Starting /dee2/code/volunteer_pipeline.sh SRR28623227 current disk space = 3089352790016 free memory = 1397909384 SRR28623227 SRAfilesize 6bd60fe7830649bc9db5abb2e18765b4 SRR28623227.sra SRR28623227.sra file validated SRR28623227 is paired end SRR28623227 is conventional basespace SRR28623227 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623227_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.45975 37.0 37.0 37.0 37.0 37.0 2 36.4025 37.0 37.0 37.0 37.0 37.0 3 36.6085 37.0 37.0 37.0 37.0 37.0 4 36.5955 37.0 37.0 37.0 37.0 37.0 5 36.627 37.0 37.0 37.0 37.0 37.0 6 36.5885 37.0 37.0 37.0 37.0 37.0 7 36.541 37.0 37.0 37.0 37.0 37.0 8 36.5445 37.0 37.0 37.0 37.0 37.0 9 36.583 37.0 37.0 37.0 37.0 37.0 10-14 36.5657 37.0 37.0 37.0 37.0 37.0 15-19 36.57860000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.57000000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.513600000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.45309999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.418099999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.3683 37.0 37.0 37.0 37.0 37.0 45-49 36.3265 37.0 37.0 37.0 37.0 37.0 50-54 36.3168 37.0 37.0 37.0 37.0 37.0 55-59 36.326100000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.3194 37.0 37.0 37.0 37.0 37.0 65-69 36.304 37.0 37.0 37.0 37.0 37.0 70-74 36.2627 37.0 37.0 37.0 37.0 37.0 75-79 36.2701 37.0 37.0 37.0 37.0 37.0 80-84 36.1633 37.0 37.0 37.0 37.0 37.0 85-89 36.184 37.0 37.0 37.0 37.0 37.0 90-94 36.0769 37.0 37.0 37.0 37.0 37.0 95-99 35.952299999999994 37.0 37.0 37.0 37.0 37.0 100-104 36.055 37.0 37.0 37.0 37.0 37.0 105-109 36.0094 37.0 37.0 37.0 37.0 37.0 110-114 35.934 37.0 37.0 37.0 37.0 37.0 115-119 35.881299999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.80329999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.739 37.0 37.0 37.0 37.0 37.0 130-134 35.876099999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.7133 37.0 37.0 37.0 37.0 37.0 140-144 35.47580000000001 37.0 37.0 37.0 37.0 37.0 145-149 35.461299999999994 37.0 37.0 37.0 34.6 37.0 150-151 35.31075 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 3.0 25 2.0 26 8.0 27 9.0 28 15.0 29 14.0 30 24.0 31 40.0 32 65.0 33 66.0 34 159.0 35 374.0 36 2944.0 37 275.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.060165455001254 14.36450238154926 8.799197793933317 36.776134369516164 2 19.3 14.875 36.825 28.999999999999996 3 18.0 20.150000000000002 28.1 33.75 4 22.05 27.224999999999998 25.575 25.15 5 24.525 30.85 24.425 20.200000000000003 6 20.349999999999998 35.75 22.1 21.8 7 16.425 27.400000000000002 41.25 14.924999999999999 8 17.325 27.250000000000004 32.025 23.400000000000002 9 17.175 24.525 33.525 24.775 10-14 18.95 31.014999999999997 27.72 22.314999999999998 15-19 19.235 28.744999999999997 28.720000000000002 23.3 20-24 19.759999999999998 29.04 27.839999999999996 23.36 25-29 19.435 29.895 27.185 23.485 30-34 19.064999999999998 29.294999999999998 28.199999999999996 23.44 35-39 19.835 28.84 27.944999999999997 23.380000000000003 40-44 19.59 28.875 27.905 23.630000000000003 45-49 19.445 29.535 27.82 23.200000000000003 50-54 19.46 28.16 28.415000000000003 23.965 55-59 19.435 28.685 28.1 23.78 60-64 19.445 29.145 27.889999999999997 23.52 65-69 20.52 29.255 27.310000000000002 22.915 70-74 20.275000000000002 29.115000000000002 27.115000000000002 23.494999999999997 75-79 19.42 27.735 28.525 24.32 80-84 19.985 28.865000000000002 27.205000000000002 23.945 85-89 20.26 28.865000000000002 27.644999999999996 23.23 90-94 20.349999999999998 28.705000000000002 26.965 23.98 95-99 20.8 29.24 27.200000000000003 22.759999999999998 100-104 20.76 29.195 26.784999999999997 23.26 105-109 20.53 28.63 27.77 23.07 110-114 20.445 28.51 27.595 23.45 115-119 20.895 29.134999999999998 27.41 22.56 120-124 20.79 28.865000000000002 26.685 23.66 125-129 20.875 28.505000000000003 27.105 23.515 130-134 20.43 29.04 26.185000000000002 24.345 135-139 20.115 29.17 26.590000000000003 24.125 140-144 21.265 27.400000000000002 27.395000000000003 23.94 145-149 20.849999999999998 27.99 26.334999999999997 24.825 150-151 21.3875 28.299999999999997 25.6125 24.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.5 18 1.5 19 2.0 20 3.0 21 2.5 22 3.0 23 3.0 24 3.5 25 5.5 26 8.0 27 13.0 28 14.0 29 19.0 30 29.0 31 32.5 32 37.5 33 52.0 34 73.5 35 96.5 36 117.0 37 122.0 38 135.0 39 186.0 40 216.0 41 208.5 42 216.5 43 232.5 44 249.5 45 242.0 46 224.0 47 228.0 48 214.0 49 186.0 50 154.5 51 143.0 52 123.5 53 89.0 54 82.0 55 75.0 56 47.5 57 25.0 58 17.5 59 14.5 60 15.5 61 10.5 62 7.0 63 5.5 64 2.0 65 1.0 66 2.5 67 2.5 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.775 #Duplication Level Percentage of deduplicated Percentage of total 1 83.8854073410922 70.275 2 13.458669054013727 22.55 3 2.1486123545210387 5.4 4 0.4476275738585497 1.5 5 0.029841838257236648 0.125 6 0.029841838257236648 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGACTCACAGGCAAAATAGACCACGAATTTCCATTCAATGGTCCTCGCCG 6 0.15 No Hit GTAACAGCCTTATCCACATTAAGAATCTCATGTGAATTCGATGAGATTAG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.4375 0.0 0.0 0.0 0.0 82-83 0.55 0.0 0.0 0.0 0.0 84-85 0.65 0.0 0.0 0.0 0.0 86-87 0.8125 0.0 0.0 0.0 0.0 88-89 0.9875 0.0 0.0 0.0 0.0 90-91 1.2374999999999998 0.0 0.0 0.0 0.0 92-93 1.4 0.0 0.0 0.0 0.0 94-95 1.5875 0.0 0.0 0.0 0.0 96-97 1.8125 0.0 0.0 0.0 0.0 98-99 2.25 0.0 0.0 0.0 0.0 100-101 2.5875 0.0 0.0 0.0 0.0 102-103 2.9000000000000004 0.0 0.0 0.0 0.0 104-105 3.2375 0.0 0.0 0.0 0.0 106-107 3.425 0.0 0.0 0.0 0.0 108-109 3.775 0.0 0.0 0.0 0.0 110-111 4.262499999999999 0.0 0.0 0.0 0.0 112-113 4.85 0.0 0.0 0.0 0.0 114-115 5.5 0.0 0.0 0.0 0.0 116-117 6.1875 0.0 0.0 0.0 0.0 118-119 6.9 0.0 0.0 0.0 0.0 120-121 7.5 0.0 0.0 0.0 0.0 122-123 8.15 0.0 0.0 0.0 0.0 124-125 8.8875 0.0 0.0 0.0 0.0 126-127 9.412500000000001 0.0 0.0 0.0 0.0 128-129 10.075 0.0 0.0 0.0 0.0 130-131 10.775 0.0 0.0 0.0 0.0 132-133 11.3 0.0 0.0 0.0 0.0 134-135 11.8 0.0 0.0 0.0 0.0 136-137 12.3125 0.0 0.0 0.0 0.0 138-139 13.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCTTTC 10 0.006830828 145.0 5 CCACTCT 10 0.006830828 145.0 2 CACTCTA 10 0.006830828 145.0 3 TACTTGA 10 0.006830828 145.0 8 ATTTCTC 10 0.006830828 145.0 5 CTACTTG 10 0.006830828 145.0 7 AAAAAAA 175 0.009100538 7.457143 110-114 >>END_MODULE SRR28623227 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623227_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.975 37.0 37.0 37.0 37.0 37.0 2 36.2695 37.0 37.0 37.0 37.0 37.0 3 36.228 37.0 37.0 37.0 37.0 37.0 4 36.2225 37.0 37.0 37.0 37.0 37.0 5 36.3535 37.0 37.0 37.0 37.0 37.0 6 36.2435 37.0 37.0 37.0 37.0 37.0 7 36.3015 37.0 37.0 37.0 37.0 37.0 8 36.3545 37.0 37.0 37.0 37.0 37.0 9 36.177 37.0 37.0 37.0 37.0 37.0 10-14 36.147000000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.1157 37.0 37.0 37.0 37.0 37.0 20-24 36.124900000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.0493 37.0 37.0 37.0 37.0 37.0 30-34 35.925599999999996 37.0 37.0 37.0 37.0 37.0 35-39 35.9111 37.0 37.0 37.0 37.0 37.0 40-44 35.899300000000004 37.0 37.0 37.0 37.0 37.0 45-49 35.9354 37.0 37.0 37.0 37.0 37.0 50-54 35.8857 37.0 37.0 37.0 37.0 37.0 55-59 35.6697 37.0 37.0 37.0 37.0 37.0 60-64 35.76190000000001 37.0 37.0 37.0 37.0 37.0 65-69 35.7738 37.0 37.0 37.0 37.0 37.0 70-74 35.7375 37.0 37.0 37.0 37.0 37.0 75-79 35.8202 37.0 37.0 37.0 37.0 37.0 80-84 35.7022 37.0 37.0 37.0 37.0 37.0 85-89 35.6342 37.0 37.0 37.0 37.0 37.0 90-94 35.6195 37.0 37.0 37.0 37.0 37.0 95-99 35.5908 37.0 37.0 37.0 37.0 37.0 100-104 35.5209 37.0 37.0 37.0 37.0 37.0 105-109 35.4799 37.0 37.0 37.0 37.0 37.0 110-114 35.4638 37.0 37.0 37.0 37.0 37.0 115-119 35.468900000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.50580000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.0454 37.0 37.0 37.0 29.8 37.0 130-134 35.298899999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.1075 37.0 37.0 37.0 27.4 37.0 140-144 35.1375 37.0 37.0 37.0 29.8 37.0 145-149 35.04090000000001 37.0 37.0 37.0 25.0 37.0 150-151 34.80975 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 7.0 14 5.0 15 7.0 16 3.0 17 9.0 18 5.0 19 4.0 20 6.0 21 10.0 22 7.0 23 12.0 24 7.0 25 9.0 26 9.0 27 9.0 28 19.0 29 21.0 30 18.0 31 37.0 32 53.0 33 90.0 34 194.0 35 534.0 36 2644.0 37 278.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.3 22.975 11.625 22.1 2 27.875 27.125 26.775 18.224999999999998 3 22.425 28.549999999999997 30.95 18.075 4 25.424999999999997 33.225 23.5 17.849999999999998 5 24.55 36.8 21.05 17.599999999999998 6 21.375 39.45 22.900000000000002 16.275000000000002 7 21.675 21.5 37.95 18.875 8 22.75 24.5 28.875 23.875 9 22.625 24.125 29.45 23.799999999999997 10-14 24.555 29.425 26.14 19.88 15-19 24.18 28.255000000000003 27.415 20.150000000000002 20-24 24.02 28.345 27.694999999999997 19.939999999999998 25-29 24.285 28.365000000000002 27.279999999999998 20.07 30-34 23.43 28.689999999999998 27.445000000000004 20.435 35-39 23.585 28.060000000000002 28.194999999999997 20.16 40-44 24.03 28.375 27.694999999999997 19.900000000000002 45-49 23.835 27.994999999999997 27.925 20.244999999999997 50-54 23.905 27.455000000000002 28.849999999999998 19.79 55-59 23.46 28.384999999999998 27.845 20.31 60-64 23.54 28.000000000000004 27.74 20.72 65-69 23.285 27.72 28.410000000000004 20.585 70-74 23.515 27.63 28.535 20.32 75-79 23.585 29.09 27.99 19.335 80-84 23.71 28.565 27.63 20.095 85-89 23.225 28.315 27.88 20.580000000000002 90-94 24.044999999999998 27.860000000000003 28.055000000000003 20.04 95-99 23.41 29.015 27.72 19.855 100-104 23.974999999999998 28.349999999999998 27.485 20.19 105-109 24.23 28.84 27.62 19.31 110-114 24.18 28.95 27.18 19.689999999999998 115-119 24.735 28.98 26.83 19.455 120-124 24.815 29.32 26.490000000000002 19.375 125-129 24.64 28.42 27.650000000000002 19.29 130-134 25.474999999999998 27.939999999999998 27.425 19.16 135-139 25.590000000000003 27.91 27.185 19.314999999999998 140-144 26.145000000000003 28.075 27.139999999999997 18.64 145-149 26.545 28.645 25.775 19.035 150-151 26.5 27.787499999999998 27.0125 18.7 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 1.0 9 1.5 10 1.0 11 1.0 12 2.0 13 1.0 14 0.5 15 1.0 16 1.5 17 1.5 18 1.0 19 1.0 20 4.0 21 3.5 22 3.0 23 4.5 24 2.5 25 2.5 26 5.0 27 11.0 28 12.5 29 12.5 30 18.0 31 25.5 32 32.0 33 49.5 34 74.5 35 79.0 36 92.5 37 121.0 38 147.0 39 173.0 40 173.0 41 207.0 42 252.0 43 257.5 44 269.5 45 244.5 46 237.0 47 250.5 48 219.0 49 198.0 50 170.0 51 127.0 52 100.5 53 85.5 54 69.0 55 50.0 56 41.5 57 34.0 58 25.5 59 19.5 60 13.5 61 8.0 62 5.5 63 6.0 64 5.5 65 3.5 66 1.5 67 1.5 68 1.5 69 1.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.5 75 1.0 76 0.5 77 0.0 78 1.5 79 2.0 80 1.0 81 2.0 82 2.5 83 1.0 84 0.0 85 0.0 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 1.5 93 1.5 94 1.0 95 1.5 96 0.5 97 0.0 98 0.0 99 1.0 100 6.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 84.98070644108044 71.575 2 12.496289700207777 21.05 3 1.9887206886316413 5.025 4 0.41555357672899973 1.4000000000000001 5 0.0 0.0 6 0.08904719501335707 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.029682398337785694 0.5 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 20 0.5 No Hit GGCTTCCTCAAGCTCAGCAGGCAATGCAGCTCAAAACCCTAGAAAATCGT 6 0.15 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.4375 0.0 0.0 0.0 0.0 82-83 0.55 0.0 0.0 0.0 0.0 84-85 0.65 0.0 0.0 0.0 0.0 86-87 0.8125 0.0 0.0 0.0 0.0 88-89 0.9875 0.0 0.0 0.0 0.0 90-91 1.2374999999999998 0.0 0.0 0.0 0.0 92-93 1.375 0.0 0.0 0.0 0.0 94-95 1.5625 0.0 0.0 0.0 0.0 96-97 1.7875 0.0 0.0 0.0 0.0 98-99 2.2 0.0 0.0 0.0 0.0 100-101 2.5375 0.0 0.0 0.0 0.0 102-103 2.8499999999999996 0.0 0.0 0.0 0.0 104-105 3.1625 0.0 0.0 0.0 0.0 106-107 3.375 0.0 0.0 0.0 0.0 108-109 3.725 0.0 0.0 0.0 0.0 110-111 4.2125 0.0 0.0 0.0 0.0 112-113 4.8 0.0 0.0 0.0 0.0 114-115 5.475 0.0 0.0 0.0 0.0 116-117 6.1625 0.0 0.0 0.0 0.0 118-119 6.9 0.0 0.0 0.0 0.0 120-121 7.5 0.0 0.0 0.0 0.0 122-123 8.15 0.0 0.0 0.0 0.0 124-125 8.875 0.0 0.0 0.0 0.0 126-127 9.4 0.0 0.0 0.0 0.0 128-129 10.075 0.0 0.0 0.0 0.0 130-131 10.75 0.0 0.0 0.0 0.0 132-133 11.275 0.0 0.0 0.0 0.0 134-135 11.775 0.0 0.0 0.0 0.0 136-137 12.3125 0.0 0.0 0.0 0.0 138-139 13.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAATCAA 20 3.5877043E-4 108.75 4 >>END_MODULE Read 1592266 spots for SRR28623227.sra Written 1592266 spots for SRR28623227.sra Read 1592266 spots for SRR28623227.sra Written 1592266 spots for SRR28623227.sra Read 1592266 spots for SRR28623227.sra Written 1592266 spots for SRR28623227.sra Read 1592266 spots for SRR28623227.sra Written 1592266 spots for SRR28623227.sra Read 1592266 spots for SRR28623227.sra Written 1592266 spots for SRR28623227.sra Read 1592266 spots for SRR28623227.sra Written 1592266 spots for SRR28623227.sra Read 1592266 spots for SRR28623227.sra Written 1592266 spots for SRR28623227.sra Read 1592266 spots for SRR28623227.sra Written 1592266 spots for SRR28623227.sra Read 1592266 spots for SRR28623227.sra Written 1592266 spots for SRR28623227.sra Read 1592266 spots for SRR28623227.sra Written 1592266 spots for SRR28623227.sra Read 1592266 spots for SRR28623227.sra Written 1592266 spots for SRR28623227.sra Read 1592266 spots for SRR28623227.sra Written 1592266 spots for SRR28623227.sra Read 1592273 spots for SRR28623227.sra Written 1592273 spots for SRR28623227.sra Read 1592266 spots for SRR28623227.sra Written 1592266 spots for SRR28623227.sra Read 1592266 spots for SRR28623227.sra Written 1592266 spots for SRR28623227.sra Read 1592266 spots for SRR28623227.sra Written 1592266 spots for SRR28623227.sra Read 1592266 spots for SRR28623227.sra Written 1592266 spots for SRR28623227.sra Read 1592266 spots for SRR28623227.sra Written 1592266 spots for SRR28623227.sra Read 1592266 spots for SRR28623227.sra Written 1592266 spots for SRR28623227.sra Read 1592266 spots for SRR28623227.sra Written 1592266 spots for SRR28623227.sra SRR ids: ['SRR28623227.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xn0oeyhk SRR28623227.sra spots: 31845327 blocks: [[1, 1592266], [1592267, 3184532], [3184533, 4776798], [4776799, 6369064], [6369065, 7961330], [7961331, 9553596], [9553597, 11145862], [11145863, 12738128], [12738129, 14330394], [14330395, 15922660], [15922661, 17514926], [17514927, 19107192], [19107193, 20699458], [20699459, 22291724], [22291725, 23883990], [23883991, 25476256], [25476257, 27068522], [27068523, 28660788], [28660789, 30253054], [30253055, 31845327]] SRR28623227 file size 11759026 SRR28623227 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623227 SRR28623227_1.fastq SRR28623227_2.fastq Input file: SRR28623227_1.fastq Paired file: SRR28623227_2.fastq trimmed: SRR28623227-trimmed-pair1.fastq, SRR28623227-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:55:29 2025 >> started Thu Feb 13 14:56:04 2025 >> done (35.253s) 31845327 read pairs processed; of these: 21 ( 0.00%) short read pairs filtered out after trimming by size control 22814 ( 0.07%) empty read pairs filtered out after trimming by size control 31822492 (99.93%) read pairs available; of these: 5634745 (17.71%) trimmed read pairs available after processing 26187747 (82.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 4 0.00% 21 5 0.00% 22 4 0.00% 23 5 0.00% 24 4 0.00% 25 7 0.00% 26 7 0.00% 27 13 0.00% 28 13 0.00% 29 11 0.00% 30 15 0.00% 31 17 0.00% 32 21 0.00% 33 15 0.00% 34 16 0.00% 35 19 0.00% 36 23 0.00% 37 21 0.00% 38 34 0.00% 39 34 0.00% 40 49 0.00% 41 48 0.00% 42 59 0.00% 43 53 0.00% 44 73 0.00% 45 100 0.00% 46 95 0.00% 47 138 0.00% 48 141 0.00% 49 179 0.00% 50 172 0.00% 51 231 0.00% 52 248 0.00% 53 310 0.00% 54 362 0.00% 55 415 0.00% 56 453 0.00% 57 563 0.00% 58 615 0.00% 59 796 0.00% 60 900 0.00% 61 1075 0.00% 62 1328 0.00% 63 1339 0.00% 64 1656 0.01% 65 1754 0.01% 66 2037 0.01% 67 2384 0.01% 68 2578 0.01% 69 3184 0.01% 70 3539 0.01% 71 4178 0.01% 72 4890 0.02% 73 5535 0.02% 74 6100 0.02% 75 7148 0.02% 76 7857 0.02% 77 8660 0.03% 78 9537 0.03% 79 10636 0.03% 80 11861 0.04% 81 13264 0.04% 82 15062 0.05% 83 16614 0.05% 84 18646 0.06% 85 19997 0.06% 86 21841 0.07% 87 23375 0.07% 88 24741 0.08% 89 26466 0.08% 90 28768 0.09% 91 31047 0.10% 92 33149 0.10% 93 36844 0.12% 94 38696 0.12% 95 40600 0.13% 96 42790 0.13% 97 44659 0.14% 98 46315 0.15% 99 48594 0.15% 100 50505 0.16% 101 52718 0.17% 102 55249 0.17% 103 58064 0.18% 104 60579 0.19% 105 63276 0.20% 106 65490 0.21% 107 66930 0.21% 108 68182 0.21% 109 70450 0.22% 110 71994 0.23% 111 74258 0.23% 112 76701 0.24% 113 77452 0.24% 114 81263 0.26% 115 83842 0.26% 116 85976 0.27% 117 88456 0.28% 118 89310 0.28% 119 91048 0.29% 120 92149 0.29% 121 94099 0.30% 122 95957 0.30% 123 97774 0.31% 124 99944 0.31% 125 100900 0.32% 126 104949 0.33% 127 104769 0.33% 128 105837 0.33% 129 107835 0.34% 130 108598 0.34% 131 108582 0.34% 132 111321 0.35% 133 111932 0.35% 134 112907 0.35% 135 114733 0.36% 136 116361 0.37% 137 117666 0.37% 138 119134 0.37% 139 120777 0.38% 140 119775 0.38% 141 120921 0.38% 142 122832 0.39% 143 124030 0.39% 144 124419 0.39% 145 126618 0.40% 146 127287 0.40% 147 127558 0.40% 148 129072 0.41% 149 129527 0.41% 150 129703 0.41% 151 26187747 82.29% 31822492 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=36 prefix-density=0.27 prefix-fanout=2.0 sequence=TACGTGCTTAAT criterion=fanout-score sequence-density=0.04 sequence-density-rank=35 fanout-score=43.29 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=11.4 sequence=ACCATCTTTGCCATGAAGCTATACCTATCAGCTGCTTGATCAATCAATTTTTGAGTTGGCCGTCCAGCTCCATGTCCAGCTTTACAATCAATGCGGCCGATTATTGGATTGGTCTGGGGGCT criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.84 fanout-score-rank=36 prefix-density=0.24 prefix-fanout=2.5 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAACAATGACATTACTTCCATTGCAAGCAATGGCGGAAGAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCAGTGCATCAGTTTTATCGCCTCCAAGCCGAAGGGTGTCTAGGTTCCAAGATTTGATG criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=77.93 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=10.7 sequence=TGGTGTTGACAAAGCCTTCGGCCGTGACATTGTCGATGCGCATTACAAGGCATGTCTGTATGCAGGCATTAACATTAGCGGCATCAATGGAGAAGTGATGCCAGGCCAATGGGAGTTTCAAGTTGGACCTTCAGTCGGTATCTCCGCCGGAGATGAATTATGGGCTGCTCGGTATATTTTGGAGAGGATTACTGAGGTTGCTGGAGTTGTGCTTTCATTTGATCCCAAGCCAATTCAGGGCGATTGGAATGGAGCGGGGGCACACACAAATTACAGTACTGAGTCTATGAGAAATGAAGGAGGCTATGAAATCATCAAGAAAGCAATTGAAAAGCTTGGTCTGAGGCATAAAGAACACATTGCAGCTTATGGAGAAGGGAATGAGCGGAGACTCACCGGCCGACACGAAACGGCTGACATTAATACCTTCAAATGGGGTGTGGCTGATCGTGGAGCTTCTATTCGTGTTGGTCGCGACACAGAGAAAGAAGGAAAGGGGTATTTTGAGGAT SRR28623227 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:56:49 Started mapping on | Feb 13 14:56:49 Finished on | Feb 13 15:00:24 Mapping speed, Million of reads per hour | 532.84 Number of input reads | 31822492 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 29276922 Uniquely mapped reads % | 92.00% Average mapped length | 290.51 Number of splices: Total | 26499865 Number of splices: Annotated (sjdb) | 25822553 Number of splices: GT/AG | 25984347 Number of splices: GC/AG | 386295 Number of splices: AT/AC | 21158 Number of splices: Non-canonical | 108065 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.03% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 814690 % of reads mapped to multiple loci | 2.56% Number of reads mapped to too many loci | 77325 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.91% % of reads unmapped: other | 0.29% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1730880 1730880 1730880 N_multimapping 814690 814690 814690 N_noFeature 1222480 28763534 1435435 N_ambiguous 488035 2256 186317 UnstrandedReadsAssigned:27566407 PositiveStrandReadsAssigned:511132 NegativeStrandReadsAssigned:27655170 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623227 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623227-trimmed-pair1.fastq SRR28623227-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,822,492 reads, 28,040,747 reads pseudoaligned [quant] estimated average fragment length: 223.027 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,210 rounds 52401 SRR28623227.ke.tsv 34699 SRR28623227.se.tsv 87100 total ==> SRR28623227.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1795.97 2640 46.9009 Potri.005G024800.1.v4.1 1035 812.973 940 36.8917 Potri.004G059700.1.v4.1 961 738.992 102 4.4039 Potri.007G009000.2.v4.1 1416 1193.97 0 0 Potri.003G141000.2.v4.1 2943 2720.97 1967.56 23.0717 Potri.016G087400.1.v4.1 270 95.9677 2089.97 694.85 Potri.015G069301.1.v4.1 564 347.376 0 0 Potri.010G195200.1.v4.1 1773 1550.97 818.993 16.8482 Potri.012G127500.1.v4.1 977 754.987 37 1.56365 ==> SRR28623227.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 33 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 469 Potri.001G212900.v4.1 122 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 175 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 35 SRR28623227 completed mapping pipeline successfully