Starting /dee2/code/volunteer_pipeline.sh SRR28623228 current disk space = 3089202262016 free memory = 1488311648 SRR28623228 SRAfilesize ade07e1892bc9ab0de825cb08c62eea6 SRR28623228.sra SRR28623228.sra file validated SRR28623228 is paired end SRR28623228 is conventional basespace SRR28623228 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623228_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4385 37.0 37.0 37.0 37.0 37.0 2 36.367 37.0 37.0 37.0 37.0 37.0 3 36.5625 37.0 37.0 37.0 37.0 37.0 4 36.626 37.0 37.0 37.0 37.0 37.0 5 36.574 37.0 37.0 37.0 37.0 37.0 6 36.6915 37.0 37.0 37.0 37.0 37.0 7 36.557 37.0 37.0 37.0 37.0 37.0 8 36.502 37.0 37.0 37.0 37.0 37.0 9 36.5 37.0 37.0 37.0 37.0 37.0 10-14 36.586 37.0 37.0 37.0 37.0 37.0 15-19 36.5467 37.0 37.0 37.0 37.0 37.0 20-24 36.539 37.0 37.0 37.0 37.0 37.0 25-29 36.5096 37.0 37.0 37.0 37.0 37.0 30-34 36.489599999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.455600000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.39150000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.40070000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.314899999999994 37.0 37.0 37.0 37.0 37.0 55-59 36.2802 37.0 37.0 37.0 37.0 37.0 60-64 36.3172 37.0 37.0 37.0 37.0 37.0 65-69 36.2572 37.0 37.0 37.0 37.0 37.0 70-74 36.1637 37.0 37.0 37.0 37.0 37.0 75-79 36.164699999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.1478 37.0 37.0 37.0 37.0 37.0 85-89 36.1263 37.0 37.0 37.0 37.0 37.0 90-94 36.104200000000006 37.0 37.0 37.0 37.0 37.0 95-99 35.9959 37.0 37.0 37.0 37.0 37.0 100-104 36.030899999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.9745 37.0 37.0 37.0 37.0 37.0 110-114 35.942800000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.9435 37.0 37.0 37.0 37.0 37.0 120-124 35.765 37.0 37.0 37.0 37.0 37.0 125-129 35.71809999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.8257 37.0 37.0 37.0 37.0 37.0 135-139 35.60809999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.311099999999996 37.0 37.0 37.0 34.6 37.0 145-149 35.1265 37.0 37.0 37.0 29.8 37.0 150-151 34.812 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 2.0 24 2.0 25 1.0 26 12.0 27 13.0 28 8.0 29 24.0 30 28.0 31 39.0 32 63.0 33 91.0 34 168.0 35 356.0 36 2881.0 37 310.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.450803212851408 13.95582329317269 9.939759036144578 44.653614457831324 2 17.4 15.725 36.325 30.55 3 19.45 17.95 27.500000000000004 35.099999999999994 4 24.025 25.3 23.3 27.375 5 23.95 32.025 23.674999999999997 20.349999999999998 6 19.2 36.7 23.05 21.05 7 16.875 28.375 39.625 15.125 8 17.599999999999998 26.924999999999997 32.775 22.7 9 18.775 24.275 32.65 24.3 10-14 19.71 30.270000000000003 27.075 22.945 15-19 20.05 29.189999999999998 27.389999999999997 23.369999999999997 20-24 20.105 29.025000000000002 27.005000000000003 23.865 25-29 20.25 28.754999999999995 27.305 23.69 30-34 19.82 29.7 26.71 23.77 35-39 19.55 30.070000000000004 26.875 23.505000000000003 40-44 19.79 29.285 27.455000000000002 23.47 45-49 20.59 28.904999999999998 27.450000000000003 23.055 50-54 20.015 28.720000000000002 27.61 23.655 55-59 20.225 28.83 27.48 23.465 60-64 20.375 28.525 26.950000000000003 24.15 65-69 20.57 28.15 27.405 23.875 70-74 20.630000000000003 28.87 26.655 23.845 75-79 20.265 28.794999999999998 27.36 23.580000000000002 80-84 20.84 28.96 26.745 23.455000000000002 85-89 20.655 28.365000000000002 27.495000000000005 23.485 90-94 20.96 28.705000000000002 26.939999999999998 23.395 95-99 20.724999999999998 28.665000000000003 26.945000000000004 23.665 100-104 21.365000000000002 28.7 26.795 23.14 105-109 21.715 27.875 26.575 23.835 110-114 21.035 29.015 26.424999999999997 23.525 115-119 21.715 28.205000000000002 26.36 23.72 120-124 21.085 28.475 26.650000000000002 23.79 125-129 21.54 27.900000000000002 26.19 24.37 130-134 21.805 28.860000000000003 25.619999999999997 23.715 135-139 22.37 28.134999999999998 25.145 24.349999999999998 140-144 21.709999999999997 28.110000000000003 25.11 25.069999999999997 145-149 22.27 27.944999999999997 26.045 23.74 150-151 22.225 26.8 25.674999999999997 25.3 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.5 22 1.0 23 1.0 24 3.0 25 3.0 26 2.5 27 8.0 28 15.5 29 14.5 30 15.5 31 34.0 32 56.0 33 62.5 34 69.0 35 86.0 36 107.5 37 118.0 38 133.0 39 149.5 40 169.0 41 204.5 42 208.5 43 197.0 44 209.5 45 250.5 46 269.0 47 254.5 48 220.5 49 179.5 50 164.5 51 170.0 52 143.0 53 100.5 54 88.5 55 74.0 56 52.0 57 40.0 58 31.5 59 25.0 60 19.5 61 9.5 62 7.5 63 5.5 64 4.0 65 4.0 66 2.5 67 2.0 68 2.0 69 2.0 70 2.5 71 1.0 72 0.5 73 0.5 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.45 #Duplication Level Percentage of deduplicated Percentage of total 1 84.96151568975725 71.75 2 12.492599171107164 21.099999999999998 3 1.8946121965660152 4.8 4 0.5032563647128478 1.7000000000000002 5 0.11841326228537595 0.5 6 0.029603315571343988 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCATTGTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGC 6 0.15 No Hit CATCTCCTTCCATCTCCTTCCGATTCCAACGGAGCCACGGCCTTACTCGA 5 0.125 No Hit CTCGGTTGCGAAAAACACCCTGAGAAATCCTATCATTACATATATATGCT 5 0.125 No Hit CCAGTCCAAGTATCTCTTGAGATAGATAGAAACAGTCATTGTGCATGAGA 5 0.125 No Hit ACCCAACATTGCCCACCGTCCATGAATAAGTTCGCATTCTCTAAACCTCT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.36250000000000004 0.0 0.0 0.0 0.0 82-83 0.42500000000000004 0.0 0.0 0.0 0.0 84-85 0.55 0.0 0.0 0.0 0.0 86-87 0.7375 0.0 0.0 0.0 0.0 88-89 0.9875 0.0 0.0 0.0 0.0 90-91 1.2 0.0 0.0 0.0 0.0 92-93 1.6 0.0 0.0 0.0 0.0 94-95 1.925 0.0 0.0 0.0 0.0 96-97 2.3375 0.0 0.0 0.0 0.0 98-99 2.7375 0.0 0.0 0.0 0.0 100-101 3.25 0.0 0.0 0.0 0.0 102-103 3.9 0.0 0.0 0.0 0.0 104-105 4.2 0.0 0.0 0.0 0.0 106-107 4.7375 0.0 0.0 0.0 0.0 108-109 5.1875 0.0 0.0 0.0 0.0 110-111 5.975 0.0 0.0 0.0 0.0 112-113 6.699999999999999 0.0 0.0 0.0 0.0 114-115 7.512499999999999 0.0 0.0 0.0 0.0 116-117 8.2 0.0 0.0 0.0 0.0 118-119 8.8625 0.0 0.0 0.0 0.0 120-121 9.75 0.0 0.0 0.0 0.0 122-123 10.3 0.0 0.0 0.0 0.0 124-125 11.2375 0.0 0.0 0.0 0.0 126-127 12.6375 0.0 0.0 0.0 0.0 128-129 13.575 0.0 0.0 0.0 0.0 130-131 14.35 0.0 0.0 0.0 0.0 132-133 15.325 0.0 0.0 0.0 0.0 134-135 16.225 0.0 0.0 0.0 0.0 136-137 17.200000000000003 0.0 0.0 0.0 0.0 138-139 17.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCATAG 10 0.006830828 145.0 1 >>END_MODULE SRR28623228 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623228_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9165 37.0 37.0 37.0 37.0 37.0 2 36.2575 37.0 37.0 37.0 37.0 37.0 3 36.419 37.0 37.0 37.0 37.0 37.0 4 36.2345 37.0 37.0 37.0 37.0 37.0 5 36.397 37.0 37.0 37.0 37.0 37.0 6 36.3325 37.0 37.0 37.0 37.0 37.0 7 36.2795 37.0 37.0 37.0 37.0 37.0 8 36.2465 37.0 37.0 37.0 37.0 37.0 9 36.236 37.0 37.0 37.0 37.0 37.0 10-14 36.2536 37.0 37.0 37.0 37.0 37.0 15-19 36.241200000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.2318 37.0 37.0 37.0 37.0 37.0 25-29 36.1785 37.0 37.0 37.0 37.0 37.0 30-34 36.1131 37.0 37.0 37.0 37.0 37.0 35-39 36.1358 37.0 37.0 37.0 37.0 37.0 40-44 36.106399999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.12179999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.071099999999994 37.0 37.0 37.0 37.0 37.0 55-59 35.9841 37.0 37.0 37.0 37.0 37.0 60-64 35.9692 37.0 37.0 37.0 37.0 37.0 65-69 36.0066 37.0 37.0 37.0 37.0 37.0 70-74 36.008399999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.9968 37.0 37.0 37.0 37.0 37.0 80-84 35.8505 37.0 37.0 37.0 37.0 37.0 85-89 35.8494 37.0 37.0 37.0 37.0 37.0 90-94 35.7995 37.0 37.0 37.0 37.0 37.0 95-99 35.8711 37.0 37.0 37.0 37.0 37.0 100-104 35.756099999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.685 37.0 37.0 37.0 37.0 37.0 110-114 35.772499999999994 37.0 37.0 37.0 37.0 37.0 115-119 35.6378 37.0 37.0 37.0 37.0 37.0 120-124 35.6629 37.0 37.0 37.0 37.0 37.0 125-129 35.27310000000001 37.0 37.0 37.0 32.2 37.0 130-134 35.4983 37.0 37.0 37.0 37.0 37.0 135-139 35.2938 37.0 37.0 37.0 32.2 37.0 140-144 35.3504 37.0 37.0 37.0 34.6 37.0 145-149 35.1748 37.0 37.0 37.0 32.2 37.0 150-151 34.87175 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 5.0 15 10.0 16 2.0 17 1.0 18 2.0 19 5.0 20 1.0 21 6.0 22 5.0 23 4.0 24 8.0 25 13.0 26 5.0 27 5.0 28 9.0 29 19.0 30 26.0 31 24.0 32 55.0 33 87.0 34 187.0 35 545.0 36 2698.0 37 276.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.824999999999996 19.400000000000002 13.975000000000001 28.799999999999997 2 27.3 24.65 30.675 17.375 3 23.275000000000002 26.275 31.225 19.225 4 26.400000000000002 31.75 22.5 19.35 5 26.3 35.3 21.8 16.6 6 21.85 37.574999999999996 22.1 18.475 7 21.875 21.825 37.55 18.75 8 22.575 24.9 28.625 23.9 9 23.45 24.4 30.349999999999998 21.8 10-14 24.89 28.03 26.740000000000002 20.34 15-19 24.75 27.185 27.205000000000002 20.86 20-24 23.96 27.74 27.16 21.14 25-29 23.990000000000002 28.83 26.590000000000003 20.59 30-34 24.07 27.375 27.66 20.895 35-39 23.799999999999997 27.705000000000002 27.994999999999997 20.5 40-44 23.585 27.83 27.685 20.9 45-49 23.89 27.21 27.384999999999998 21.515 50-54 23.815 27.450000000000003 27.650000000000002 21.085 55-59 23.9 27.755000000000003 27.575 20.77 60-64 23.73 27.42 27.755000000000003 21.095 65-69 23.53 27.99 27.560000000000002 20.919999999999998 70-74 23.77 27.505000000000003 27.38 21.345 75-79 23.53 27.589999999999996 28.449999999999996 20.43 80-84 23.585 28.1 27.875 20.44 85-89 23.830000000000002 28.044999999999998 27.595 20.53 90-94 23.09 28.720000000000002 27.38 20.810000000000002 95-99 24.07 27.52 27.315 21.095 100-104 24.79 27.384999999999998 27.355 20.47 105-109 24.375 27.834999999999997 27.435 20.355 110-114 25.06 27.435 26.965 20.54 115-119 25.480000000000004 28.125 26.490000000000002 19.905 120-124 25.430000000000003 28.615000000000002 26.58 19.375 125-129 26.179999999999996 27.589999999999996 26.595000000000002 19.634999999999998 130-134 27.055 27.85 26.484999999999996 18.61 135-139 26.314999999999998 28.26 26.135 19.29 140-144 27.339999999999996 28.09 26.179999999999996 18.39 145-149 27.605 27.87 26.045 18.48 150-151 27.05 28.525 27.075 17.349999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 1.0 10 1.0 11 1.0 12 0.5 13 0.0 14 0.0 15 0.0 16 1.0 17 1.5 18 0.5 19 1.0 20 1.5 21 2.0 22 2.0 23 1.5 24 4.5 25 5.0 26 3.5 27 3.0 28 7.5 29 13.0 30 17.5 31 21.5 32 23.5 33 36.0 34 55.0 35 67.5 36 80.0 37 112.0 38 140.0 39 147.5 40 172.5 41 180.5 42 206.0 43 247.0 44 259.0 45 257.0 46 249.0 47 241.5 48 225.5 49 209.0 50 175.5 51 146.0 52 132.0 53 117.5 54 100.0 55 81.0 56 59.0 57 43.0 58 33.0 59 25.5 60 19.5 61 14.5 62 10.0 63 7.5 64 5.5 65 1.5 66 2.0 67 3.0 68 1.0 69 0.5 70 1.5 71 2.5 72 2.0 73 1.0 74 0.5 75 0.0 76 0.5 77 1.0 78 1.5 79 1.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 1.0 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.425 #Duplication Level Percentage of deduplicated Percentage of total 1 85.95258999122038 73.425 2 11.911033069944397 20.349999999999998 3 1.5803336259877085 4.05 4 0.3804506877377817 1.3 5 0.11706175007316359 0.5 6 0.029265437518290898 0.15 7 0.0 0.0 8 0.0 0.0 9 0.029265437518290898 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 6 0.15 No Hit CATTGAACCATGGAAATGTCATCGATTTGGGAGTCAAGTCCGCAGCTGGA 5 0.125 No Hit CTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATGATCTCA 5 0.125 No Hit GGAGTTCTATCATGCTGCCAGGGATGCTATCCTTCTCTATGAGGCTGTTG 5 0.125 No Hit ATTCGCTCTTGGTAAGCCCGCAGAGTACTTGCAATTTGATTTGGATTCGT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.36250000000000004 0.0 0.0 0.0 0.0 82-83 0.4125 0.0 0.0 0.0 0.0 84-85 0.5249999999999999 0.0 0.0 0.0 0.0 86-87 0.7125 0.0 0.0 0.0 0.0 88-89 0.9624999999999999 0.0 0.0 0.0 0.0 90-91 1.175 0.0 0.0 0.0 0.0 92-93 1.575 0.0 0.0 0.0 0.0 94-95 1.9 0.0 0.0 0.0 0.0 96-97 2.3125 0.0 0.0 0.0 0.0 98-99 2.7125000000000004 0.0 0.0 0.0 0.0 100-101 3.25 0.0 0.0 0.0 0.0 102-103 3.925 0.0 0.0 0.0 0.0 104-105 4.225 0.0 0.0 0.0 0.0 106-107 4.7625 0.0 0.0 0.0 0.0 108-109 5.2125 0.0 0.0 0.0 0.0 110-111 5.987500000000001 0.0 0.0 0.0 0.0 112-113 6.6875 0.0 0.0 0.0 0.0 114-115 7.5 0.0 0.0 0.0 0.0 116-117 8.1625 0.0 0.0 0.0 0.0 118-119 8.850000000000001 0.0 0.0 0.0 0.0 120-121 9.85 0.0 0.0 0.0 0.0 122-123 10.4125 0.0 0.0 0.0 0.0 124-125 11.325 0.0 0.0 0.0 0.0 126-127 12.7125 0.0 0.0 0.0 0.0 128-129 13.6375 0.0 0.0 0.0 0.0 130-131 14.425 0.0 0.0 0.0 0.0 132-133 15.425 0.0 0.0 0.0 0.0 134-135 16.325000000000003 0.0 0.0 0.0 0.0 136-137 17.299999999999997 0.0 0.0 0.0 0.0 138-139 18.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1468314 spots for SRR28623228.sra Written 1468314 spots for SRR28623228.sra Read 1468314 spots for SRR28623228.sra Written 1468314 spots for SRR28623228.sra Read 1468314 spots for SRR28623228.sra Written 1468314 spots for SRR28623228.sra Read 1468314 spots for SRR28623228.sra Written 1468314 spots for SRR28623228.sra Read 1468314 spots for SRR28623228.sra Written 1468314 spots for SRR28623228.sra Read 1468314 spots for SRR28623228.sra Written 1468314 spots for SRR28623228.sra Read 1468314 spots for SRR28623228.sra Written 1468314 spots for SRR28623228.sra Read 1468314 spots for SRR28623228.sra Written 1468314 spots for SRR28623228.sra Read 1468314 spots for SRR28623228.sra Written 1468314 spots for SRR28623228.sra Read 1468314 spots for SRR28623228.sra Written 1468314 spots for SRR28623228.sra Read 1468314 spots for SRR28623228.sra Written 1468314 spots for SRR28623228.sra Read 1468314 spots for SRR28623228.sra Written 1468314 spots for SRR28623228.sra Read 1468314 spots for SRR28623228.sra Written 1468314 spots for SRR28623228.sra Read 1468314 spots for SRR28623228.sra Written 1468314 spots for SRR28623228.sra Read 1468314 spots for SRR28623228.sra Written 1468314 spots for SRR28623228.sra Read 1468314 spots for SRR28623228.sra Written 1468314 spots for SRR28623228.sra Read 1468314 spots for SRR28623228.sra Written 1468314 spots for SRR28623228.sra Read 1468331 spots for SRR28623228.sra Written 1468331 spots for SRR28623228.sra Read 1468314 spots for SRR28623228.sra Written 1468314 spots for SRR28623228.sra Read 1468314 spots for SRR28623228.sra Written 1468314 spots for SRR28623228.sra SRR ids: ['SRR28623228.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_096h1vlx SRR28623228.sra spots: 29366297 blocks: [[1, 1468314], [1468315, 2936628], [2936629, 4404942], [4404943, 5873256], [5873257, 7341570], [7341571, 8809884], [8809885, 10278198], [10278199, 11746512], [11746513, 13214826], [13214827, 14683140], [14683141, 16151454], [16151455, 17619768], [17619769, 19088082], [19088083, 20556396], [20556397, 22024710], [22024711, 23493024], [23493025, 24961338], [24961339, 26429652], [26429653, 27897966], [27897967, 29366297]] SRR28623228 file size 10842794 SRR28623228 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623228 SRR28623228_1.fastq SRR28623228_2.fastq Input file: SRR28623228_1.fastq Paired file: SRR28623228_2.fastq trimmed: SRR28623228-trimmed-pair1.fastq, SRR28623228-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 15:09:15 2025 >> started Thu Feb 13 15:09:53 2025 >> done (38.895s) 29366297 read pairs processed; of these: 15 ( 0.00%) short read pairs filtered out after trimming by size control 21139 ( 0.07%) empty read pairs filtered out after trimming by size control 29345143 (99.93%) read pairs available; of these: 6959182 (23.71%) trimmed read pairs available after processing 22385961 (76.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 0 0.00% 21 1 0.00% 22 2 0.00% 23 3 0.00% 24 7 0.00% 25 2 0.00% 26 11 0.00% 27 10 0.00% 28 10 0.00% 29 5 0.00% 30 20 0.00% 31 24 0.00% 32 14 0.00% 33 20 0.00% 34 23 0.00% 35 19 0.00% 36 30 0.00% 37 48 0.00% 38 54 0.00% 39 72 0.00% 40 66 0.00% 41 84 0.00% 42 106 0.00% 43 90 0.00% 44 127 0.00% 45 137 0.00% 46 158 0.00% 47 192 0.00% 48 225 0.00% 49 300 0.00% 50 300 0.00% 51 392 0.00% 52 442 0.00% 53 525 0.00% 54 553 0.00% 55 608 0.00% 56 644 0.00% 57 729 0.00% 58 937 0.00% 59 998 0.00% 60 1276 0.00% 61 1565 0.01% 62 1774 0.01% 63 1953 0.01% 64 2395 0.01% 65 2560 0.01% 66 2943 0.01% 67 3319 0.01% 68 3702 0.01% 69 4317 0.01% 70 4796 0.02% 71 5596 0.02% 72 6448 0.02% 73 7387 0.03% 74 8539 0.03% 75 9567 0.03% 76 10864 0.04% 77 11707 0.04% 78 13052 0.04% 79 14426 0.05% 80 16025 0.05% 81 17981 0.06% 82 20269 0.07% 83 22129 0.08% 84 24667 0.08% 85 26951 0.09% 86 29320 0.10% 87 32227 0.11% 88 34289 0.12% 89 36593 0.12% 90 38506 0.13% 91 41759 0.14% 92 44521 0.15% 93 47516 0.16% 94 50949 0.17% 95 54693 0.19% 96 57809 0.20% 97 60246 0.21% 98 62723 0.21% 99 65517 0.22% 100 67963 0.23% 101 69971 0.24% 102 72637 0.25% 103 75671 0.26% 104 78271 0.27% 105 81911 0.28% 106 85893 0.29% 107 88158 0.30% 108 89528 0.31% 109 92911 0.32% 110 93803 0.32% 111 95678 0.33% 112 97683 0.33% 113 98984 0.34% 114 102250 0.35% 115 106245 0.36% 116 108544 0.37% 117 111739 0.38% 118 114006 0.39% 119 115251 0.39% 120 116337 0.40% 121 117570 0.40% 122 117105 0.40% 123 119639 0.41% 124 122610 0.42% 125 123002 0.42% 126 126262 0.43% 127 128437 0.44% 128 131064 0.45% 129 132171 0.45% 130 133289 0.45% 131 133466 0.45% 132 134663 0.46% 133 136131 0.46% 134 135487 0.46% 135 136152 0.46% 136 138378 0.47% 137 138913 0.47% 138 141640 0.48% 139 143844 0.49% 140 143289 0.49% 141 143911 0.49% 142 143106 0.49% 143 143385 0.49% 144 143878 0.49% 145 144143 0.49% 146 144120 0.49% 147 145234 0.49% 148 146808 0.50% 149 148765 0.51% 150 148421 0.51% 151 22385961 76.29% 29345143 reads passed initial QC criterion=sequence-density sequence-density=1.01 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=25 prefix-density=1.02 prefix-fanout=1.9 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.04 sequence-density-rank=25 fanout-score=35.30 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=2.2 sequence=TGAATGGTGCACATTACGGGTCCATGGCACAAAATCAGAGGATAACAATATCCATTCAAGACTATGCAACAATATAATTTGATTATCCTTAGAAAGTGCTTCTCCTTACACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=0.87 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=21 prefix-density=0.87 prefix-fanout=1.9 sequence=CTACCCATGTTTGGATGCACTGAGGCATCTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=20.94 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.4 sequence=AGCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC SRR28623228 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 15:10:31 Started mapping on | Feb 13 15:10:31 Finished on | Feb 13 15:12:57 Mapping speed, Million of reads per hour | 723.58 Number of input reads | 29345143 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 27672840 Uniquely mapped reads % | 94.30% Average mapped length | 287.23 Number of splices: Total | 22772179 Number of splices: Annotated (sjdb) | 22302816 Number of splices: GT/AG | 22282400 Number of splices: GC/AG | 393365 Number of splices: AT/AC | 18227 Number of splices: Non-canonical | 78187 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.03% Insertion average length | 2.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 734928 % of reads mapped to multiple loci | 2.50% Number of reads mapped to too many loci | 219979 % of reads mapped to too many loci | 0.75% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.24% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 937375 937375 937375 N_multimapping 734928 734928 734928 N_noFeature 947808 27265966 1110113 N_ambiguous 426028 1676 180390 UnstrandedReadsAssigned:26299004 PositiveStrandReadsAssigned:405198 NegativeStrandReadsAssigned:26382337 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=142 echo kmer=137 SRR28623228 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623228-trimmed-pair1.fastq SRR28623228-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,345,143 reads, 26,940,676 reads pseudoaligned [quant] estimated average fragment length: 202.888 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,135 rounds 52401 SRR28623228.ke.tsv 34699 SRR28623228.se.tsv 87100 total ==> SRR28623228.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1816.11 464 9.54658 Potri.005G024800.1.v4.1 1035 833.112 185 8.29738 Potri.004G059700.1.v4.1 961 759.118 109 5.36525 Potri.007G009000.2.v4.1 1416 1214.11 0 0 Potri.003G141000.2.v4.1 2943 2741.11 594.294 8.10115 Potri.016G087400.1.v4.1 270 103.051 1117.52 405.203 Potri.015G069301.1.v4.1 564 365.116 0 0 Potri.010G195200.1.v4.1 1773 1571.11 4 0.0951317 Potri.012G127500.1.v4.1 977 775.118 1315 63.3915 ==> SRR28623228.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 65 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 358 Potri.001G212900.v4.1 26 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR28623228 completed mapping pipeline successfully