Starting /dee2/code/volunteer_pipeline.sh SRR28623230 current disk space = 3053284466688 free memory = 1244556368 SRR28623230 SRAfilesize 72c1fdb6c20400866d95a7284a74fc4d SRR28623230.sra SRR28623230.sra file validated SRR28623230 is paired end SRR28623230 is conventional basespace SRR28623230 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623230_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.417 37.0 37.0 37.0 37.0 37.0 2 36.4475 37.0 37.0 37.0 37.0 37.0 3 36.5685 37.0 37.0 37.0 37.0 37.0 4 36.6635 37.0 37.0 37.0 37.0 37.0 5 36.562 37.0 37.0 37.0 37.0 37.0 6 36.6675 37.0 37.0 37.0 37.0 37.0 7 36.561 37.0 37.0 37.0 37.0 37.0 8 36.442 37.0 37.0 37.0 37.0 37.0 9 36.5675 37.0 37.0 37.0 37.0 37.0 10-14 36.5864 37.0 37.0 37.0 37.0 37.0 15-19 36.556 37.0 37.0 37.0 37.0 37.0 20-24 36.486000000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.459199999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.4404 37.0 37.0 37.0 37.0 37.0 35-39 36.39020000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.369600000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.234899999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.244099999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.163599999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.175599999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.1395 37.0 37.0 37.0 37.0 37.0 70-74 36.0583 37.0 37.0 37.0 37.0 37.0 75-79 36.1355 37.0 37.0 37.0 37.0 37.0 80-84 36.0854 37.0 37.0 37.0 37.0 37.0 85-89 36.075 37.0 37.0 37.0 37.0 37.0 90-94 36.028800000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.939499999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.958000000000006 37.0 37.0 37.0 37.0 37.0 105-109 35.9336 37.0 37.0 37.0 37.0 37.0 110-114 35.878299999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.868700000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.7419 37.0 37.0 37.0 37.0 37.0 125-129 35.6268 37.0 37.0 37.0 37.0 37.0 130-134 35.695 37.0 37.0 37.0 37.0 37.0 135-139 35.6173 37.0 37.0 37.0 37.0 37.0 140-144 35.2128 37.0 37.0 37.0 32.2 37.0 145-149 35.125099999999996 37.0 37.0 37.0 29.8 37.0 150-151 34.71325 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 2.0 21 1.0 22 1.0 23 1.0 24 5.0 25 5.0 26 9.0 27 10.0 28 18.0 29 30.0 30 28.0 31 43.0 32 45.0 33 108.0 34 165.0 35 422.0 36 2848.0 37 258.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.91520321123934 13.49724034119418 9.859508278976417 43.728048168590064 2 17.525 17.125 34.75 30.599999999999998 3 18.3 17.299999999999997 29.049999999999997 35.35 4 22.900000000000002 25.624999999999996 22.7 28.775000000000002 5 24.3 31.525 22.5 21.675 6 20.474999999999998 36.675000000000004 22.2 20.65 7 15.425 28.625 38.85 17.1 8 17.9 28.499999999999996 30.349999999999998 23.25 9 18.375 23.95 34.975 22.7 10-14 18.790000000000003 31.66 27.22 22.33 15-19 19.259999999999998 29.42 27.395000000000003 23.925 20-24 19.7 29.299999999999997 27.36 23.64 25-29 19.435 29.475 27.229999999999997 23.86 30-34 19.735 29.134999999999998 27.279999999999998 23.849999999999998 35-39 19.765 29.544999999999998 27.175 23.515 40-44 19.33 29.765000000000004 27.235 23.669999999999998 45-49 20.200000000000003 29.104999999999997 26.96 23.735 50-54 20.28 28.92 26.8 24.0 55-59 19.48 29.134999999999998 27.24 24.145 60-64 20.13 28.775000000000002 27.055 24.04 65-69 19.89 30.335 26.25 23.525 70-74 19.93 29.165000000000003 27.169999999999998 23.735 75-79 20.535 29.73 26.345000000000002 23.39 80-84 20.119999999999997 29.39 27.165 23.325000000000003 85-89 20.055 29.145 26.86 23.94 90-94 20.505000000000003 29.42 26.825 23.25 95-99 20.369999999999997 29.715000000000003 26.400000000000002 23.515 100-104 20.61 29.435 26.295 23.66 105-109 20.52 28.875 26.495 24.11 110-114 21.240000000000002 29.13 25.785000000000004 23.845 115-119 20.91 28.82 25.89 24.38 120-124 21.61 29.4 24.965 24.025 125-129 21.2 28.865000000000002 25.72 24.215 130-134 21.240000000000002 29.04 25.285000000000004 24.435000000000002 135-139 21.485000000000003 28.689999999999998 25.624999999999996 24.2 140-144 22.015 27.794999999999998 25.715 24.474999999999998 145-149 22.259999999999998 28.349999999999998 25.21 24.18 150-151 21.85 27.400000000000002 25.6 25.15 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.0 21 1.0 22 3.0 23 3.0 24 3.0 25 6.0 26 6.5 27 6.0 28 13.0 29 25.0 30 28.5 31 28.5 32 46.5 33 65.5 34 74.0 35 94.5 36 114.5 37 123.5 38 147.5 39 158.0 40 173.0 41 208.5 42 223.0 43 241.5 44 239.5 45 217.5 46 226.5 47 250.0 48 229.0 49 184.5 50 160.0 51 137.5 52 114.0 53 97.0 54 81.5 55 58.5 56 37.0 57 29.5 58 24.5 59 22.0 60 15.5 61 7.5 62 9.5 63 10.5 64 7.5 65 4.0 66 6.5 67 9.0 68 7.0 69 3.5 70 2.5 71 2.0 72 1.5 73 2.0 74 3.0 75 2.0 76 0.5 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.3 #Duplication Level Percentage of deduplicated Percentage of total 1 84.15366146458584 70.1 2 12.695078031212484 21.15 3 2.34093637454982 5.8500000000000005 4 0.6602641056422569 2.1999999999999997 5 0.09003601440576231 0.375 6 0.030012004801920768 0.15 7 0.030012004801920768 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACACCGTAGTATCTCGTTT 7 0.17500000000000002 TruSeq Adapter, Index 5 (97% over 38bp) CCCACTTTCCATGTGGATGTCTAGGGTTGTTGAGTAATACACCAGTGGCA 6 0.15 No Hit GGCAGCCATATCAGAGTTCTGCTTTTAATTCATCCAGTACTCTGCACATG 5 0.125 No Hit CTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGC 5 0.125 No Hit GATGATTGGATGCCTTGGATTAATCTCGAGCACCCTCTTGCCGCGCATAT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0375 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.36250000000000004 0.0 0.0 0.0 0.0 82-83 0.5125 0.0 0.0 0.0 0.0 84-85 0.625 0.0 0.0 0.0 0.0 86-87 0.75 0.0 0.0 0.0 0.0 88-89 0.975 0.0 0.0 0.0 0.0 90-91 1.4 0.0 0.0 0.0 0.0 92-93 1.7000000000000002 0.0 0.0 0.0 0.0 94-95 1.9625 0.0 0.0 0.0 0.0 96-97 2.3 0.0 0.0 0.0 0.0 98-99 2.95 0.0 0.0 0.0 0.0 100-101 3.4375 0.0 0.0 0.0 0.0 102-103 3.9125 0.0 0.0 0.0 0.0 104-105 4.4125 0.0 0.0 0.0 0.0 106-107 5.0 0.0 0.0 0.0 0.0 108-109 5.512499999999999 0.0 0.0 0.0 0.0 110-111 5.925 0.0 0.0 0.0 0.0 112-113 6.5125 0.0 0.0 0.0 0.0 114-115 7.1875 0.0 0.0 0.0 0.0 116-117 8.0125 0.0 0.0 0.0 0.0 118-119 8.8125 0.0 0.0 0.0 0.0 120-121 9.6 0.0 0.0 0.0 0.0 122-123 10.475 0.0 0.0 0.0 0.0 124-125 11.325 0.0 0.0 0.0 0.0 126-127 12.149999999999999 0.0 0.0 0.0 0.0 128-129 12.6875 0.0 0.0 0.0 0.0 130-131 13.5125 0.0 0.0 0.0 0.0 132-133 14.350000000000001 0.0 0.0 0.0 0.0 134-135 15.1875 0.0 0.0 0.0 0.0 136-137 16.225 0.0 0.0 0.0 0.0 138-139 17.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCTTTT 10 0.006830828 145.0 7 CTAGATT 10 0.006830828 145.0 8 GCTTTTC 10 0.006830828 145.0 8 TAGATTC 10 0.006830828 145.0 9 TTTGTCC 10 0.006830828 145.0 145 >>END_MODULE SRR28623230 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623230_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.6665 37.0 37.0 37.0 37.0 37.0 2 36.1945 37.0 37.0 37.0 37.0 37.0 3 36.261 37.0 37.0 37.0 37.0 37.0 4 36.238 37.0 37.0 37.0 37.0 37.0 5 36.3535 37.0 37.0 37.0 37.0 37.0 6 36.387 37.0 37.0 37.0 37.0 37.0 7 36.317 37.0 37.0 37.0 37.0 37.0 8 36.1865 37.0 37.0 37.0 37.0 37.0 9 36.0985 37.0 37.0 37.0 37.0 37.0 10-14 36.1687 37.0 37.0 37.0 37.0 37.0 15-19 36.0565 37.0 37.0 37.0 37.0 37.0 20-24 36.10170000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.007000000000005 37.0 37.0 37.0 37.0 37.0 30-34 35.974399999999996 37.0 37.0 37.0 37.0 37.0 35-39 35.9532 37.0 37.0 37.0 37.0 37.0 40-44 35.906800000000004 37.0 37.0 37.0 37.0 37.0 45-49 35.9144 37.0 37.0 37.0 37.0 37.0 50-54 35.8728 37.0 37.0 37.0 37.0 37.0 55-59 35.69199999999999 37.0 37.0 37.0 37.0 37.0 60-64 35.716 37.0 37.0 37.0 37.0 37.0 65-69 35.790499999999994 37.0 37.0 37.0 37.0 37.0 70-74 35.797399999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.7763 37.0 37.0 37.0 37.0 37.0 80-84 35.6238 37.0 37.0 37.0 37.0 37.0 85-89 35.6587 37.0 37.0 37.0 37.0 37.0 90-94 35.607000000000006 37.0 37.0 37.0 37.0 37.0 95-99 35.6071 37.0 37.0 37.0 37.0 37.0 100-104 35.5295 37.0 37.0 37.0 37.0 37.0 105-109 35.4297 37.0 37.0 37.0 37.0 37.0 110-114 35.5667 37.0 37.0 37.0 37.0 37.0 115-119 35.5192 37.0 37.0 37.0 37.0 37.0 120-124 35.463800000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.0899 37.0 37.0 37.0 29.8 37.0 130-134 35.2855 37.0 37.0 37.0 32.2 37.0 135-139 35.044599999999996 37.0 37.0 37.0 25.0 37.0 140-144 35.064800000000005 37.0 37.0 37.0 25.0 37.0 145-149 34.9646 37.0 37.0 37.0 25.0 37.0 150-151 34.744 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 0.0 15 7.0 16 1.0 17 2.0 18 1.0 19 2.0 20 6.0 21 6.0 22 11.0 23 9.0 24 14.0 25 10.0 26 9.0 27 12.0 28 19.0 29 26.0 30 30.0 31 39.0 32 63.0 33 132.0 34 212.0 35 660.0 36 2485.0 37 242.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.175 20.25 15.125 26.450000000000003 2 28.425 25.0 30.625000000000004 15.950000000000001 3 21.85 27.200000000000003 31.225 19.725 4 26.724999999999998 31.45 24.375 17.45 5 26.75 35.8 23.175 14.274999999999999 6 23.5 37.05 22.375 17.075000000000003 7 20.925 21.3 38.275 19.5 8 23.65 24.675 28.875 22.8 9 24.925 23.549999999999997 30.025000000000002 21.5 10-14 23.974999999999998 28.82 26.1 21.105 15-19 24.34 27.63 27.92 20.11 20-24 24.33 27.72 27.700000000000003 20.25 25-29 24.015 27.439999999999998 28.28 20.265 30-34 24.39 27.200000000000003 28.18 20.23 35-39 24.115000000000002 26.465 28.83 20.59 40-44 24.52 27.57 27.639999999999997 20.27 45-49 23.94 27.46 28.52 20.080000000000002 50-54 24.52 26.715 28.555000000000003 20.21 55-59 24.34 27.845 28.105000000000004 19.71 60-64 24.22 27.500000000000004 28.285 19.994999999999997 65-69 24.279999999999998 26.634999999999998 28.73 20.355 70-74 23.76 27.46 28.610000000000003 20.169999999999998 75-79 24.27 27.0 28.499999999999996 20.23 80-84 24.595 27.250000000000004 28.215 19.939999999999998 85-89 23.810000000000002 27.38 28.720000000000002 20.09 90-94 23.915 27.73 28.985 19.37 95-99 25.415 27.529999999999998 27.625 19.43 100-104 25.16 26.85 27.965 20.025000000000002 105-109 25.180000000000003 27.57 28.015 19.235 110-114 25.019999999999996 27.49 27.705000000000002 19.785 115-119 25.75 27.66 27.375 19.215 120-124 26.13 27.47 27.125 19.275000000000002 125-129 26.334999999999997 28.189999999999998 26.395000000000003 19.08 130-134 26.3 27.87 26.865 18.965 135-139 27.145000000000003 26.99 27.134999999999998 18.73 140-144 26.919999999999998 27.139999999999997 27.084999999999997 18.855 145-149 27.845 27.85 26.474999999999998 17.83 150-151 26.887499999999996 26.7625 26.5875 19.7625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 1.0 9 0.5 10 0.5 11 1.5 12 1.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 2.0 22 4.5 23 2.5 24 0.5 25 4.0 26 8.0 27 9.0 28 8.0 29 8.0 30 14.0 31 19.5 32 27.0 33 39.0 34 55.5 35 79.5 36 88.0 37 98.0 38 130.5 39 173.5 40 202.0 41 209.0 42 240.0 43 265.0 44 259.0 45 264.5 46 254.5 47 242.0 48 225.5 49 197.0 50 171.5 51 127.0 52 100.0 53 97.0 54 80.0 55 55.5 56 41.0 57 26.5 58 19.0 59 17.5 60 17.5 61 14.5 62 12.5 63 14.5 64 9.0 65 5.0 66 5.5 67 5.5 68 5.0 69 3.0 70 2.0 71 2.0 72 0.5 73 2.0 74 2.5 75 1.5 76 1.5 77 1.5 78 1.0 79 1.0 80 1.0 81 0.0 82 1.0 83 1.5 84 1.5 85 2.0 86 1.0 87 0.0 88 0.5 89 1.0 90 1.0 91 0.5 92 0.0 93 0.5 94 0.5 95 0.0 96 0.5 97 0.5 98 0.5 99 1.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 84.95102404274265 71.55 2 12.140100920154348 20.45 3 2.315227070347284 5.8500000000000005 4 0.5046007717423567 1.7000000000000002 5 0.05936479667557139 0.25 6 0.0 0.0 7 0.0 0.0 8 0.029682398337785694 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit TGTGGAAGCAACTGCTTATCTTGCTATTGAAGACTTTCTACATGCAAGTG 5 0.125 No Hit TGCTGGGGACCTGTGGTTCACCATCATTTTTCTGGCTCAACGAGTTGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0375 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.36250000000000004 0.0 0.0 0.0 0.0 82-83 0.5125 0.0 0.0 0.0 0.0 84-85 0.625 0.0 0.0 0.0 0.0 86-87 0.75 0.0 0.0 0.0 0.0 88-89 0.975 0.0 0.0 0.0 0.0 90-91 1.4 0.0 0.0 0.0 0.0 92-93 1.725 0.0 0.0 0.0 0.0 94-95 1.9874999999999998 0.0 0.0 0.0 0.0 96-97 2.3375 0.0 0.0 0.0 0.0 98-99 3.05 0.0 0.0 0.0 0.0 100-101 3.5875000000000004 0.0 0.0 0.0 0.0 102-103 4.075 0.0 0.0 0.0 0.0 104-105 4.574999999999999 0.0 0.0 0.0 0.0 106-107 5.1375 0.0 0.0 0.0 0.0 108-109 5.637499999999999 0.0 0.0 0.0 0.0 110-111 6.025 0.0 0.0 0.0 0.0 112-113 6.5625 0.0 0.0 0.0 0.0 114-115 7.2875 0.0 0.0 0.0 0.0 116-117 8.1375 0.0 0.0 0.0 0.0 118-119 8.95 0.0 0.0 0.0 0.0 120-121 9.725 0.0 0.0 0.0 0.0 122-123 10.575 0.0 0.0 0.0 0.0 124-125 11.3625 0.0 0.0 0.0 0.0 126-127 12.125 0.0 0.0 0.0 0.0 128-129 12.6625 0.0 0.0 0.0 0.0 130-131 13.4875 0.0 0.0 0.0 0.0 132-133 14.325 0.0 0.0 0.0 0.0 134-135 15.175 0.0 0.0 0.0 0.0 136-137 16.1625 0.0 0.0 0.0 0.0 138-139 17.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACACCAT 10 0.006830828 145.0 4 CAACACC 10 0.006830828 145.0 2 AACACCA 10 0.006830828 145.0 3 >>END_MODULE Read 1688670 spots for SRR28623230.sra Written 1688670 spots for SRR28623230.sra Read 1688670 spots for SRR28623230.sra Written 1688670 spots for SRR28623230.sra Read 1688670 spots for SRR28623230.sra Written 1688670 spots for SRR28623230.sra Read 1688670 spots for SRR28623230.sra Written 1688670 spots for SRR28623230.sra Read 1688670 spots for SRR28623230.sra Written 1688670 spots for SRR28623230.sra Read 1688670 spots for SRR28623230.sra Written 1688670 spots for SRR28623230.sra Read 1688670 spots for SRR28623230.sra Written 1688670 spots for SRR28623230.sra Read 1688670 spots for SRR28623230.sra Written 1688670 spots for SRR28623230.sra Read 1688670 spots for SRR28623230.sra Written 1688670 spots for SRR28623230.sra Read 1688670 spots for SRR28623230.sra Written 1688670 spots for SRR28623230.sra Read 1688670 spots for SRR28623230.sra Written 1688670 spots for SRR28623230.sra Read 1688679 spots for SRR28623230.sra Written 1688679 spots for SRR28623230.sra Read 1688670 spots for SRR28623230.sra Written 1688670 spots for SRR28623230.sra Read 1688670 spots for SRR28623230.sra Written 1688670 spots for SRR28623230.sra Read 1688670 spots for SRR28623230.sra Written 1688670 spots for SRR28623230.sra Read 1688670 spots for SRR28623230.sra Written 1688670 spots for SRR28623230.sra Read 1688670 spots for SRR28623230.sra Written 1688670 spots for SRR28623230.sra Read 1688670 spots for SRR28623230.sra Written 1688670 spots for SRR28623230.sra Read 1688670 spots for SRR28623230.sra Written 1688670 spots for SRR28623230.sra Read 1688670 spots for SRR28623230.sra Written 1688670 spots for SRR28623230.sra SRR ids: ['SRR28623230.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_efqbego9 SRR28623230.sra spots: 33773409 blocks: [[1, 1688670], [1688671, 3377340], [3377341, 5066010], [5066011, 6754680], [6754681, 8443350], [8443351, 10132020], [10132021, 11820690], [11820691, 13509360], [13509361, 15198030], [15198031, 16886700], [16886701, 18575370], [18575371, 20264040], [20264041, 21952710], [21952711, 23641380], [23641381, 25330050], [25330051, 27018720], [27018721, 28707390], [28707391, 30396060], [30396061, 32084730], [32084731, 33773409]] SRR28623230 file size 12471640 SRR28623230 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623230 SRR28623230_1.fastq SRR28623230_2.fastq Input file: SRR28623230_1.fastq Paired file: SRR28623230_2.fastq trimmed: SRR28623230-trimmed-pair1.fastq, SRR28623230-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:29:58 2025 >> started Tue Feb 11 10:30:39 2025 >> done (41.144s) 33773409 read pairs processed; of these: 38 ( 0.00%) short read pairs filtered out after trimming by size control 169289 ( 0.50%) empty read pairs filtered out after trimming by size control 33604082 (99.50%) read pairs available; of these: 7775565 (23.14%) trimmed read pairs available after processing 25828517 (76.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 2 0.00% 21 4 0.00% 22 4 0.00% 23 6 0.00% 24 4 0.00% 25 6 0.00% 26 5 0.00% 27 8 0.00% 28 12 0.00% 29 15 0.00% 30 17 0.00% 31 16 0.00% 32 22 0.00% 33 26 0.00% 34 26 0.00% 35 37 0.00% 36 36 0.00% 37 44 0.00% 38 47 0.00% 39 73 0.00% 40 83 0.00% 41 107 0.00% 42 121 0.00% 43 122 0.00% 44 108 0.00% 45 154 0.00% 46 153 0.00% 47 211 0.00% 48 272 0.00% 49 330 0.00% 50 360 0.00% 51 410 0.00% 52 493 0.00% 53 523 0.00% 54 565 0.00% 55 688 0.00% 56 739 0.00% 57 924 0.00% 58 1013 0.00% 59 1166 0.00% 60 1433 0.00% 61 1706 0.01% 62 2026 0.01% 63 2267 0.01% 64 2800 0.01% 65 2833 0.01% 66 3041 0.01% 67 3450 0.01% 68 4077 0.01% 69 4576 0.01% 70 5358 0.02% 71 6200 0.02% 72 7018 0.02% 73 8065 0.02% 74 9200 0.03% 75 10487 0.03% 76 11809 0.04% 77 12655 0.04% 78 14148 0.04% 79 16072 0.05% 80 17540 0.05% 81 19750 0.06% 82 22128 0.07% 83 24653 0.07% 84 27695 0.08% 85 31159 0.09% 86 33342 0.10% 87 35221 0.10% 88 38531 0.11% 89 40470 0.12% 90 43268 0.13% 91 46236 0.14% 92 50250 0.15% 93 53959 0.16% 94 57724 0.17% 95 61764 0.18% 96 66384 0.20% 97 69457 0.21% 98 72774 0.22% 99 74454 0.22% 100 77534 0.23% 101 80358 0.24% 102 82473 0.25% 103 86813 0.26% 104 89470 0.27% 105 94106 0.28% 106 98146 0.29% 107 99898 0.30% 108 102695 0.31% 109 105866 0.32% 110 106186 0.32% 111 109415 0.33% 112 111750 0.33% 113 113220 0.34% 114 115492 0.34% 115 121323 0.36% 116 122425 0.36% 117 125160 0.37% 118 127455 0.38% 119 129206 0.38% 120 131826 0.39% 121 131938 0.39% 122 133274 0.40% 123 134682 0.40% 124 136934 0.41% 125 137447 0.41% 126 140943 0.42% 127 144815 0.43% 128 146003 0.43% 129 147098 0.44% 130 150331 0.45% 131 148457 0.44% 132 148131 0.44% 133 150033 0.45% 134 149893 0.45% 135 149952 0.45% 136 152054 0.45% 137 154265 0.46% 138 156474 0.47% 139 156706 0.47% 140 157853 0.47% 141 158090 0.47% 142 158252 0.47% 143 156991 0.47% 144 158521 0.47% 145 158903 0.47% 146 157775 0.47% 147 159853 0.48% 148 160906 0.48% 149 161094 0.48% 150 162146 0.48% 151 25828517 76.86% 33604082 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.27 fanout-score-rank=26 prefix-density=0.25 prefix-fanout=2.6 sequence=GGCTTCTCCCATTTGAGGGGCTTGACAAC criterion=fanout-score sequence-density=0.03 sequence-density-rank=36 fanout-score=273.55 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=23.2 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAACAAGGAGTTCAGCAGCCTGTACTCCATGGTAAGGATCAATATGGAATCCGGATTTTCCATGCACAATGATCTCAGCA criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=32 prefix-density=0.19 prefix-fanout=2.2 sequence=AATAGGTTCTTGAAGACAGCTGCATACGGACA criterion=fanout-score sequence-density=0.04 sequence-density-rank=27 fanout-score=39.50 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=3.4 sequence=TCTTGAAGAATGGTGATGCTGG SRR28623230 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:31:22 Started mapping on | Feb 11 10:31:22 Finished on | Feb 11 10:34:37 Mapping speed, Million of reads per hour | 620.38 Number of input reads | 33604082 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 30917020 Uniquely mapped reads % | 92.00% Average mapped length | 287.28 Number of splices: Total | 22167882 Number of splices: Annotated (sjdb) | 21637922 Number of splices: GT/AG | 21795157 Number of splices: GC/AG | 268073 Number of splices: AT/AC | 22247 Number of splices: Non-canonical | 82405 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.04% Deletion average length | 2.88 Insertion rate per base | 0.03% Insertion average length | 2.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 766447 % of reads mapped to multiple loci | 2.28% Number of reads mapped to too many loci | 969455 % of reads mapped to too many loci | 2.88% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.25% % of reads unmapped: other | 0.58% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1920615 1920615 1920615 N_multimapping 766447 766447 766447 N_noFeature 1186367 30428283 1387837 N_ambiguous 420013 4029 129551 UnstrandedReadsAssigned:29310640 PositiveStrandReadsAssigned:484708 NegativeStrandReadsAssigned:29399632 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=143 echo kmer=139 SRR28623230 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623230-trimmed-pair1.fastq SRR28623230-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,604,082 reads, 30,510,525 reads pseudoaligned [quant] estimated average fragment length: 204.927 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,319 rounds 52401 SRR28623230.ke.tsv 34699 SRR28623230.se.tsv 87100 total ==> SRR28623230.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1814.07 960 18.5738 Potri.005G024800.1.v4.1 1035 831.073 312 13.1765 Potri.004G059700.1.v4.1 961 757.08 39 1.80804 Potri.007G009000.2.v4.1 1416 1212.07 0 0 Potri.003G141000.2.v4.1 2943 2739.07 409.074 5.24182 Potri.016G087400.1.v4.1 270 102.647 2442.19 835.059 Potri.015G069301.1.v4.1 564 363.319 0 0 Potri.010G195200.1.v4.1 1773 1569.07 51 1.1408 Potri.012G127500.1.v4.1 977 773.08 4452 202.123 ==> SRR28623230.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2662 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 607 Potri.001G212900.v4.1 41 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR28623230 completed mapping pipeline successfully