Starting /dee2/code/volunteer_pipeline.sh SRR28623226 current disk space = 3089084198912 free memory = 1458980984 SRR28623226 SRAfilesize 7f87c8282750c9dffa26a2f0eeb6ce03 SRR28623226.sra SRR28623226.sra file validated SRR28623226 is paired end SRR28623226 is conventional basespace SRR28623226 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623226_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.82675 37.0 37.0 37.0 37.0 37.0 2 36.2775 37.0 37.0 37.0 37.0 37.0 3 36.4215 37.0 37.0 37.0 37.0 37.0 4 36.5225 37.0 37.0 37.0 37.0 37.0 5 36.5305 37.0 37.0 37.0 37.0 37.0 6 36.5385 37.0 37.0 37.0 37.0 37.0 7 36.519 37.0 37.0 37.0 37.0 37.0 8 36.607 37.0 37.0 37.0 37.0 37.0 9 36.5345 37.0 37.0 37.0 37.0 37.0 10-14 36.5704 37.0 37.0 37.0 37.0 37.0 15-19 36.5271 37.0 37.0 37.0 37.0 37.0 20-24 36.525 37.0 37.0 37.0 37.0 37.0 25-29 36.451499999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.4074 37.0 37.0 37.0 37.0 37.0 35-39 36.3637 37.0 37.0 37.0 37.0 37.0 40-44 36.328100000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.3208 37.0 37.0 37.0 37.0 37.0 50-54 36.2736 37.0 37.0 37.0 37.0 37.0 55-59 36.2712 37.0 37.0 37.0 37.0 37.0 60-64 36.2244 37.0 37.0 37.0 37.0 37.0 65-69 36.101099999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.1229 37.0 37.0 37.0 37.0 37.0 75-79 36.105900000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.0089 37.0 37.0 37.0 37.0 37.0 85-89 35.911199999999994 37.0 37.0 37.0 37.0 37.0 90-94 36.01350000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.8577 37.0 37.0 37.0 37.0 37.0 100-104 35.8181 37.0 37.0 37.0 37.0 37.0 105-109 35.7819 37.0 37.0 37.0 37.0 37.0 110-114 35.7144 37.0 37.0 37.0 37.0 37.0 115-119 35.647800000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.6254 37.0 37.0 37.0 37.0 37.0 125-129 35.43579999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.197199999999995 37.0 37.0 37.0 27.4 37.0 135-139 35.167899999999996 37.0 37.0 37.0 27.4 37.0 140-144 34.9707 37.0 37.0 37.0 27.4 37.0 145-149 34.8019 37.0 37.0 37.0 25.0 37.0 150-151 34.01925 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 0.0 23 0.0 24 1.0 25 7.0 26 9.0 27 18.0 28 26.0 29 25.0 30 38.0 31 47.0 32 70.0 33 105.0 34 169.0 35 461.0 36 2865.0 37 157.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.748684540215486 12.878977699824606 9.170633926334252 45.20170383362566 2 16.825000000000003 14.924999999999999 38.925 29.325000000000003 3 17.75 18.05 27.400000000000002 36.8 4 22.8 25.525 23.775 27.900000000000002 5 24.7 32.775 23.599999999999998 18.925 6 20.825 35.675000000000004 22.825 20.674999999999997 7 16.525000000000002 26.75 40.075 16.650000000000002 8 17.875 26.674999999999997 32.300000000000004 23.150000000000002 9 17.825 23.549999999999997 33.775 24.85 10-14 19.2 30.305 27.800000000000004 22.695 15-19 19.74 28.134999999999998 28.549999999999997 23.575 20-24 19.99 27.825 28.249999999999996 23.935000000000002 25-29 19.49 28.610000000000003 28.194999999999997 23.705000000000002 30-34 19.74 28.52 27.889999999999997 23.849999999999998 35-39 20.119999999999997 27.894999999999996 27.96 24.025 40-44 19.915 29.07 27.83 23.185 45-49 20.13 28.544999999999998 27.605 23.72 50-54 19.835 28.315 28.005000000000003 23.845 55-59 20.315 28.360000000000003 27.655 23.669999999999998 60-64 20.495 28.144999999999996 27.815 23.544999999999998 65-69 20.49 28.410000000000004 27.61 23.49 70-74 20.36 28.694999999999997 27.49 23.455000000000002 75-79 19.735 28.51 27.794999999999998 23.96 80-84 20.13 28.435 28.015 23.419999999999998 85-89 20.54 29.15 27.315 22.994999999999997 90-94 20.495 28.725 27.615000000000002 23.165 95-99 20.71 28.38 27.400000000000002 23.51 100-104 20.794999999999998 28.79 27.47 22.945 105-109 20.4 28.305000000000003 27.52 23.775 110-114 20.87 28.749999999999996 26.58 23.799999999999997 115-119 20.895 29.125 26.279999999999998 23.7 120-124 21.05 28.599999999999998 26.395000000000003 23.955000000000002 125-129 20.93 29.075 26.119999999999997 23.875 130-134 20.815 28.9 25.919999999999998 24.365000000000002 135-139 21.38 28.294999999999998 26.365 23.96 140-144 20.905 28.165000000000003 26.245 24.685000000000002 145-149 21.505 27.900000000000002 26.169999999999998 24.425 150-151 21.825 27.175 26.387500000000003 24.6125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 2.0 23 2.0 24 3.0 25 5.5 26 7.0 27 8.0 28 13.0 29 18.0 30 23.0 31 33.0 32 35.5 33 44.5 34 60.0 35 72.0 36 96.0 37 116.0 38 135.5 39 164.0 40 194.5 41 210.0 42 223.5 43 248.0 44 251.5 45 262.0 46 268.0 47 255.5 48 234.0 49 190.5 50 156.5 51 129.0 52 106.5 53 90.5 54 74.0 55 64.0 56 48.5 57 35.0 58 27.5 59 21.5 60 20.0 61 13.5 62 8.5 63 6.5 64 3.0 65 2.5 66 3.0 67 3.5 68 2.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.7 #Duplication Level Percentage of deduplicated Percentage of total 1 97.7482088024565 95.5 2 2.175025588536336 4.25 3 0.0511770726714432 0.15 4 0.0255885363357216 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.16249999999999998 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.2875 0.0 0.0 0.0 0.0 74-75 0.3625 0.0 0.0 0.0 0.0 76-77 0.48750000000000004 0.0 0.0 0.0 0.0 78-79 0.7625 0.0 0.0 0.0 0.0 80-81 0.9375 0.0 0.0 0.0 0.0 82-83 1.0 0.0 0.0 0.0 0.0 84-85 1.2625 0.0 0.0 0.0 0.0 86-87 1.625 0.0 0.0 0.0 0.0 88-89 1.95 0.0 0.0 0.0 0.0 90-91 2.3 0.0 0.0 0.0 0.0 92-93 2.7125000000000004 0.0 0.0 0.0 0.0 94-95 3.05 0.0 0.0 0.0 0.0 96-97 3.55 0.0 0.0 0.0 0.0 98-99 4.2375 0.0 0.0 0.0 0.0 100-101 4.775 0.0 0.0 0.0 0.0 102-103 5.425000000000001 0.0 0.0 0.0 0.0 104-105 5.9375 0.0 0.0 0.0 0.0 106-107 6.5875 0.0 0.0 0.0 0.0 108-109 7.387499999999999 0.0 0.0 0.0 0.0 110-111 8.1875 0.0 0.0 0.0 0.0 112-113 8.8375 0.0 0.0 0.0 0.0 114-115 9.600000000000001 0.0 0.0 0.0 0.0 116-117 10.325 0.0 0.0 0.0 0.0 118-119 11.2375 0.0 0.0 0.0 0.0 120-121 11.975000000000001 0.0 0.0 0.0 0.0 122-123 12.875 0.0 0.0 0.0 0.0 124-125 13.8875 0.0 0.0 0.0 0.0 126-127 14.7125 0.0 0.0 0.0 0.0 128-129 15.862499999999999 0.0 0.0 0.0 0.0 130-131 17.0125 0.0 0.0 0.0 0.0 132-133 18.075 0.0 0.0 0.0 0.0 134-135 19.0 0.0 0.0 0.0 0.0 136-137 20.012500000000003 0.0 0.0 0.0 0.0 138-139 21.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTCACC 10 0.006830828 145.0 6 >>END_MODULE SRR28623226 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623226_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.088 37.0 37.0 37.0 37.0 37.0 2 36.3755 37.0 37.0 37.0 37.0 37.0 3 36.356 37.0 37.0 37.0 37.0 37.0 4 36.363 37.0 37.0 37.0 37.0 37.0 5 36.355 37.0 37.0 37.0 37.0 37.0 6 36.4055 37.0 37.0 37.0 37.0 37.0 7 36.3565 37.0 37.0 37.0 37.0 37.0 8 36.3855 37.0 37.0 37.0 37.0 37.0 9 36.3675 37.0 37.0 37.0 37.0 37.0 10-14 36.366200000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.3236 37.0 37.0 37.0 37.0 37.0 20-24 36.3053 37.0 37.0 37.0 37.0 37.0 25-29 36.26700000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.2455 37.0 37.0 37.0 37.0 37.0 35-39 36.2159 37.0 37.0 37.0 37.0 37.0 40-44 36.178700000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.102199999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.076499999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.043 37.0 37.0 37.0 37.0 37.0 60-64 36.0615 37.0 37.0 37.0 37.0 37.0 65-69 35.950100000000006 37.0 37.0 37.0 37.0 37.0 70-74 35.89059999999999 37.0 37.0 37.0 37.0 37.0 75-79 35.855199999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.9054 37.0 37.0 37.0 37.0 37.0 85-89 35.7158 37.0 37.0 37.0 37.0 37.0 90-94 35.715999999999994 37.0 37.0 37.0 37.0 37.0 95-99 35.634 37.0 37.0 37.0 37.0 37.0 100-104 35.597 37.0 37.0 37.0 37.0 37.0 105-109 35.55159999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.4897 37.0 37.0 37.0 37.0 37.0 115-119 35.3757 37.0 37.0 37.0 34.6 37.0 120-124 35.2496 37.0 37.0 37.0 29.8 37.0 125-129 35.23649999999999 37.0 37.0 37.0 27.4 37.0 130-134 35.18820000000001 37.0 37.0 37.0 29.8 37.0 135-139 34.956399999999995 37.0 37.0 37.0 25.0 37.0 140-144 35.007000000000005 37.0 37.0 37.0 25.0 37.0 145-149 34.7069 37.0 37.0 37.0 25.0 37.0 150-151 34.22925 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 3.0 16 1.0 17 0.0 18 0.0 19 2.0 20 0.0 21 4.0 22 3.0 23 7.0 24 7.0 25 17.0 26 14.0 27 25.0 28 22.0 29 34.0 30 39.0 31 28.0 32 56.0 33 88.0 34 214.0 35 593.0 36 2608.0 37 233.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.019009504752376 19.93496748374187 12.281140570285142 29.764882441220607 2 25.35 25.55 33.575 15.525 3 20.8 27.6 30.55 21.05 4 25.650000000000002 32.35 22.8 19.2 5 25.624999999999996 36.35 22.075 15.950000000000001 6 19.55 39.625 23.825 17.0 7 20.349999999999998 20.424999999999997 40.775 18.45 8 21.25 24.8 31.0 22.95 9 22.6 26.125 29.475 21.8 10-14 23.355 29.520000000000003 26.834999999999997 20.29 15-19 22.900000000000002 28.994999999999997 27.815 20.29 20-24 23.225 28.215 27.689999999999998 20.87 25-29 22.99 28.71 27.694999999999997 20.605 30-34 22.869999999999997 28.57 27.675 20.885 35-39 22.994999999999997 28.43 27.985 20.59 40-44 23.205000000000002 28.03 27.955000000000002 20.810000000000002 45-49 23.0 27.605 28.78 20.615 50-54 23.09 28.71 27.68 20.52 55-59 23.28 27.965 28.044999999999998 20.71 60-64 22.830000000000002 27.595 28.26 21.315 65-69 23.52 27.145000000000003 28.51 20.825 70-74 23.25 27.935 28.1 20.715 75-79 23.66 28.175 27.689999999999998 20.474999999999998 80-84 23.474999999999998 28.744999999999997 27.415 20.365 85-89 23.830000000000002 28.37 27.700000000000003 20.1 90-94 23.77 28.83 27.455000000000002 19.945 95-99 24.195 28.395 27.21 20.200000000000003 100-104 24.560000000000002 28.32 27.810000000000002 19.31 105-109 24.610000000000003 28.499999999999996 26.735 20.155 110-114 25.074999999999996 28.475 27.060000000000002 19.39 115-119 25.509999999999998 28.665000000000003 26.46 19.365 120-124 26.279999999999998 28.055000000000003 26.91 18.755 125-129 26.240000000000002 27.950000000000003 26.655 19.155 130-134 26.505000000000003 28.76 25.790000000000003 18.945 135-139 27.650000000000002 27.939999999999998 26.13 18.279999999999998 140-144 27.63 27.775 26.484999999999996 18.11 145-149 27.555000000000003 27.675 26.55 18.22 150-151 27.6875 28.549999999999997 25.4 18.3625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 1.0 6 1.0 7 1.5 8 1.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 1.0 18 1.5 19 1.5 20 1.0 21 0.5 22 2.5 23 3.5 24 5.0 25 7.0 26 4.0 27 6.0 28 12.5 29 14.5 30 19.0 31 25.5 32 36.0 33 44.0 34 50.5 35 65.5 36 89.0 37 112.0 38 152.5 39 182.5 40 204.5 41 230.0 42 231.0 43 241.5 44 262.5 45 280.0 46 275.0 47 239.0 48 205.0 49 187.5 50 158.0 51 124.5 52 106.0 53 92.0 54 74.5 55 60.0 56 45.0 57 30.0 58 22.0 59 20.0 60 21.0 61 14.0 62 7.5 63 5.5 64 3.5 65 2.5 66 1.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 1.0 73 1.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.6 #Duplication Level Percentage of deduplicated Percentage of total 1 97.64344262295081 95.3 2 2.2797131147540983 4.45 3 0.05122950819672131 0.15 4 0.025614754098360656 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.16249999999999998 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.2875 0.0 0.0 0.0 0.0 74-75 0.3625 0.0 0.0 0.0 0.0 76-77 0.48750000000000004 0.0 0.0 0.0 0.0 78-79 0.7625 0.0 0.0 0.0 0.0 80-81 0.9375 0.0 0.0 0.0 0.0 82-83 1.0 0.0 0.0 0.0 0.0 84-85 1.2625 0.0 0.0 0.0 0.0 86-87 1.625 0.0 0.0 0.0 0.0 88-89 1.95 0.0 0.0 0.0 0.0 90-91 2.3 0.0 0.0 0.0 0.0 92-93 2.7125000000000004 0.0 0.0 0.0 0.0 94-95 3.0374999999999996 0.0 0.0 0.0 0.0 96-97 3.525 0.0 0.0 0.0 0.0 98-99 4.2375 0.0 0.0 0.0 0.0 100-101 4.800000000000001 0.0 0.0 0.0 0.0 102-103 5.4375 0.0 0.0 0.0 0.0 104-105 5.987500000000001 0.0 0.0 0.0 0.0 106-107 6.6875 0.0 0.0 0.0 0.0 108-109 7.5125 0.0 0.0 0.0 0.0 110-111 8.375 0.0 0.0 0.0 0.0 112-113 9.1375 0.0 0.0 0.0 0.0 114-115 9.925 0.0 0.0 0.0 0.0 116-117 10.7125 0.0 0.0 0.0 0.0 118-119 11.6625 0.0 0.0 0.0 0.0 120-121 12.3875 0.0 0.0 0.0 0.0 122-123 13.274999999999999 0.0 0.0 0.0 0.0 124-125 14.3125 0.0 0.0 0.0 0.0 126-127 15.149999999999999 0.0 0.0 0.0 0.0 128-129 16.325 0.0 0.0 0.0 0.0 130-131 17.5125 0.0 0.0 0.0 0.0 132-133 18.575 0.0 0.0 0.0 0.0 134-135 19.55 0.0 0.0 0.0 0.0 136-137 20.5375 0.0 0.0 0.0 0.0 138-139 21.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1320877 spots for SRR28623226.sra Written 1320877 spots for SRR28623226.sra Read 1320877 spots for SRR28623226.sra Written 1320877 spots for SRR28623226.sra Read 1320877 spots for SRR28623226.sra Written 1320877 spots for SRR28623226.sra Read 1320884 spots for SRR28623226.sra Written 1320884 spots for SRR28623226.sra Read 1320877 spots for SRR28623226.sra Written 1320877 spots for SRR28623226.sra Read 1320877 spots for SRR28623226.sra Written 1320877 spots for SRR28623226.sra Read 1320877 spots for SRR28623226.sra Written 1320877 spots for SRR28623226.sra Read 1320877 spots for SRR28623226.sra Written 1320877 spots for SRR28623226.sra Read 1320877 spots for SRR28623226.sra Written 1320877 spots for SRR28623226.sra Read 1320877 spots for SRR28623226.sra Written 1320877 spots for SRR28623226.sra Read 1320877 spots for SRR28623226.sra Written 1320877 spots for SRR28623226.sra Read 1320877 spots for SRR28623226.sra Written 1320877 spots for SRR28623226.sra Read 1320877 spots for SRR28623226.sra Written 1320877 spots for SRR28623226.sra Read 1320877 spots for SRR28623226.sra Written 1320877 spots for SRR28623226.sra Read 1320877 spots for SRR28623226.sra Written 1320877 spots for SRR28623226.sra Read 1320877 spots for SRR28623226.sra Written 1320877 spots for SRR28623226.sra Read 1320877 spots for SRR28623226.sra Written 1320877 spots for SRR28623226.sra Read 1320877 spots for SRR28623226.sra Written 1320877 spots for SRR28623226.sra Read 1320877 spots for SRR28623226.sra Written 1320877 spots for SRR28623226.sra Read 1320877 spots for SRR28623226.sra Written 1320877 spots for SRR28623226.sra SRR ids: ['SRR28623226.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wficddhc SRR28623226.sra spots: 26417547 blocks: [[1, 1320877], [1320878, 2641754], [2641755, 3962631], [3962632, 5283508], [5283509, 6604385], [6604386, 7925262], [7925263, 9246139], [9246140, 10567016], [10567017, 11887893], [11887894, 13208770], [13208771, 14529647], [14529648, 15850524], [15850525, 17171401], [17171402, 18492278], [18492279, 19813155], [19813156, 21134032], [21134033, 22454909], [22454910, 23775786], [23775787, 25096663], [25096664, 26417547]] SRR28623226 file size 9752909 SRR28623226 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623226 SRR28623226_1.fastq SRR28623226_2.fastq Input file: SRR28623226_1.fastq Paired file: SRR28623226_2.fastq trimmed: SRR28623226-trimmed-pair1.fastq, SRR28623226-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 15:16:21 2025 >> started Thu Feb 13 15:17:04 2025 >> done (43.232s) 26417547 read pairs processed; of these: 38 ( 0.00%) short read pairs filtered out after trimming by size control 12252 ( 0.05%) empty read pairs filtered out after trimming by size control 26405257 (99.95%) read pairs available; of these: 7168147 (27.15%) trimmed read pairs available after processing 19237110 (72.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 2 0.00% 21 3 0.00% 22 3 0.00% 23 7 0.00% 24 6 0.00% 25 6 0.00% 26 9 0.00% 27 8 0.00% 28 11 0.00% 29 21 0.00% 30 19 0.00% 31 17 0.00% 32 24 0.00% 33 25 0.00% 34 28 0.00% 35 43 0.00% 36 58 0.00% 37 64 0.00% 38 58 0.00% 39 78 0.00% 40 99 0.00% 41 129 0.00% 42 147 0.00% 43 172 0.00% 44 176 0.00% 45 196 0.00% 46 234 0.00% 47 282 0.00% 48 366 0.00% 49 402 0.00% 50 462 0.00% 51 509 0.00% 52 649 0.00% 53 679 0.00% 54 759 0.00% 55 857 0.00% 56 942 0.00% 57 1108 0.00% 58 1262 0.00% 59 1438 0.01% 60 1737 0.01% 61 1982 0.01% 62 2310 0.01% 63 2608 0.01% 64 2915 0.01% 65 3332 0.01% 66 3790 0.01% 67 4201 0.02% 68 4806 0.02% 69 5359 0.02% 70 6167 0.02% 71 7186 0.03% 72 8182 0.03% 73 9320 0.04% 74 10755 0.04% 75 11868 0.04% 76 13441 0.05% 77 14506 0.05% 78 16151 0.06% 79 17922 0.07% 80 19523 0.07% 81 22051 0.08% 82 24574 0.09% 83 27170 0.10% 84 30227 0.11% 85 33210 0.13% 86 35674 0.14% 87 38484 0.15% 88 41141 0.16% 89 44149 0.17% 90 46772 0.18% 91 50502 0.19% 92 53522 0.20% 93 57144 0.22% 94 60617 0.23% 95 64808 0.25% 96 67878 0.26% 97 71270 0.27% 98 73567 0.28% 99 76200 0.29% 100 79172 0.30% 101 81003 0.31% 102 84493 0.32% 103 87510 0.33% 104 90078 0.34% 105 93644 0.35% 106 97261 0.37% 107 98774 0.37% 108 100925 0.38% 109 103478 0.39% 110 104248 0.39% 111 106164 0.40% 112 108423 0.41% 113 109068 0.41% 114 111696 0.42% 115 114247 0.43% 116 116336 0.44% 117 117938 0.45% 118 119454 0.45% 119 120645 0.46% 120 121048 0.46% 121 122824 0.47% 122 122280 0.46% 123 124071 0.47% 124 124923 0.47% 125 124195 0.47% 126 126653 0.48% 127 128579 0.49% 128 128923 0.49% 129 130012 0.49% 130 131467 0.50% 131 130324 0.49% 132 130833 0.50% 133 131063 0.50% 134 130161 0.49% 135 130613 0.49% 136 131473 0.50% 137 131869 0.50% 138 132869 0.50% 139 134467 0.51% 140 133289 0.50% 141 133792 0.51% 142 133537 0.51% 143 132060 0.50% 144 132685 0.50% 145 132423 0.50% 146 131133 0.50% 147 131103 0.50% 148 132600 0.50% 149 131648 0.50% 150 132287 0.50% 151 19237110 72.85% 26405257 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.73 fanout-score-rank=32 prefix-density=0.33 prefix-fanout=1.8 sequence=GGGGTGCGGTTAACTGTGGCAACGGCCGCCGATGAAATCACAGAGGAAGCCATCTCTTACAGGCTACTTAGCTATTACACCCTCTATATGTGGTTTTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=24 fanout-score=54.44 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=13.7 sequence=CCATCTTCTTCATCTATAGATTTCAATCACAACAG criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=33 prefix-density=0.38 prefix-fanout=2.2 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAACAATGACATTACTTCCATTGCAAGCAATGGCGGAAGAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCAC criterion=fanout-score sequence-density=0.09 sequence-density-rank=19 fanout-score=80.66 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=15.1 sequence=AAGAAAGAAAGAAA SRR28623226 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 15:17:49 Started mapping on | Feb 13 15:17:49 Finished on | Feb 13 15:20:44 Mapping speed, Million of reads per hour | 543.19 Number of input reads | 26405257 Average input read length | 285 UNIQUE READS: Uniquely mapped reads number | 24715557 Uniquely mapped reads % | 93.60% Average mapped length | 284.23 Number of splices: Total | 21662587 Number of splices: Annotated (sjdb) | 21154432 Number of splices: GT/AG | 21237914 Number of splices: GC/AG | 317932 Number of splices: AT/AC | 19290 Number of splices: Non-canonical | 87451 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.03% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 798239 % of reads mapped to multiple loci | 3.02% Number of reads mapped to too many loci | 146571 % of reads mapped to too many loci | 0.56% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.66% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 891461 891461 891461 N_multimapping 798239 798239 798239 N_noFeature 976009 24433098 1106503 N_ambiguous 295910 1572 143008 UnstrandedReadsAssigned:23443638 PositiveStrandReadsAssigned:280887 NegativeStrandReadsAssigned:23466046 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=136 echo kmer=131 SRR28623226 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623226-trimmed-pair1.fastq SRR28623226-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,405,257 reads, 23,825,655 reads pseudoaligned [quant] estimated average fragment length: 203.208 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,116 rounds 52401 SRR28623226.ke.tsv 34699 SRR28623226.se.tsv 87100 total ==> SRR28623226.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1815.79 5143.69 122.894 Potri.005G024800.1.v4.1 1035 832.792 3249 169.252 Potri.004G059700.1.v4.1 961 758.834 347 19.8383 Potri.007G009000.2.v4.1 1416 1213.79 0 0 Potri.003G141000.2.v4.1 2943 2740.79 1405.33 22.2446 Potri.016G087400.1.v4.1 270 107.189 1561.72 632.086 Potri.015G069301.1.v4.1 564 367.009 0 0 Potri.010G195200.1.v4.1 1773 1570.79 106 2.92758 Potri.012G127500.1.v4.1 977 774.806 163 9.12675 ==> SRR28623226.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 64 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 365 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 390 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR28623226 completed mapping pipeline successfully