65 27.8625 25.2875 25.2 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 2.0 23 2.5 24 4.0 25 5.0 26 6.0 27 12.5 28 14.5 29 16.0 30 22.5 31 24.0 32 31.5 33 42.5 34 50.5 35 64.0 36 90.0 37 121.5 38 152.0 39 172.0 40 185.5 41 216.0 42 237.0 43 258.0 44 281.0 45 273.0 46 261.0 47 261.5 48 223.5 49 199.5 50 180.5 51 145.5 52 115.0 53 79.5 54 65.5 55 45.0 56 31.5 57 24.5 58 16.5 59 14.5 60 13.5 61 8.5 62 6.0 63 5.0 64 3.0 65 2.5 66 2.0 67 2.5 68 2.5 69 1.5 70 0.5 71 0.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.01 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.025 #Duplication Level Percentage of deduplicated Percentage of total 1 91.128810766273 82.95 2 8.102169733589673 14.75 3 0.5767646251029936 1.575 4 0.16478989288656962 0.6 5 0.027464982147761604 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAAATTTGTATTTTAATATATCAGGTGAAAAAGAAAATAACATCCAACA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.037500000000000006 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.16249999999999998 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.2375 0.0 0.0 0.0 0.0 74-75 0.2625 0.0 0.0 0.0 0.0 76-77 0.3375 0.0 0.0 0.0 0.0 78-79 0.38749999999999996 0.0 0.0 0.0 0.0 80-81 0.4625 0.0 0.0 0.0 0.0 82-83 0.6125 0.0 0.0 0.0 0.0 84-85 0.7 0.0 0.0 0.0 0.0 86-87 0.8 0.0 0.0 0.0 0.0 88-89 0.9874999999999999 0.0 0.0 0.0 0.0 90-91 1.225 0.0 0.0 0.0 0.0 92-93 1.4625 0.0 0.0 0.0 0.0 94-95 1.7625 0.0 0.0 0.0 0.0 96-97 2.125 0.0 0.0 0.0 0.0 98-99 2.525 0.0 0.0 0.0 0.0 100-101 2.925 0.0 0.0 0.0 0.0 102-103 3.25 0.0 0.0 0.0 0.0 104-105 3.75 0.0 0.0 0.0 0.0 106-107 4.262499999999999 0.0 0.0 0.0 0.0 108-109 4.9 0.0 0.0 0.0 0.0 110-111 5.5875 0.0 0.0 0.0 0.0 112-113 6.1 0.0 0.0 0.0 0.0 114-115 6.825 0.0 0.0 0.0 0.0 116-117 7.6125 0.0 0.0 0.0 0.0 118-119 8.8125 0.0 0.0 0.0 0.0 120-121 9.774999999999999 0.0 0.0 0.0 0.0 122-123 10.7 0.0 0.0 0.0 0.0 124-125 11.5375 0.0 0.0 0.0 0.0 126-127 12.4375 0.0 0.0 0.0 0.0 128-129 13.4 0.0 0.0 0.0 0.0 130-131 14.4 0.0 0.0 0.0 0.0 132-133 15.225000000000001 0.0 0.0 0.0 0.0 134-135 16.1375 0.0 0.0 0.0 0.0 136-137 17.0375 0.0 0.0 0.0 0.0 138-139 18.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR26075378 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR26075378_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.622 37.0 37.0 37.0 37.0 37.0 2 35.8325 37.0 37.0 37.0 37.0 37.0 3 35.9305 37.0 37.0 37.0 37.0 37.0 4 36.0325 37.0 37.0 37.0 37.0 37.0 5 35.9285 37.0 37.0 37.0 37.0 37.0 6 35.8275 37.0 37.0 37.0 37.0 37.0 7 35.8595 37.0 37.0 37.0 37.0 37.0 8 35.977 37.0 37.0 37.0 37.0 37.0 9 35.872 37.0 37.0 37.0 37.0 37.0 10-14 35.93509999999999 37.0 37.0 37.0 37.0 37.0 15-19 35.896 37.0 37.0 37.0 37.0 37.0 20-24 35.88280000000001 37.0 37.0 37.0 37.0 37.0 25-29 35.8039 37.0 37.0 37.0 37.0 37.0 30-34 35.7128 37.0 37.0 37.0 37.0 37.0 35-39 35.7372 37.0 37.0 37.0 37.0 37.0 40-44 35.6522 37.0 37.0 37.0 37.0 37.0 45-49 35.6289 37.0 37.0 37.0 37.0 37.0 50-54 35.583299999999994 37.0 37.0 37.0 37.0 37.0 55-59 35.515899999999995 37.0 37.0 37.0 37.0 37.0 60-64 35.5714 37.0 37.0 37.0 37.0 37.0 65-69 35.4328 37.0 37.0 37.0 37.0 37.0 70-74 35.3541 37.0 37.0 37.0 37.0 37.0 75-79 35.4372 37.0 37.0 37.0 37.0 37.0 80-84 35.3574 37.0 37.0 37.0 37.0 37.0 85-89 35.3466 37.0 37.0 37.0 37.0 37.0 90-94 35.2365 37.0 37.0 37.0 29.8 37.0 95-99 35.2436 37.0 37.0 37.0 32.2 37.0 100-104 35.2222 37.0 37.0 37.0 32.2 37.0 105-109 35.097899999999996 37.0 37.0 37.0 25.0 37.0 110-114 35.0241 37.0 37.0 37.0 25.0 37.0 115-119 34.976200000000006 37.0 37.0 37.0 25.0 37.0 120-124 34.810199999999995 37.0 37.0 37.0 25.0 37.0 125-129 34.675 37.0 37.0 37.0 25.0 37.0 130-134 34.7402 37.0 37.0 37.0 25.0 37.0 135-139 34.655899999999995 37.0 37.0 37.0 25.0 37.0 140-144 34.5885 37.0 37.0 37.0 25.0 37.0 145-149 34.3481 37.0 37.0 37.0 25.0 37.0 150-151 34.36225 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 3.0 15 5.0 16 2.0 17 0.0 18 2.0 19 5.0 20 4.0 21 7.0 22 10.0 23 9.0 24 9.0 25 17.0 26 27.0 27 22.0 28 23.0 29 40.0 30 52.0 31 54.0 32 100.0 33 146.0 34 315.0 35 818.0 36 2159.0 37 166.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.05 20.625 15.15 28.175 2 29.525000000000002 24.55 28.849999999999998 17.075000000000003 3 23.0 25.624999999999996 31.0 20.375 4 24.9 32.425 23.05 19.625 5 25.974999999999998 34.300000000000004 22.875 16.85 6 20.625 38.1 24.075 17.2 7 20.849999999999998 20.925 38.625 19.6 8 21.3 26.6 28.9 23.200000000000003 9 22.85 24.875 30.099999999999998 22.175 10-14 24.474999999999998 29.104999999999997 25.45 20.97 15-19 23.855 28.744999999999997 27.36 20.04 20-24 23.150000000000002 28.595 27.450000000000003 20.805 25-29 24.355 28.51 26.755000000000003 20.380000000000003 30-34 23.669999999999998 28.544999999999998 27.150000000000002 20.635 35-39 23.73 27.97 27.994999999999997 20.305 40-44 23.86 28.355000000000004 27.01 20.775 45-49 23.53 28.585 27.435 20.45 50-54 23.44 28.375 28.015 20.169999999999998 55-59 23.855 28.655 27.855 19.634999999999998 60-64 23.630000000000003 28.17 27.975 20.225 65-69 23.68 28.63 27.700000000000003 19.99 70-74 24.16 28.16 27.975 19.705000000000002 75-79 23.76 28.735 27.47 20.035 80-84 23.635 28.655 27.88 19.830000000000002 85-89 24.135 28.52 27.165 20.18 90-94 24.215 28.54 27.400000000000002 19.845 95-99 23.985 29.32 26.865 19.830000000000002 100-104 24.42 28.435 27.375 19.77 105-109 24.675 28.360000000000003 27.400000000000002 19.564999999999998 110-114 24.975 28.854999999999997 26.85 19.32 115-119 25.235000000000003 28.67 26.66 19.435 120-124 25.290000000000003 28.815 26.540000000000003 19.355 125-129 26.465 28.65 26.8 18.085 130-134 27.275 27.74 26.619999999999997 18.365000000000002 135-139 26.96 28.23 26.845000000000002 17.965 140-144 27.279999999999998 28.215 26.085 18.42 145-149 28.389999999999997 27.555000000000003 26.52 17.535 150-151 28.4375 27.5625 27.224999999999998 16.775000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 1.0 5 1.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 2.0 15 2.0 16 1.0 17 1.0 18 1.0 19 0.5 20 0.0 21 0.5 22 2.5 23 3.5 24 2.5 25 3.5 26 5.0 27 3.0 28 2.5 29 6.5 30 7.5 31 13.5 32 23.5 33 35.0 34 42.5 35 60.0 36 85.5 37 111.0 38 136.5 39 164.5 40 198.0 41 233.5 42 258.0 43 270.5 44 277.5 45 286.5 46 292.5 47 278.5 48 248.5 49 202.5 50 154.5 51 124.5 52 105.0 53 82.0 54 63.5 55 46.0 56 35.5 57 26.5 58 20.0 59 16.0 60 11.5 61 9.5 62 8.5 63 5.5 64 4.5 65 4.5 66 2.0 67 1.0 68 1.0 69 0.5 70 0.0 71 0.5 72 1.5 73 1.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.425 #Duplication Level Percentage of deduplicated Percentage of total 1 91.63248564397047 83.775 2 7.6838939021055515 14.05 3 0.4922067268252666 1.35 4 0.13672409078479628 0.5 5 0.027344818156959255 0.125 6 0.0 0.0 7 0.0 0.0 8 0.027344818156959255 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit AGGCGCCTTACATTGAAGATCCAAATACTGGGGTCCAGATGTTTGAAAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.037500000000000006 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.16249999999999998 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.2375 0.0 0.0 0.0 0.0 74-75 0.2625 0.0 0.0 0.0 0.0 76-77 0.3375 0.0 0.0 0.0 0.0 78-79 0.38749999999999996 0.0 0.0 0.0 0.0 80-81 0.475 0.0 0.0 0.0 0.0 82-83 0.6375 0.0 0.0 0.0 0.0 84-85 0.725 0.0 0.0 0.0 0.0 86-87 0.825 0.0 0.0 0.0 0.0 88-89 1.0375 0.0 0.0 0.0 0.0 90-91 1.2625000000000002 0.0 0.0 0.0 0.0 92-93 1.4875 0.0 0.0 0.0 0.0 94-95 1.7875 0.0 0.0 0.0 0.0 96-97 2.15 0.0 0.0 0.0 0.0 98-99 2.5374999999999996 0.0 0.0 0.0 0.0 100-101 2.925 0.0 0.0 0.0 0.0 102-103 3.25 0.0 0.0 0.0 0.0 104-105 3.8 0.0 0.0 0.0 0.0 106-107 4.3125 0.0 0.0 0.0 0.0 108-109 4.9875 0.0 0.0 0.0 0.0 110-111 5.699999999999999 0.0 0.0 0.0 0.0 112-113 6.225 0.0 0.0 0.0 0.0 114-115 6.95 0.0 0.0 0.0 0.0 116-117 7.737500000000001 0.0 0.0 0.0 0.0 118-119 8.975 0.0 0.0 0.0 0.0 120-121 9.9875 0.0 0.0 0.0 0.0 122-123 10.95 0.0 0.0 0.0 0.0 124-125 11.825 0.0 0.0 0.0 0.0 126-127 12.725 0.0 0.0 0.0 0.0 128-129 13.712499999999999 0.0 0.0 0.0 0.0 130-131 14.7 0.0 0.0 0.0 0.0 132-133 15.5375 0.0 0.0 0.0 0.0 134-135 16.475 0.0 0.0 0.0 0.0 136-137 17.4125 0.0 0.0 0.0 0.0 138-139 18.575000000000003 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1453688 spots for SRR26075378.sra Written 1453688 spots for SRR26075378.sra Read 1453688 spots for SRR26075378.sra Written 1453688 spots for SRR26075378.sra Read 1453688 spots for SRR26075378.sra Written 1453688 spots for SRR26075378.sra Read 1453688 spots for SRR26075378.sra Written 1453688 spots for SRR26075378.sra Read 1453688 spots for SRR26075378.sra Written 1453688 spots for SRR26075378.sra Read 1453688 spots for SRR26075378.sra Written 1453688 spots for SRR26075378.sra Read 1453688 spots for SRR26075378.sra Written 1453688 spots for SRR26075378.sra Read 1453688 spots for SRR26075378.sra Written 1453688 spots for SRR26075378.sra Read 1453688 spots for SRR26075378.sra Written 1453688 spots for SRR26075378.sra Read 1453688 spots for SRR26075378.sra Written 1453688 spots for SRR26075378.sra Read 1453688 spots for SRR26075378.sra Written 1453688 spots for SRR26075378.sra Read 1453688 spots for SRR26075378.sra Written 1453688 spots for SRR26075378.sra Read 1453688 spots for SRR26075378.sra Written 1453688 spots for SRR26075378.sra Read 1453688 spots for SRR26075378.sra Written 1453688 spots for SRR26075378.sra Read 1453688 spots for SRR26075378.sra Written 1453688 spots for SRR26075378.sra Read 1453688 spots for SRR26075378.sra Written 1453688 spots for SRR26075378.sra Read 1453688 spots for SRR26075378.sra Written 1453688 spots for SRR26075378.sra Read 1453688 spots for SRR26075378.sra Written 1453688 spots for SRR26075378.sra Read 1453688 spots for SRR26075378.sra Written 1453688 spots for SRR26075378.sra Read 1453688 spots for SRR26075378.sra Written 1453688 spots for SRR26075378.sra SRR ids: ['SRR26075378.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r6rycdv_ SRR26075378.sra spots: 29073760 blocks: [[1, 1453688], [1453689, 2907376], [2907377, 4361064], [4361065, 5814752], [5814753, 7268440], [7268441, 8722128], [8722129, 10175816], [10175817, 11629504], [11629505, 13083192], [13083193, 14536880], [14536881, 15990568], [15990569, 17444256], [17444257, 18897944], [18897945, 20351632], [20351633, 21805320], [21805321, 23259008], [23259009, 24712696], [24712697, 26166384], [26166385, 27620072], [27620073, 29073760]] SRR26075378 file size 10734674 SRR26075378 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR26075378 SRR26075378_1.fastq SRR26075378_2.fastq Input file: SRR26075378_1.fastq Paired file: SRR26075378_2.fastq trimmed: SRR26075378-trimmed-pair1.fastq, SRR26075378-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 00:19:15 2025 >> started Wed Feb 12 00:19:51 2025 >> done (36.001s) 29073760 read pairs processed; of these: 42 ( 0.00%) short read pairs filtered out after trimming by size control 41458 ( 0.14%) empty read pairs filtered out after trimming by size control 29032260 (99.86%) read pairs available; of these: 7795596 (26.85%) trimmed read pairs available after processing 21236664 (73.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 3 0.00% 20 8 0.00% 21 4 0.00% 22 10 0.00% 23 7 0.00% 24 6 0.00% 25 5 0.00% 26 17 0.00% 27 12 0.00% 28 10 0.00% 29 13 0.00% 30 36 0.00% 31 33 0.00% 32 40 0.00% 33 42 0.00% 34 56 0.00% 35 53 0.00% 36 58 0.00% 37 82 0.00% 38 104 0.00% 39 99 0.00% 40 144 0.00% 41 138 0.00% 42 138 0.00% 43 158 0.00% 44 139 0.00% 45 157 0.00% 46 186 0.00% 47 242 0.00% 48 264 0.00% 49 303 0.00% 50 367 0.00% 51 425 0.00% 52 509 0.00% 53 542 0.00% 54 597 0.00% 55 616 0.00% 56 758 0.00% 57 832 0.00% 58 932 0.00% 59 1103 0.00% 60 1275 0.00% 61 1546 0.01% 62 1694 0.01% 63 1974 0.01% 64 2242 0.01% 65 2249 0.01% 66 2604 0.01% 67 3012 0.01% 68 3361 0.01% 69 3897 0.01% 70 4300 0.01% 71 5008 0.02% 72 5564 0.02% 73 6332 0.02% 74 7345 0.03% 75 7961 0.03% 76 9088 0.03% 77 10203 0.04% 78 11421 0.04% 79 12934 0.04% 80 14137 0.05% 81 15851 0.05% 82 17623 0.06% 83 19870 0.07% 84 21734 0.07% 85 24405 0.08% 86 26734 0.09% 87 28746 0.10% 88 31399 0.11% 89 33798 0.12% 90 37136 0.13% 91 40630 0.14% 92 43231 0.15% 93 47013 0.16% 94 50754 0.17% 95 54339 0.19% 96 57598 0.20% 97 61131 0.21% 98 64539 0.22% 99 67746 0.23% 100 72143 0.25% 101 75214 0.26% 102 78997 0.27% 103 83650 0.29% 104 86262 0.30% 105 90207 0.31% 106 93615 0.32% 107 96958 0.33% 108 99466 0.34% 109 102917 0.35% 110 105451 0.36% 111 109801 0.38% 112 113341 0.39% 113 115887 0.40% 114 120126 0.41% 115 123236 0.42% 116 125076 0.43% 117 127643 0.44% 118 130276 0.45% 119 131091 0.45% 120 133815 0.46% 121 136307 0.47% 122 137765 0.47% 123 140461 0.48% 124 143256 0.49% 125 146049 0.50% 126 148272 0.51% 127 149492 0.51% 128 150095 0.52% 129 151198 0.52% 130 153441 0.53% 131 152431 0.53% 132 154042 0.53% 133 156547 0.54% 134 158523 0.55% 135 159033 0.55% 136 160698 0.55% 137 161327 0.56% 138 161928 0.56% 139 163732 0.56% 140 162997 0.56% 141 162771 0.56% 142 165493 0.57% 143 163581 0.56% 144 164972 0.57% 145 167249 0.58% 146 167256 0.58% 147 167129 0.58% 148 168610 0.58% 149 167096 0.58% 150 166995 0.58% 151 21236664 73.15% 29032260 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=8.64 fanout-score-rank=18 prefix-density=0.43 prefix-fanout=4.1 sequence=TTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGT criterion=fanout-score sequence-density=0.09 sequence-density-rank=13 fanout-score=265.43 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=29.2 sequence=TCATCATCACCG criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=5.14 fanout-score-rank=27 prefix-density=0.28 prefix-fanout=3.8 sequence=TGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATT criterion=fanout-score sequence-density=0.09 sequence-density-rank=15 fanout-score=318.52 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=28.9 sequence=AAGAAGAAGAAA SRR26075378 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 00:20:39 Started mapping on | Feb 12 00:20:39 Finished on | Feb 12 00:25:44 Mapping speed, Million of reads per hour | 342.68 Number of input reads | 29032260 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 25920430 Uniquely mapped reads % | 89.28% Average mapped length | 285.57 Number of splices: Total | 19831751 Number of splices: Annotated (sjdb) | 19345912 Number of splices: GT/AG | 19497397 Number of splices: GC/AG | 238752 Number of splices: AT/AC | 19554 Number of splices: Non-canonical | 76048 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.03% Deletion average length | 2.98 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1042016 % of reads mapped to multiple loci | 3.59% Number of reads mapped to too many loci | 59133 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.75% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2069814 2069814 2069814 N_multimapping 1042016 1042016 1042016 N_noFeature 721338 25634245 863809 N_ambiguous 309715 2576 164302 UnstrandedReadsAssigned:24889377 PositiveStrandReadsAssigned:283609 NegativeStrandReadsAssigned:24892319 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=139 echo kmer=135 SRR26075378 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR26075378-trimmed-pair1.fastq SRR26075378-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,032,260 reads, 25,520,741 reads pseudoaligned [quant] estimated average fragment length: 194.948 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,169 rounds 52401 SRR26075378.ke.tsv 34699 SRR26075378.se.tsv 87100 total ==> SRR26075378.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1824.05 4196.31 76.3405 Potri.005G024800.1.v4.1 1035 841.052 6196 244.463 Potri.004G059700.1.v4.1 961 767.069 110 4.75864 Potri.007G009000.2.v4.1 1416 1222.05 0 0 Potri.003G141000.2.v4.1 2943 2749.05 1099 13.266 Potri.016G087400.1.v4.1 270 102.731 2243 724.523 Potri.015G069301.1.v4.1 564 371.346 0 0 Potri.010G195200.1.v4.1 1773 1579.05 69.649 1.46367 Potri.012G127500.1.v4.1 977 783.069 4169 176.668 ==> SRR26075378.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 424 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 546 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 150 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 376 SRR26075378 completed mapping pipeline successfully