Starting /dee2/code/volunteer_pipeline.sh SRR26075379 current disk space = 3048830742528 free memory = 1433131640 SRR26075379 SRAfilesize 58b15bce2dac69b0ba53edbddf7ee85d SRR26075379.sra SRR26075379.sra file validated SRR26075379 is paired end SRR26075379 is conventional basespace SRR26075379 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR26075379_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.21175 37.0 37.0 37.0 37.0 37.0 2 36.1465 37.0 37.0 37.0 37.0 37.0 3 36.38 37.0 37.0 37.0 37.0 37.0 4 36.405 37.0 37.0 37.0 37.0 37.0 5 36.528 37.0 37.0 37.0 37.0 37.0 6 36.414 37.0 37.0 37.0 37.0 37.0 7 36.327 37.0 37.0 37.0 37.0 37.0 8 36.3475 37.0 37.0 37.0 37.0 37.0 9 36.3555 37.0 37.0 37.0 37.0 37.0 10-14 36.4079 37.0 37.0 37.0 37.0 37.0 15-19 36.3479 37.0 37.0 37.0 37.0 37.0 20-24 36.258 37.0 37.0 37.0 37.0 37.0 25-29 36.1849 37.0 37.0 37.0 37.0 37.0 30-34 36.1208 37.0 37.0 37.0 37.0 37.0 35-39 36.104299999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.021499999999996 37.0 37.0 37.0 37.0 37.0 45-49 35.9842 37.0 37.0 37.0 37.0 37.0 50-54 35.921400000000006 37.0 37.0 37.0 37.0 37.0 55-59 35.8995 37.0 37.0 37.0 37.0 37.0 60-64 35.854 37.0 37.0 37.0 37.0 37.0 65-69 35.679 37.0 37.0 37.0 37.0 37.0 70-74 35.70129999999999 37.0 37.0 37.0 37.0 37.0 75-79 35.6632 37.0 37.0 37.0 37.0 37.0 80-84 35.6899 37.0 37.0 37.0 37.0 37.0 85-89 35.569599999999994 37.0 37.0 37.0 37.0 37.0 90-94 35.5336 37.0 37.0 37.0 37.0 37.0 95-99 35.4894 37.0 37.0 37.0 37.0 37.0 100-104 35.3792 37.0 37.0 37.0 37.0 37.0 105-109 35.3366 37.0 37.0 37.0 34.6 37.0 110-114 35.2808 37.0 37.0 37.0 32.2 37.0 115-119 35.1527 37.0 37.0 37.0 25.0 37.0 120-124 35.180400000000006 37.0 37.0 37.0 25.0 37.0 125-129 35.018800000000006 37.0 37.0 37.0 25.0 37.0 130-134 34.9217 37.0 37.0 37.0 25.0 37.0 135-139 34.7413 37.0 37.0 37.0 25.0 37.0 140-144 34.580999999999996 37.0 37.0 37.0 25.0 37.0 145-149 34.608700000000006 37.0 37.0 37.0 25.0 37.0 150-151 34.4275 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 4.0 22 2.0 23 3.0 24 4.0 25 8.0 26 17.0 27 29.0 28 37.0 29 48.0 30 61.0 31 66.0 32 96.0 33 144.0 34 242.0 35 518.0 36 2596.0 37 125.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.13286537979443 13.010779644021058 11.381298571070444 45.47505640511406 2 20.200000000000003 16.2 37.3 26.3 3 18.4 19.0 29.45 33.15 4 23.1 25.8 24.7 26.400000000000002 5 24.775 31.65 24.675 18.9 6 22.8 34.0 22.5 20.7 7 17.575 27.275 38.35 16.8 8 19.75 26.525 30.45 23.275000000000002 9 18.85 23.775 33.900000000000006 23.474999999999998 10-14 21.415 28.749999999999996 26.340000000000003 23.494999999999997 15-19 21.36 26.995 27.71 23.935000000000002 20-24 21.43 27.894999999999996 26.974999999999998 23.7 25-29 21.07 27.735 26.845000000000002 24.349999999999998 30-34 20.93 27.72 27.905 23.445 35-39 21.125 27.315 27.639999999999997 23.919999999999998 40-44 21.865000000000002 27.62 27.255000000000003 23.26 45-49 21.240000000000002 27.805000000000003 26.919999999999998 24.035 50-54 21.560000000000002 27.750000000000004 27.065 23.625 55-59 21.735 27.284999999999997 27.43 23.549999999999997 60-64 21.305 27.41 27.195000000000004 24.09 65-69 21.25 27.755000000000003 27.18 23.815 70-74 20.965 27.839999999999996 27.08 24.115000000000002 75-79 21.605 27.16 26.605 24.63 80-84 21.310000000000002 27.67 26.729999999999997 24.29 85-89 21.490000000000002 27.544999999999998 27.37 23.595 90-94 21.654999999999998 27.88 26.775 23.69 95-99 21.335 27.185 26.840000000000003 24.64 100-104 21.465 27.900000000000002 26.900000000000002 23.735 105-109 21.41 27.99 26.165 24.435000000000002 110-114 22.085 27.79 26.645000000000003 23.48 115-119 22.31 27.785 26.340000000000003 23.565 120-124 22.235 27.845 25.855 24.065 125-129 22.155 28.139999999999997 25.96 23.745 130-134 22.005 28.23 25.44 24.325 135-139 22.36 27.57 25.740000000000002 24.33 140-144 22.37 27.634999999999998 25.264999999999997 24.73 145-149 22.7 27.884999999999998 24.525 24.89 150-151 23.2125 27.025 24.4125 25.35 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 1.5 21 2.0 22 2.5 23 2.5 24 2.5 25 2.5 26 2.0 27 4.0 28 7.5 29 18.0 30 21.0 31 18.5 32 25.0 33 33.5 34 46.5 35 60.0 36 65.5 37 75.0 38 119.0 39 158.0 40 168.5 41 192.0 42 217.0 43 224.0 44 224.0 45 237.5 46 235.5 47 230.5 48 229.0 49 196.5 50 171.5 51 157.5 52 139.5 53 119.0 54 106.0 55 99.5 56 82.5 57 63.0 58 56.5 59 48.5 60 34.5 61 24.5 62 18.5 63 15.0 64 13.5 65 8.0 66 3.0 67 5.0 68 4.0 69 1.5 70 1.0 71 1.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.575 #Duplication Level Percentage of deduplicated Percentage of total 1 92.84364029165542 85.95 2 6.4542263029975695 11.95 3 0.5671077504725899 1.575 4 0.10802052389954091 0.4 5 0.027005130974885227 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGATGATTAAGAGCGTCGTCTGCTGTTATTCGCTTATCTGGGTCATAAGT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.3375 0.0 0.0 0.0 0.0 80-81 0.4125 0.0 0.0 0.0 0.0 82-83 0.475 0.0 0.0 0.0 0.0 84-85 0.575 0.0 0.0 0.0 0.0 86-87 0.6625000000000001 0.0 0.0 0.0 0.0 88-89 0.8 0.0 0.0 0.0 0.0 90-91 0.9375 0.0 0.0 0.0 0.0 92-93 1.0499999999999998 0.0 0.0 0.0 0.0 94-95 1.25 0.0 0.0 0.0 0.0 96-97 1.4125 0.0 0.0 0.0 0.0 98-99 1.6 0.0 0.0 0.0 0.0 100-101 1.75 0.0 0.0 0.0 0.0 102-103 2.2625 0.0 0.0 0.0 0.0 104-105 2.7 0.0 0.0 0.0 0.0 106-107 3.25 0.0 0.0 0.0 0.0 108-109 3.7125000000000004 0.0 0.0 0.0 0.0 110-111 4.2875 0.0 0.0 0.0 0.0 112-113 4.8125 0.0 0.0 0.0 0.0 114-115 5.3375 0.0 0.0 0.0 0.0 116-117 5.8375 0.0 0.0 0.0 0.0 118-119 6.525 0.0 0.0 0.0 0.0 120-121 7.3375 0.0 0.0 0.0 0.0 122-123 8.15 0.0 0.0 0.0 0.0 124-125 8.95 0.0 0.0 0.0 0.0 126-127 9.725000000000001 0.0 0.0 0.0 0.0 128-129 10.5125 0.0 0.0 0.0 0.0 130-131 11.45 0.0 0.0 0.0 0.0 132-133 12.525 0.0 0.0 0.0 0.0 134-135 13.5625 0.0 0.0 0.0 0.0 136-137 14.6 0.0 0.0 0.0 0.0 138-139 15.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGAACT 10 0.006830828 145.0 7 TCAAGCA 10 0.006830828 145.0 2 GTGAGGG 10 0.006830828 145.0 8 AGACGTG 10 0.006830828 145.0 4 GACGTGA 10 0.006830828 145.0 5 TCAGACG 10 0.006830828 145.0 2 CTCAGAC 10 0.006830828 145.0 1 CAGACGT 10 0.006830828 145.0 3 TGAGGGT 10 0.006830828 145.0 9 CGTGAGG 10 0.006830828 145.0 7 ACGGTGA 10 0.006830828 145.0 6 CAAGCAT 10 0.006830828 145.0 3 ACGTGAG 10 0.006830828 145.0 6 >>END_MODULE SRR26075379 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR26075379_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.90075 37.0 37.0 37.0 37.0 37.0 2 35.857 37.0 37.0 37.0 37.0 37.0 3 36.073 37.0 37.0 37.0 37.0 37.0 4 36.0545 37.0 37.0 37.0 37.0 37.0 5 35.9615 37.0 37.0 37.0 37.0 37.0 6 35.822 37.0 37.0 37.0 37.0 37.0 7 35.8715 37.0 37.0 37.0 37.0 37.0 8 35.985 37.0 37.0 37.0 37.0 37.0 9 35.978 37.0 37.0 37.0 37.0 37.0 10-14 35.945800000000006 37.0 37.0 37.0 37.0 37.0 15-19 35.9754 37.0 37.0 37.0 37.0 37.0 20-24 35.865899999999996 37.0 37.0 37.0 37.0 37.0 25-29 35.871 37.0 37.0 37.0 37.0 37.0 30-34 35.7715 37.0 37.0 37.0 37.0 37.0 35-39 35.7384 37.0 37.0 37.0 37.0 37.0 40-44 35.7144 37.0 37.0 37.0 37.0 37.0 45-49 35.651300000000006 37.0 37.0 37.0 37.0 37.0 50-54 35.5988 37.0 37.0 37.0 37.0 37.0 55-59 35.5669 37.0 37.0 37.0 37.0 37.0 60-64 35.5193 37.0 37.0 37.0 37.0 37.0 65-69 35.4682 37.0 37.0 37.0 37.0 37.0 70-74 35.4591 37.0 37.0 37.0 37.0 37.0 75-79 35.3377 37.0 37.0 37.0 37.0 37.0 80-84 35.39880000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.277300000000004 37.0 37.0 37.0 34.6 37.0 90-94 35.2351 37.0 37.0 37.0 34.6 37.0 95-99 35.274 37.0 37.0 37.0 34.6 37.0 100-104 35.1669 37.0 37.0 37.0 27.4 37.0 105-109 35.1551 37.0 37.0 37.0 25.0 37.0 110-114 35.038000000000004 37.0 37.0 37.0 25.0 37.0 115-119 34.9655 37.0 37.0 37.0 25.0 37.0 120-124 34.830200000000005 37.0 37.0 37.0 25.0 37.0 125-129 34.795100000000005 37.0 37.0 37.0 25.0 37.0 130-134 34.84585 37.0 37.0 37.0 25.0 37.0 135-139 34.66985 37.0 37.0 37.0 25.0 37.0 140-144 34.66635 37.0 37.0 37.0 25.0 37.0 145-149 34.51995 37.0 37.0 37.0 25.0 37.0 150-151 34.47425 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 4.0 15 3.0 16 3.0 17 6.0 18 1.0 19 1.0 20 5.0 21 2.0 22 12.0 23 13.0 24 10.0 25 14.0 26 23.0 27 29.0 28 20.0 29 28.0 30 51.0 31 60.0 32 108.0 33 152.0 34 307.0 35 761.0 36 2226.0 37 159.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.383345836459114 21.005251312828207 14.703675918979744 30.90772693173293 2 27.650000000000002 24.0 30.2 18.15 3 22.525000000000002 25.5 29.849999999999998 22.125 4 25.074999999999996 30.075000000000003 23.200000000000003 21.65 5 25.05 34.2 22.475 18.275 6 21.875 36.85 22.5 18.775 7 20.025000000000002 22.625 37.875 19.475 8 21.625 25.174999999999997 28.4 24.8 9 22.55 24.125 29.125 24.2 10-14 24.11 29.125 24.779999999999998 21.985 15-19 24.03 27.765 26.295 21.91 20-24 23.745 27.794999999999998 26.36 22.1 25-29 23.535 27.650000000000002 26.31 22.505 30-34 23.03 28.29 26.695 21.985 35-39 23.64 27.794999999999998 26.35 22.215 40-44 23.13 27.38 26.979999999999997 22.509999999999998 45-49 23.59 27.925 26.965 21.52 50-54 24.395 27.495000000000005 26.505000000000003 21.605 55-59 23.925 27.33 26.735 22.009999999999998 60-64 23.995 27.42 27.034999999999997 21.55 65-69 23.365 28.065 26.795 21.775 70-74 23.305 28.075 27.1 21.52 75-79 23.674999999999997 27.24 27.13 21.955 80-84 24.195 27.500000000000004 26.985 21.32 85-89 24.57 28.310000000000002 25.4 21.72 90-94 24.01 27.785 26.955000000000002 21.25 95-99 24.279999999999998 27.305 26.855 21.560000000000002 100-104 24.395 28.225 26.02 21.36 105-109 25.005 27.805000000000003 26.340000000000003 20.849999999999998 110-114 24.715 27.63 26.640000000000004 21.015 115-119 25.205 27.900000000000002 26.215 20.68 120-124 25.035007001400277 28.325665133026607 26.66533306661332 19.973994798959794 125-129 26.067606760676064 27.972797279727974 25.557555755575557 20.402040204020402 130-134 26.206310315515775 27.896394819740987 26.01130056502825 19.885994299714984 135-139 25.98149537384346 27.22680670167542 26.901725431357836 19.88997249312328 140-144 26.74668667166792 27.901975493873472 25.401350337584393 19.94998749687422 145-149 26.76169042260565 27.231807951987996 25.751437859464865 20.255063765941486 150-151 26.71917979494874 27.056764191047762 26.19404851212803 20.030007501875467 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 1.5 10 3.0 11 2.0 12 0.5 13 0.5 14 1.0 15 1.0 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 1.5 22 1.5 23 0.5 24 1.0 25 2.5 26 3.5 27 2.0 28 2.5 29 6.0 30 7.0 31 11.5 32 19.0 33 27.5 34 36.5 35 55.0 36 68.0 37 85.0 38 118.0 39 146.0 40 186.0 41 217.0 42 227.0 43 242.5 44 245.0 45 243.5 46 232.5 47 219.5 48 212.0 49 190.5 50 169.5 51 151.5 52 141.5 53 124.0 54 105.5 55 94.0 56 81.5 57 70.5 58 57.0 59 41.5 60 30.0 61 24.5 62 20.5 63 15.5 64 13.5 65 10.0 66 4.5 67 2.0 68 2.5 69 1.5 70 0.5 71 1.0 72 1.0 73 1.0 74 0.5 75 1.0 76 1.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.5 85 0.5 86 0.5 87 0.5 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.02 125-129 0.01 130-134 0.005 135-139 0.025 140-144 0.025 145-149 0.025 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 93.12853678253839 86.4 2 6.1708434384263 11.450000000000001 3 0.5658852061438965 1.575 4 0.08084074373484236 0.3 5 0.026946914578280787 0.125 6 0.026946914578280787 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit TTCCTTTCACACCTTTCACAGGATCTCCAGTTCTCTCTGACTCAGGATTT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.3625 0.0 0.0 0.0 0.0 80-81 0.4375 0.0 0.0 0.0 0.0 82-83 0.5 0.0 0.0 0.0 0.0 84-85 0.5874999999999999 0.0 0.0 0.0 0.0 86-87 0.6625000000000001 0.0 0.0 0.0 0.0 88-89 0.7875 0.0 0.0 0.0 0.0 90-91 0.9125 0.0 0.0 0.0 0.0 92-93 1.025 0.0 0.0 0.0 0.0 94-95 1.2375 0.0 0.0 0.0 0.0 96-97 1.4125 0.0 0.0 0.0 0.0 98-99 1.6 0.0 0.0 0.0 0.0 100-101 1.75 0.0 0.0 0.0 0.0 102-103 2.2375 0.0 0.0 0.0 0.0 104-105 2.675 0.0 0.0 0.0 0.0 106-107 3.2375 0.0 0.0 0.0 0.0 108-109 3.7125000000000004 0.0 0.0 0.0 0.0 110-111 4.2625 0.0 0.0 0.0 0.0 112-113 4.8125 0.0 0.0 0.0 0.0 114-115 5.375 0.0 0.0 0.0 0.0 116-117 5.8875 0.0 0.0 0.0 0.0 118-119 6.5625 0.0 0.0 0.0 0.0 120-121 7.4 0.0 0.0 0.0 0.0 122-123 8.275 0.0 0.0 0.0 0.0 124-125 9.075 0.0 0.0 0.0 0.0 126-127 9.825 0.0 0.0 0.0 0.0 128-129 10.537500000000001 0.0 0.0 0.0 0.0 130-131 11.524999999999999 0.0 0.0 0.0 0.0 132-133 12.65 0.0 0.0 0.0 0.0 134-135 13.7125 0.0 0.0 0.0 0.0 136-137 14.8375 0.0 0.0 0.0 0.0 138-139 15.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGACGA 10 0.006830828 145.0 2 GTCGACG 10 0.006830828 145.0 1 GACGATT 10 0.006830828 145.0 4 GGGACTA 10 0.006830828 145.0 2 CGACGAT 10 0.006830828 145.0 3 AGTCTCG 10 0.006830828 145.0 145 GTCGTGT 40 0.0076550315 18.125 135-139 >>END_MODULE Read 1595883 spots for SRR26075379.sra Written 1595883 spots for SRR26075379.sra Read 1595883 spots for SRR26075379.sra Written 1595883 spots for SRR26075379.sra Read 1595883 spots for SRR26075379.sra Written 1595883 spots for SRR26075379.sra Read 1595883 spots for SRR26075379.sra Written 1595883 spots for SRR26075379.sra Read 1595883 spots for SRR26075379.sra Written 1595883 spots for SRR26075379.sra Read 1595883 spots for SRR26075379.sra Written 1595883 spots for SRR26075379.sra Read 1595883 spots for SRR26075379.sra Written 1595883 spots for SRR26075379.sra Read 1595898 spots for SRR26075379.sra Written 1595898 spots for SRR26075379.sra Read 1595883 spots for SRR26075379.sra Written 1595883 spots for SRR26075379.sra Read 1595883 spots for SRR26075379.sra Written 1595883 spots for SRR26075379.sra Read 1595883 spots for SRR26075379.sra Written 1595883 spots for SRR26075379.sra Read 1595883 spots for SRR26075379.sra Written 1595883 spots for SRR26075379.sra Read 1595883 spots for SRR26075379.sra Written 1595883 spots for SRR26075379.sra Read 1595883 spots for SRR26075379.sra Written 1595883 spots for SRR26075379.sra Read 1595883 spots for SRR26075379.sra Written 1595883 spots for SRR26075379.sra Read 1595883 spots for SRR26075379.sra Written 1595883 spots for SRR26075379.sra Read 1595883 spots for SRR26075379.sra Written 1595883 spots for SRR26075379.sra Read 1595883 spots for SRR26075379.sra Written 1595883 spots for SRR26075379.sra Read 1595883 spots for SRR26075379.sra Written 1595883 spots for SRR26075379.sra Read 1595883 spots for SRR26075379.sra Written 1595883 spots for SRR26075379.sra SRR ids: ['SRR26075379.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_euh2abkf SRR26075379.sra spots: 31917675 blocks: [[1, 1595883], [1595884, 3191766], [3191767, 4787649], [4787650, 6383532], [6383533, 7979415], [7979416, 9575298], [9575299, 11171181], [11171182, 12767064], [12767065, 14362947], [14362948, 15958830], [15958831, 17554713], [17554714, 19150596], [19150597, 20746479], [20746480, 22342362], [22342363, 23938245], [23938246, 25534128], [25534129, 27130011], [27130012, 28725894], [28725895, 30321777], [30321778, 31917675]] SRR26075379 file size 11785750 SRR26075379 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR26075379 SRR26075379_1.fastq SRR26075379_2.fastq Input file: SRR26075379_1.fastq Paired file: SRR26075379_2.fastq trimmed: SRR26075379-trimmed-pair1.fastq, SRR26075379-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 03:46:55 2025 >> started Wed Feb 12 03:47:35 2025 >> done (39.837s) 31917675 read pairs processed; of these: 32 ( 0.00%) short read pairs filtered out after trimming by size control 31933 ( 0.10%) empty read pairs filtered out after trimming by size control 31885710 (99.90%) read pairs available; of these: 7280401 (22.83%) trimmed read pairs available after processing 24605309 (77.17%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 5 0.00% 20 6 0.00% 21 12 0.00% 22 16 0.00% 23 18 0.00% 24 22 0.00% 25 17 0.00% 26 22 0.00% 27 30 0.00% 28 36 0.00% 29 33 0.00% 30 42 0.00% 31 31 0.00% 32 42 0.00% 33 54 0.00% 34 48 0.00% 35 70 0.00% 36 77 0.00% 37 88 0.00% 38 98 0.00% 39 111 0.00% 40 113 0.00% 41 128 0.00% 42 149 0.00% 43 160 0.00% 44 150 0.00% 45 179 0.00% 46 191 0.00% 47 218 0.00% 48 242 0.00% 49 297 0.00% 50 333 0.00% 51 376 0.00% 52 405 0.00% 53 474 0.00% 54 464 0.00% 55 543 0.00% 56 583 0.00% 57 662 0.00% 58 730 0.00% 59 845 0.00% 60 999 0.00% 61 1211 0.00% 62 1348 0.00% 63 1476 0.00% 64 1493 0.00% 65 1731 0.01% 66 1918 0.01% 67 2189 0.01% 68 2476 0.01% 69 2884 0.01% 70 3089 0.01% 71 3554 0.01% 72 3997 0.01% 73 4626 0.01% 74 5161 0.02% 75 5904 0.02% 76 6550 0.02% 77 7279 0.02% 78 7983 0.03% 79 9220 0.03% 80 10263 0.03% 81 11492 0.04% 82 12976 0.04% 83 14449 0.05% 84 15743 0.05% 85 17962 0.06% 86 19514 0.06% 87 21484 0.07% 88 23881 0.07% 89 25601 0.08% 90 28259 0.09% 91 31189 0.10% 92 33841 0.11% 93 36861 0.12% 94 39639 0.12% 95 42745 0.13% 96 45756 0.14% 97 49170 0.15% 98 51721 0.16% 99 54984 0.17% 100 58949 0.18% 101 62278 0.20% 102 66765 0.21% 103 70177 0.22% 104 73268 0.23% 105 77110 0.24% 106 80628 0.25% 107 82875 0.26% 108 86745 0.27% 109 90655 0.28% 110 92580 0.29% 111 96752 0.30% 112 101034 0.32% 113 103575 0.32% 114 106775 0.33% 115 111286 0.35% 116 113702 0.36% 117 115844 0.36% 118 119602 0.38% 119 120484 0.38% 120 123727 0.39% 121 126766 0.40% 122 129595 0.41% 123 131481 0.41% 124 135813 0.43% 125 138396 0.43% 126 140452 0.44% 127 142953 0.45% 128 144470 0.45% 129 146529 0.46% 130 148488 0.47% 131 148589 0.47% 132 150936 0.47% 133 154061 0.48% 134 155970 0.49% 135 157478 0.49% 136 161217 0.51% 137 160592 0.50% 138 162394 0.51% 139 162900 0.51% 140 163107 0.51% 141 164349 0.52% 142 165567 0.52% 143 166345 0.52% 144 168131 0.53% 145 169340 0.53% 146 170591 0.54% 147 170986 0.54% 148 173561 0.54% 149 171136 0.54% 150 172652 0.54% 151 24605309 77.17% 31885710 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.61 fanout-score-rank=29 prefix-density=0.28 prefix-fanout=2.4 sequence=GGAATTGAATTAATGAACTTGGTGGCAGCAAGGAAGGCGTTGTAGGAGGCTAAATAGCTAACTCCAGAGTCTGAACTTGTTTCACCAGCTACATTTGAAACACCTTGGAACACCACGAAGAGCTTTTCATTTGACA criterion=fanout-score sequence-density=0.13 sequence-density-rank=7 fanout-score=15.51 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=7.3 sequence=AGCATCATCATCACCGTTCTATAGAACACAAGAATACTGCCTGCTGCCCTACTGGGAAGCACTCTCCTTTTCTTTCTCCTTCTCTTCTTCA criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.75 fanout-score-rank=27 prefix-density=0.23 prefix-fanout=2.4 sequence=TACAACATCCAGAAGGAGTCCACCCTCCACTTGGTGCTTCG criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=122.95 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=5.6 sequence=TCCTGCTCTCGCAATCGCTGCTTCTTTGTCTGTCTTTGGGTCGATCCGAAAGAGAGGAGCTCTTCTGCGCAATCATGTTGGTCTATCAAGATCTTCTCTCTGGTGATGAGCTTCTCTCGGATTCGTTCCCATACAAGGAGATTGAGAATGGGATACTGTGGGAAGTTGAAGGAAAGTGGGTTGTTCAAGGAGCCGTTGATGTAGACATTGGTGCAAATCCTT SRR26075379 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 03:48:42 Started mapping on | Feb 12 03:48:42 Finished on | Feb 12 04:01:05 Mapping speed, Million of reads per hour | 154.49 Number of input reads | 31885710 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 24649562 Uniquely mapped reads % | 77.31% Average mapped length | 288.63 Number of splices: Total | 20412269 Number of splices: Annotated (sjdb) | 19868523 Number of splices: GT/AG | 20057593 Number of splices: GC/AG | 256141 Number of splices: AT/AC | 23608 Number of splices: Non-canonical | 74927 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.03% Deletion average length | 2.97 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 807561 % of reads mapped to multiple loci | 2.53% Number of reads mapped to too many loci | 120219 % of reads mapped to too many loci | 0.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 19.35% % of reads unmapped: other | 0.43% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 6428587 6428587 6428587 N_multimapping 807561 807561 807561 N_noFeature 614767 24418234 738655 N_ambiguous 288018 1624 179555 UnstrandedReadsAssigned:23746777 PositiveStrandReadsAssigned:229704 NegativeStrandReadsAssigned:23731352 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR26075379 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR26075379-trimmed-pair1.fastq SRR26075379-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,885,710 reads, 24,257,137 reads pseudoaligned [quant] estimated average fragment length: 203.986 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,247 rounds 52401 SRR26075379.ke.tsv 34699 SRR26075379.se.tsv 87100 total ==> SRR26075379.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1815.01 5987 121.691 Potri.005G024800.1.v4.1 1035 832.014 7972 353.482 Potri.004G059700.1.v4.1 961 758.014 9 0.438022 Potri.007G009000.2.v4.1 1416 1213.01 0 0 Potri.003G141000.2.v4.1 2943 2740.01 933 12.562 Potri.016G087400.1.v4.1 270 98.2241 1899 713.243 Potri.015G069301.1.v4.1 564 362.949 0 0 Potri.010G195200.1.v4.1 1773 1570.01 355 8.34171 Potri.012G127500.1.v4.1 977 774.014 10049 478.966 ==> SRR26075379.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 18 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 255 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 731 SRR26075379 completed mapping pipeline successfully