Starting /dee2/code/volunteer_pipeline.sh SRR28623229 current disk space = 3053023502336 free memory = 1487747512 SRR28623229 SRAfilesize 8c8dd575d2ea6c6e78b3a018c98cb906 SRR28623229.sra SRR28623229.sra file validated SRR28623229 is paired end SRR28623229 is conventional basespace SRR28623229 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623229_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.51625 37.0 37.0 37.0 37.0 37.0 2 36.459 37.0 37.0 37.0 37.0 37.0 3 36.5805 37.0 37.0 37.0 37.0 37.0 4 36.5885 37.0 37.0 37.0 37.0 37.0 5 36.739 37.0 37.0 37.0 37.0 37.0 6 36.655 37.0 37.0 37.0 37.0 37.0 7 36.549 37.0 37.0 37.0 37.0 37.0 8 36.415 37.0 37.0 37.0 37.0 37.0 9 36.5735 37.0 37.0 37.0 37.0 37.0 10-14 36.5975 37.0 37.0 37.0 37.0 37.0 15-19 36.549 37.0 37.0 37.0 37.0 37.0 20-24 36.538599999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.5004 37.0 37.0 37.0 37.0 37.0 30-34 36.4858 37.0 37.0 37.0 37.0 37.0 35-39 36.429899999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.4154 37.0 37.0 37.0 37.0 37.0 45-49 36.402 37.0 37.0 37.0 37.0 37.0 50-54 36.3386 37.0 37.0 37.0 37.0 37.0 55-59 36.3035 37.0 37.0 37.0 37.0 37.0 60-64 36.2672 37.0 37.0 37.0 37.0 37.0 65-69 36.294 37.0 37.0 37.0 37.0 37.0 70-74 36.153000000000006 37.0 37.0 37.0 37.0 37.0 75-79 36.16289999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.0772 37.0 37.0 37.0 37.0 37.0 85-89 36.1045 37.0 37.0 37.0 37.0 37.0 90-94 36.065200000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.009 37.0 37.0 37.0 37.0 37.0 100-104 36.0099 37.0 37.0 37.0 37.0 37.0 105-109 35.9707 37.0 37.0 37.0 37.0 37.0 110-114 35.8769 37.0 37.0 37.0 37.0 37.0 115-119 35.9034 37.0 37.0 37.0 37.0 37.0 120-124 35.7701 37.0 37.0 37.0 37.0 37.0 125-129 35.717699999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.791399999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.692 37.0 37.0 37.0 37.0 37.0 140-144 35.4014 37.0 37.0 37.0 37.0 37.0 145-149 35.4396 37.0 37.0 37.0 37.0 37.0 150-151 35.100750000000005 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 3.0 25 4.0 26 9.0 27 15.0 28 17.0 29 17.0 30 36.0 31 32.0 32 62.0 33 90.0 34 129.0 35 378.0 36 2928.0 37 280.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.21337340345605 12.79739544202354 9.11595291760581 41.8732782369146 2 18.125 14.35 36.449999999999996 31.075000000000003 3 18.5 18.099999999999998 28.4 35.0 4 22.6 25.525 23.95 27.925 5 23.65 32.35 23.849999999999998 20.150000000000002 6 22.0 35.6 21.975 20.424999999999997 7 14.975 28.15 40.0 16.875 8 17.724999999999998 25.95 32.6 23.724999999999998 9 17.349999999999998 24.275 34.050000000000004 24.325 10-14 18.85 30.37 27.62 23.16 15-19 19.57 28.525 28.22 23.685000000000002 20-24 19.18 29.425 27.750000000000004 23.645 25-29 19.580000000000002 28.82 27.765 23.835 30-34 19.45 29.74 27.52 23.29 35-39 19.314999999999998 28.985 28.000000000000004 23.7 40-44 19.475 28.665000000000003 27.785 24.075 45-49 20.01 28.925 26.775 24.29 50-54 19.84 28.03 27.950000000000003 24.18 55-59 19.64 28.660000000000004 27.975 23.724999999999998 60-64 19.68 29.04 27.584999999999997 23.695 65-69 20.085 29.25 27.425 23.24 70-74 19.675 28.860000000000003 27.860000000000003 23.605 75-79 19.405 28.51 27.73 24.355 80-84 19.794999999999998 28.67 27.389999999999997 24.145 85-89 19.325 29.035 27.505000000000003 24.135 90-94 19.84 29.035 27.525 23.599999999999998 95-99 20.085 28.675 27.615000000000002 23.625 100-104 20.305 28.535 27.075 24.085 105-109 20.485 29.080000000000002 27.055 23.380000000000003 110-114 20.125 28.945 27.415 23.515 115-119 21.05 27.97 27.33 23.65 120-124 19.675 29.195 26.540000000000003 24.59 125-129 21.125 28.595 25.805 24.474999999999998 130-134 20.785 28.315 27.139999999999997 23.76 135-139 20.74 27.900000000000002 27.02 24.34 140-144 20.82 28.655 26.119999999999997 24.404999999999998 145-149 20.72 28.355000000000004 26.97 23.955000000000002 150-151 21.1375 27.8625 25.8625 25.137500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 2.0 24 2.0 25 2.5 26 4.5 27 10.0 28 14.5 29 18.5 30 28.5 31 37.5 32 40.5 33 53.5 34 75.5 35 79.0 36 86.5 37 111.5 38 137.0 39 175.5 40 194.0 41 206.5 42 235.5 43 240.5 44 248.5 45 272.0 46 265.5 47 233.0 48 206.5 49 185.5 50 172.5 51 146.0 52 114.5 53 94.0 54 78.5 55 60.5 56 37.0 57 27.5 58 19.5 59 14.0 60 16.0 61 11.5 62 7.5 63 6.0 64 3.0 65 4.5 66 6.0 67 3.5 68 1.5 69 1.0 70 0.5 71 0.5 72 1.0 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 86.51946542707728 74.45 2 11.388727484020917 19.6 3 1.568855316676351 4.05 4 0.40674026728646134 1.4000000000000001 5 0.11621150493898895 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCAGGAAGGAGAACAAGAGCAGCTACTGCATAAGCATAGGGAACGAAAAC 5 0.125 No Hit GTCGTGAATACCCAGATTAGTGCCCCAGTGTAAGCTCTTCAAGGGTTCAA 5 0.125 No Hit TCCCTGTCATGTTCATGTTCCCCCGACCCAATTATCCTAATCGCAACCTC 5 0.125 No Hit CAAGGATAAAACTAAAACTAATAAAGCTAGCACTTGCACATCAAGGCCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.4375 0.0 0.0 0.0 0.0 86-87 0.5125 0.0 0.0 0.0 0.0 88-89 0.7125 0.0 0.0 0.0 0.0 90-91 0.925 0.0 0.0 0.0 0.0 92-93 1.0625 0.0 0.0 0.0 0.0 94-95 1.2125 0.0 0.0 0.0 0.0 96-97 1.3875 0.0 0.0 0.0 0.0 98-99 1.7125 0.0 0.0 0.0 0.0 100-101 2.125 0.0 0.0 0.0 0.0 102-103 2.3 0.0 0.0 0.0 0.0 104-105 2.5 0.0 0.0 0.0 0.0 106-107 2.7874999999999996 0.0 0.0 0.0 0.0 108-109 3.2625 0.0 0.0 0.0 0.0 110-111 3.6500000000000004 0.0 0.0 0.0 0.0 112-113 4.0375 0.0 0.0 0.0 0.0 114-115 4.55 0.0 0.0 0.0 0.0 116-117 5.0375 0.0 0.0 0.0 0.0 118-119 5.625 0.0 0.0 0.0 0.0 120-121 6.237500000000001 0.0 0.0 0.0 0.0 122-123 6.8125 0.0 0.0 0.0 0.0 124-125 7.65 0.0 0.0 0.0 0.0 126-127 8.375 0.0 0.0 0.0 0.0 128-129 9.212499999999999 0.0 0.0 0.0 0.0 130-131 9.774999999999999 0.0 0.0 0.0 0.0 132-133 10.4375 0.0 0.0 0.0 0.0 134-135 11.212499999999999 0.0 0.0 0.0 0.0 136-137 11.9875 0.0 0.0 0.0 0.0 138-139 12.850000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTTGA 10 0.006830828 145.0 1 >>END_MODULE SRR28623229 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623229_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.081 37.0 37.0 37.0 37.0 37.0 2 36.31 37.0 37.0 37.0 37.0 37.0 3 36.2125 37.0 37.0 37.0 37.0 37.0 4 36.2295 37.0 37.0 37.0 37.0 37.0 5 36.4 37.0 37.0 37.0 37.0 37.0 6 36.2725 37.0 37.0 37.0 37.0 37.0 7 36.2475 37.0 37.0 37.0 37.0 37.0 8 36.343 37.0 37.0 37.0 37.0 37.0 9 36.2275 37.0 37.0 37.0 37.0 37.0 10-14 36.1943 37.0 37.0 37.0 37.0 37.0 15-19 36.1323 37.0 37.0 37.0 37.0 37.0 20-24 36.1922 37.0 37.0 37.0 37.0 37.0 25-29 36.1197 37.0 37.0 37.0 37.0 37.0 30-34 35.986900000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.03959999999999 37.0 37.0 37.0 37.0 37.0 40-44 35.928000000000004 37.0 37.0 37.0 37.0 37.0 45-49 35.9481 37.0 37.0 37.0 37.0 37.0 50-54 35.9279 37.0 37.0 37.0 37.0 37.0 55-59 35.8556 37.0 37.0 37.0 37.0 37.0 60-64 35.7732 37.0 37.0 37.0 37.0 37.0 65-69 35.8692 37.0 37.0 37.0 37.0 37.0 70-74 35.8282 37.0 37.0 37.0 37.0 37.0 75-79 35.838100000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.79010000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.7453 37.0 37.0 37.0 37.0 37.0 90-94 35.6941 37.0 37.0 37.0 37.0 37.0 95-99 35.715599999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.6736 37.0 37.0 37.0 37.0 37.0 105-109 35.53529999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.6008 37.0 37.0 37.0 37.0 37.0 115-119 35.61730000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.5677 37.0 37.0 37.0 37.0 37.0 125-129 35.2201 37.0 37.0 37.0 32.2 37.0 130-134 35.44590000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.278200000000005 37.0 37.0 37.0 34.6 37.0 140-144 35.2119 37.0 37.0 37.0 34.6 37.0 145-149 35.1389 37.0 37.0 37.0 34.6 37.0 150-151 34.947500000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 7.0 14 11.0 15 0.0 16 3.0 17 2.0 18 4.0 19 2.0 20 3.0 21 10.0 22 4.0 23 12.0 24 6.0 25 8.0 26 11.0 27 16.0 28 11.0 29 19.0 30 26.0 31 38.0 32 45.0 33 102.0 34 185.0 35 529.0 36 2645.0 37 300.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.175000000000004 20.075000000000003 13.0 24.75 2 28.050000000000004 25.124999999999996 30.225 16.6 3 21.75 27.525 32.775 17.95 4 26.075 33.95 22.275 17.7 5 25.650000000000002 35.699999999999996 21.625 17.025000000000002 6 21.85 35.875 25.424999999999997 16.85 7 21.5 21.099999999999998 39.35 18.05 8 22.45 25.15 27.950000000000003 24.45 9 23.325000000000003 24.775 30.4 21.5 10-14 24.845 29.21 25.900000000000002 20.044999999999998 15-19 23.294999999999998 28.939999999999998 28.084999999999997 19.68 20-24 24.104999999999997 28.689999999999998 27.615000000000002 19.59 25-29 24.215 28.415000000000003 27.595 19.775000000000002 30-34 23.665 28.389999999999997 27.794999999999998 20.150000000000002 35-39 23.855 27.85 28.139999999999997 20.155 40-44 23.745 27.87 28.389999999999997 19.994999999999997 45-49 23.865 27.860000000000003 28.04 20.235 50-54 23.745 27.985 27.905 20.365 55-59 23.974999999999998 27.77 28.349999999999998 19.905 60-64 23.75 28.1 27.644999999999996 20.505000000000003 65-69 23.330000000000002 28.794999999999998 27.815 20.06 70-74 23.98 27.944999999999997 28.29 19.785 75-79 23.97 28.54 28.02 19.470000000000002 80-84 24.29 28.389999999999997 28.000000000000004 19.32 85-89 23.625 28.125 28.155 20.095 90-94 24.27 27.915 28.28 19.535 95-99 24.66 28.485 27.235 19.62 100-104 24.355 28.384999999999998 27.88 19.38 105-109 24.44 29.03 27.24 19.29 110-114 24.36 28.38 27.58 19.68 115-119 24.349999999999998 28.544999999999998 27.474999999999998 19.63 120-124 25.264999999999997 28.1 26.915 19.72 125-129 25.31 28.694999999999997 27.32 18.675 130-134 25.89 28.09 27.139999999999997 18.88 135-139 25.569999999999997 28.865000000000002 26.125 19.439999999999998 140-144 26.14 28.48 26.575 18.805 145-149 26.69 27.525 27.185 18.6 150-151 26.787499999999998 27.575 27.625 18.0125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 2.0 7 1.5 8 1.5 9 2.0 10 1.0 11 2.0 12 2.0 13 1.0 14 1.0 15 1.5 16 2.5 17 1.5 18 0.0 19 1.5 20 1.5 21 0.5 22 1.0 23 1.5 24 2.5 25 2.5 26 5.5 27 8.5 28 13.0 29 17.5 30 24.0 31 29.0 32 29.0 33 45.0 34 56.0 35 63.5 36 74.5 37 92.0 38 128.5 39 179.0 40 211.5 41 230.0 42 251.0 43 260.0 44 264.5 45 257.0 46 250.0 47 257.0 48 260.5 49 208.5 50 152.0 51 121.5 52 98.5 53 82.5 54 61.5 55 50.0 56 40.0 57 35.0 58 23.5 59 16.5 60 15.0 61 8.5 62 6.0 63 4.0 64 2.5 65 1.5 66 2.0 67 2.0 68 2.0 69 2.0 70 0.5 71 0.5 72 1.0 73 1.5 74 2.5 75 1.5 76 1.0 77 1.5 78 1.5 79 1.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 1.0 87 1.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.5 93 1.0 94 1.0 95 0.5 96 0.5 97 1.0 98 0.5 99 1.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.65 #Duplication Level Percentage of deduplicated Percentage of total 1 87.18984420080784 75.55 2 10.81938834391229 18.75 3 1.4714368147720716 3.8249999999999997 4 0.4616272360069244 1.6 5 0.028851702250432775 0.125 6 0.028851702250432775 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit GTCGGAGAAACTTGATGAGGACCAGAAGGAACATTTTAGAAAGAACATTG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.4375 0.0 0.0 0.0 0.0 86-87 0.5125 0.0 0.0 0.0 0.0 88-89 0.7125 0.0 0.0 0.0 0.0 90-91 0.925 0.0 0.0 0.0 0.0 92-93 1.0875 0.0 0.0 0.0 0.0 94-95 1.2375 0.0 0.0 0.0 0.0 96-97 1.4375 0.0 0.0 0.0 0.0 98-99 1.7625000000000002 0.0 0.0 0.0 0.0 100-101 2.2 0.0 0.0 0.0 0.0 102-103 2.4000000000000004 0.0 0.0 0.0 0.0 104-105 2.5999999999999996 0.0 0.0 0.0 0.0 106-107 2.8875 0.0 0.0 0.0 0.0 108-109 3.3625 0.0 0.0 0.0 0.0 110-111 3.75 0.0 0.0 0.0 0.0 112-113 4.125 0.0 0.0 0.0 0.0 114-115 4.625 0.0 0.0 0.0 0.0 116-117 5.1125 0.0 0.0 0.0 0.0 118-119 5.699999999999999 0.0 0.0 0.0 0.0 120-121 6.3125 0.0 0.0 0.0 0.0 122-123 6.887499999999999 0.0 0.0 0.0 0.0 124-125 7.75 0.0 0.0 0.0 0.0 126-127 8.475000000000001 0.0 0.0 0.0 0.0 128-129 9.337499999999999 0.0 0.0 0.0 0.0 130-131 9.9375 0.0 0.0 0.0 0.0 132-133 10.625 0.0 0.0 0.0 0.0 134-135 11.4 0.0 0.0 0.0 0.0 136-137 12.1875 0.0 0.0 0.0 0.0 138-139 13.024999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1410398 spots for SRR28623229.sra Written 1410398 spots for SRR28623229.sra Read 1410398 spots for SRR28623229.sra Written 1410398 spots for SRR28623229.sra Read 1410398 spots for SRR28623229.sra Written 1410398 spots for SRR28623229.sra Read 1410398 spots for SRR28623229.sra Written 1410398 spots for SRR28623229.sra Read 1410398 spots for SRR28623229.sra Written 1410398 spots for SRR28623229.sra Read 1410398 spots for SRR28623229.sra Written 1410398 spots for SRR28623229.sra Read 1410398 spots for SRR28623229.sra Written 1410398 spots for SRR28623229.sra Read 1410398 spots for SRR28623229.sra Written 1410398 spots for SRR28623229.sra Read 1410398 spots for SRR28623229.sra Written 1410398 spots for SRR28623229.sra Read 1410398 spots for SRR28623229.sra Written 1410398 spots for SRR28623229.sra Read 1410398 spots for SRR28623229.sra Written 1410398 spots for SRR28623229.sra Read 1410398 spots for SRR28623229.sra Written 1410398 spots for SRR28623229.sra Read 1410398 spots for SRR28623229.sra Written 1410398 spots for SRR28623229.sra Read 1410398 spots for SRR28623229.sra Written 1410398 spots for SRR28623229.sra Read 1410398 spots for SRR28623229.sra Written 1410398 spots for SRR28623229.sra Read 1410398 spots for SRR28623229.sra Written 1410398 spots for SRR28623229.sra Read 1410398 spots for SRR28623229.sra Written 1410398 spots for SRR28623229.sra Read 1410398 spots for SRR28623229.sra Written 1410398 spots for SRR28623229.sra Read 1410413 spots for SRR28623229.sra Written 1410413 spots for SRR28623229.sra Read 1410398 spots for SRR28623229.sra Written 1410398 spots for SRR28623229.sra SRR ids: ['SRR28623229.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w22hh8kk SRR28623229.sra spots: 28207975 blocks: [[1, 1410398], [1410399, 2820796], [2820797, 4231194], [4231195, 5641592], [5641593, 7051990], [7051991, 8462388], [8462389, 9872786], [9872787, 11283184], [11283185, 12693582], [12693583, 14103980], [14103981, 15514378], [15514379, 16924776], [16924777, 18335174], [18335175, 19745572], [19745573, 21155970], [21155971, 22566368], [22566369, 23976766], [23976767, 25387164], [25387165, 26797562], [26797563, 28207975]] SRR28623229 file size 10414689 SRR28623229 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623229 SRR28623229_1.fastq SRR28623229_2.fastq Input file: SRR28623229_1.fastq Paired file: SRR28623229_2.fastq trimmed: SRR28623229-trimmed-pair1.fastq, SRR28623229-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:47:45 2025 >> started Tue Feb 11 10:48:18 2025 >> done (33.178s) 28207975 read pairs processed; of these: 15 ( 0.00%) short read pairs filtered out after trimming by size control 22679 ( 0.08%) empty read pairs filtered out after trimming by size control 28185281 (99.92%) read pairs available; of these: 4710761 (16.71%) trimmed read pairs available after processing 23474520 (83.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 5 0.00% 21 4 0.00% 22 2 0.00% 23 1 0.00% 24 6 0.00% 25 7 0.00% 26 7 0.00% 27 9 0.00% 28 10 0.00% 29 12 0.00% 30 10 0.00% 31 8 0.00% 32 11 0.00% 33 17 0.00% 34 11 0.00% 35 15 0.00% 36 32 0.00% 37 20 0.00% 38 37 0.00% 39 22 0.00% 40 57 0.00% 41 54 0.00% 42 65 0.00% 43 58 0.00% 44 75 0.00% 45 81 0.00% 46 90 0.00% 47 114 0.00% 48 122 0.00% 49 173 0.00% 50 176 0.00% 51 208 0.00% 52 208 0.00% 53 232 0.00% 54 281 0.00% 55 302 0.00% 56 348 0.00% 57 437 0.00% 58 458 0.00% 59 565 0.00% 60 712 0.00% 61 717 0.00% 62 876 0.00% 63 1001 0.00% 64 1107 0.00% 65 1221 0.00% 66 1466 0.01% 67 1711 0.01% 68 1834 0.01% 69 2081 0.01% 70 2413 0.01% 71 2864 0.01% 72 3306 0.01% 73 3881 0.01% 74 4299 0.02% 75 4723 0.02% 76 5375 0.02% 77 5838 0.02% 78 6703 0.02% 79 7314 0.03% 80 8499 0.03% 81 9398 0.03% 82 10628 0.04% 83 11583 0.04% 84 13031 0.05% 85 14325 0.05% 86 15833 0.06% 87 16989 0.06% 88 18082 0.06% 89 19375 0.07% 90 20612 0.07% 91 22611 0.08% 92 24391 0.09% 93 26338 0.09% 94 28628 0.10% 95 30560 0.11% 96 32441 0.12% 97 34335 0.12% 98 36123 0.13% 99 37933 0.13% 100 39240 0.14% 101 40212 0.14% 102 42912 0.15% 103 45434 0.16% 104 46873 0.17% 105 50207 0.18% 106 52389 0.19% 107 53386 0.19% 108 55504 0.20% 109 57592 0.20% 110 57831 0.21% 111 59948 0.21% 112 62088 0.22% 113 63296 0.22% 114 66180 0.23% 115 68812 0.24% 116 70105 0.25% 117 72874 0.26% 118 74810 0.27% 119 76344 0.27% 120 77329 0.27% 121 78780 0.28% 122 79386 0.28% 123 81496 0.29% 124 83295 0.30% 125 85474 0.30% 126 87827 0.31% 127 89318 0.32% 128 91181 0.32% 129 92661 0.33% 130 94820 0.34% 131 93747 0.33% 132 95637 0.34% 133 96817 0.34% 134 97857 0.35% 135 98782 0.35% 136 100679 0.36% 137 102595 0.36% 138 103766 0.37% 139 106035 0.38% 140 106727 0.38% 141 107966 0.38% 142 108331 0.38% 143 108541 0.39% 144 110277 0.39% 145 110751 0.39% 146 111235 0.39% 147 112135 0.40% 148 114596 0.41% 149 114845 0.41% 150 116326 0.41% 151 23474520 83.29% 28185281 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=8.88 fanout-score-rank=22 prefix-density=0.06 prefix-fanout=8.9 sequence=GGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAATCCATCTCGTATGCCGTCTTCTGCTTGA criterion=fanout-score sequence-density=0.07 sequence-density-rank=12 fanout-score=383.00 fanout-score-rank=1 prefix-density=1.01 prefix-fanout=27.3 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=13.92 fanout-score-rank=19 prefix-density=0.14 prefix-fanout=13.9 sequence=GAGAGAGAGAGTTAAGACAATGGCCTCGAAGAAATCTGCAATCGTATTACCTGGTTCAAAGGTGTTGAAGCACATAGTTTTTGTACGGTTTAATGATGGGATCACTGATGAACAAATTGAGAA criterion=fanout-score sequence-density=0.08 sequence-density-rank=8 fanout-score=359.70 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=30.6 sequence=AAGAAGAAGAAA SRR28623229 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:49:00 Started mapping on | Feb 11 10:49:00 Finished on | Feb 11 10:51:59 Mapping speed, Million of reads per hour | 566.85 Number of input reads | 28185281 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 26279562 Uniquely mapped reads % | 93.24% Average mapped length | 291.72 Number of splices: Total | 24020375 Number of splices: Annotated (sjdb) | 23414798 Number of splices: GT/AG | 23593824 Number of splices: GC/AG | 327022 Number of splices: AT/AC | 25307 Number of splices: Non-canonical | 74222 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.96 Insertion rate per base | 0.03% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 693260 % of reads mapped to multiple loci | 2.46% Number of reads mapped to too many loci | 213561 % of reads mapped to too many loci | 0.76% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.30% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1212459 1212459 1212459 N_multimapping 693260 693260 693260 N_noFeature 1173422 25945206 1346352 N_ambiguous 311821 2415 148697 UnstrandedReadsAssigned:24794319 PositiveStrandReadsAssigned:331941 NegativeStrandReadsAssigned:24784513 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623229 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623229-trimmed-pair1.fastq SRR28623229-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,185,281 reads, 25,129,745 reads pseudoaligned [quant] estimated average fragment length: 224.464 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,134 rounds 52401 SRR28623229.ke.tsv 34699 SRR28623229.se.tsv 87100 total ==> SRR28623229.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1794.54 1084 22.796 Potri.005G024800.1.v4.1 1035 811.536 654 30.4125 Potri.004G059700.1.v4.1 961 737.566 252 12.8938 Potri.007G009000.2.v4.1 1416 1192.54 0 0 Potri.003G141000.2.v4.1 2943 2719.54 887 12.3087 Potri.016G087400.1.v4.1 270 94.1021 2170.15 870.306 Potri.015G069301.1.v4.1 564 345.154 0 0 Potri.010G195200.1.v4.1 1773 1549.54 64 1.55869 Potri.012G127500.1.v4.1 977 753.566 14056 703.919 ==> SRR28623229.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1516 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 591 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 21 Potri.001G452600.v4.1 3 SRR28623229 completed mapping pipeline successfully