Starting /dee2/code/volunteer_pipeline.sh SRR28623231 current disk space = 3053164949504 free memory = 1483541936 SRR28623231 SRAfilesize d287296553ed874df478488a05551b23 SRR28623231.sra SRR28623231.sra file validated SRR28623231 is paired end SRR28623231 is conventional basespace SRR28623231 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623231_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.291 37.0 37.0 37.0 37.0 37.0 2 36.37 37.0 37.0 37.0 37.0 37.0 3 36.6075 37.0 37.0 37.0 37.0 37.0 4 36.614 37.0 37.0 37.0 37.0 37.0 5 36.6055 37.0 37.0 37.0 37.0 37.0 6 36.5795 37.0 37.0 37.0 37.0 37.0 7 36.564 37.0 37.0 37.0 37.0 37.0 8 36.422 37.0 37.0 37.0 37.0 37.0 9 36.587 37.0 37.0 37.0 37.0 37.0 10-14 36.59740000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.5456 37.0 37.0 37.0 37.0 37.0 20-24 36.517 37.0 37.0 37.0 37.0 37.0 25-29 36.5227 37.0 37.0 37.0 37.0 37.0 30-34 36.4624 37.0 37.0 37.0 37.0 37.0 35-39 36.4745 37.0 37.0 37.0 37.0 37.0 40-44 36.4259 37.0 37.0 37.0 37.0 37.0 45-49 36.2362 37.0 37.0 37.0 37.0 37.0 50-54 36.259100000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.1027 37.0 37.0 37.0 37.0 37.0 60-64 36.1224 37.0 37.0 37.0 37.0 37.0 65-69 36.0838 37.0 37.0 37.0 37.0 37.0 70-74 36.0568 37.0 37.0 37.0 37.0 37.0 75-79 36.1284 37.0 37.0 37.0 37.0 37.0 80-84 36.0939 37.0 37.0 37.0 37.0 37.0 85-89 36.1509 37.0 37.0 37.0 37.0 37.0 90-94 36.128699999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.012 37.0 37.0 37.0 37.0 37.0 100-104 35.996500000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.9276 37.0 37.0 37.0 37.0 37.0 110-114 35.873599999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.9659 37.0 37.0 37.0 37.0 37.0 120-124 35.7881 37.0 37.0 37.0 37.0 37.0 125-129 35.6545 37.0 37.0 37.0 37.0 37.0 130-134 35.8375 37.0 37.0 37.0 37.0 37.0 135-139 35.724000000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.4845 37.0 37.0 37.0 37.0 37.0 145-149 35.4877 37.0 37.0 37.0 37.0 37.0 150-151 35.23075 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 3.0 25 4.0 26 7.0 27 6.0 28 13.0 29 17.0 30 38.0 31 42.0 32 47.0 33 95.0 34 161.0 35 402.0 36 2905.0 37 258.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 27.98188223452441 12.707599396074484 13.563160543532964 45.74735782586814 2 18.0 16.225 34.75 31.025000000000002 3 17.474999999999998 18.2 27.375 36.95 4 20.4 24.725 24.95 29.925 5 25.55 30.375000000000004 23.275000000000002 20.8 6 22.15 34.975 23.549999999999997 19.325 7 15.299999999999999 28.075 39.95 16.675 8 19.775000000000002 27.55 30.925000000000004 21.75 9 17.925 25.7 35.275 21.099999999999998 10-14 19.785 30.240000000000002 26.939999999999998 23.035 15-19 19.055 28.43 28.244999999999997 24.27 20-24 19.125 29.270000000000003 27.345000000000002 24.26 25-29 19.495 28.93 27.965 23.61 30-34 19.23 29.035 26.955000000000002 24.779999999999998 35-39 19.56 29.12 27.63 23.69 40-44 19.935 29.054999999999996 27.46 23.549999999999997 45-49 19.895 29.160000000000004 27.889999999999997 23.055 50-54 20.1 28.854999999999997 27.18 23.865 55-59 19.75 28.565 28.03 23.655 60-64 19.32 28.955 27.950000000000003 23.775 65-69 20.52 29.18 27.005000000000003 23.294999999999998 70-74 20.335 28.28 27.755000000000003 23.630000000000003 75-79 20.39 28.535 27.555000000000003 23.52 80-84 21.16 28.73 27.505000000000003 22.605 85-89 21.115000000000002 27.650000000000002 27.805000000000003 23.43 90-94 20.580000000000002 28.42 27.6 23.400000000000002 95-99 20.87 27.884999999999998 27.375 23.87 100-104 21.02 28.199999999999996 27.36 23.419999999999998 105-109 21.2 28.46 26.995 23.345 110-114 20.94 27.93 27.61 23.52 115-119 21.245 28.355000000000004 26.900000000000002 23.5 120-124 21.44 28.794999999999998 26.26 23.505000000000003 125-129 21.34 28.110000000000003 27.400000000000002 23.150000000000002 130-134 21.25 27.98 26.634999999999998 24.135 135-139 22.005 28.249999999999996 26.26 23.485 140-144 21.895 27.765 26.245 24.095 145-149 21.98 28.04 26.064999999999998 23.915 150-151 22.55 27.787499999999998 25.224999999999998 24.4375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 1.5 22 2.5 23 2.5 24 4.0 25 3.0 26 4.0 27 7.0 28 11.0 29 18.0 30 29.0 31 29.0 32 38.5 33 57.5 34 65.0 35 88.0 36 118.5 37 131.5 38 135.5 39 150.0 40 187.0 41 210.5 42 219.0 43 243.5 44 259.0 45 263.5 46 264.0 47 247.5 48 209.0 49 178.5 50 150.5 51 124.5 52 105.0 53 92.5 54 80.5 55 52.0 56 37.0 57 35.5 58 25.0 59 13.0 60 11.0 61 10.0 62 7.5 63 5.0 64 3.0 65 10.5 66 17.5 67 15.0 68 9.0 69 5.0 70 4.0 71 1.5 72 2.5 73 2.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.65 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.6 #Duplication Level Percentage of deduplicated Percentage of total 1 84.6291866028708 70.75 2 13.008373205741627 21.75 3 1.9138755980861244 4.8 4 0.23923444976076555 0.8 5 0.11961722488038277 0.5 6 0.029904306220095694 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05980861244019139 1.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCACCTTACATCTCGTAT 33 0.8250000000000001 TruSeq Adapter, Index 7 (97% over 35bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACCACCTTACATCGCGTAT 17 0.42500000000000004 TruSeq Adapter, Index 7 (97% over 35bp) GCTGGTTCCAAAAGATGGAGTAAGAGTGGAAATCCTTAGTAGGGTCAAAC 6 0.15 No Hit TCTTCAGCTTCATCCTCTAAGCCCCTGGTCCCGTGGGAGTTCACATCAGA 5 0.125 No Hit CACCACGGCTATAACCGCCTCCGCCACCTTCACGGCGACCTCCGTAACCG 5 0.125 No Hit GCATAATTTTACTAATTCTCGTGGGGGTGGAATCACTGAACAGTGGAGAC 5 0.125 No Hit CGTTGCTGTTGATTTTGACCACCAATAATATTAGCATTCCTATGATCCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.30000000000000004 0.0 0.0 0.0 0.0 84-85 0.38749999999999996 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.7625 0.0 0.0 0.0 0.0 92-93 0.9875 0.0 0.0 0.0 0.0 94-95 1.2 0.0 0.0 0.0 0.0 96-97 1.35 0.0 0.0 0.0 0.0 98-99 1.5499999999999998 0.0 0.0 0.0 0.0 100-101 1.8875 0.0 0.0 0.0 0.0 102-103 2.125 0.0 0.0 0.0 0.0 104-105 2.375 0.0 0.0 0.0 0.0 106-107 2.7375 0.0 0.0 0.0 0.0 108-109 3.0875 0.0 0.0 0.0 0.0 110-111 3.375 0.0 0.0 0.0 0.0 112-113 3.7 0.0 0.0 0.0 0.0 114-115 4.0625 0.0 0.0 0.0 0.0 116-117 4.875 0.0 0.0 0.0 0.0 118-119 5.5375 0.0 0.0 0.0 0.0 120-121 6.025 0.0 0.0 0.0 0.0 122-123 6.575 0.0 0.0 0.0 0.0 124-125 7.075 0.0 0.0 0.0 0.0 126-127 7.5125 0.0 0.0 0.0 0.0 128-129 8.25 0.0 0.0 0.0 0.0 130-131 8.85 0.0 0.0 0.0 0.0 132-133 9.5125 0.0 0.0 0.0 0.0 134-135 10.162500000000001 0.0 0.0 0.0 0.0 136-137 10.9125 0.0 0.0 0.0 0.0 138-139 11.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGATGGA 10 0.006830828 145.0 7 CTGAAGG 10 0.006830828 145.0 7 TTGATGG 10 0.006830828 145.0 6 CTAGCCT 10 0.006830828 145.0 145 >>END_MODULE SRR28623231 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623231_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9305 37.0 37.0 37.0 37.0 37.0 2 36.1495 37.0 37.0 37.0 37.0 37.0 3 36.2265 37.0 37.0 37.0 37.0 37.0 4 36.1185 37.0 37.0 37.0 37.0 37.0 5 36.116 37.0 37.0 37.0 37.0 37.0 6 36.1285 37.0 37.0 37.0 37.0 37.0 7 36.1635 37.0 37.0 37.0 37.0 37.0 8 36.109 37.0 37.0 37.0 37.0 37.0 9 35.967 37.0 37.0 37.0 37.0 37.0 10-14 35.8712 37.0 37.0 37.0 37.0 37.0 15-19 35.8649 37.0 37.0 37.0 37.0 37.0 20-24 35.813300000000005 37.0 37.0 37.0 37.0 37.0 25-29 35.6654 37.0 37.0 37.0 37.0 37.0 30-34 35.567099999999996 37.0 37.0 37.0 37.0 37.0 35-39 35.56660000000001 37.0 37.0 37.0 37.0 37.0 40-44 35.478300000000004 37.0 37.0 37.0 37.0 37.0 45-49 35.4858 37.0 37.0 37.0 37.0 37.0 50-54 35.5158 37.0 37.0 37.0 37.0 37.0 55-59 35.3585 37.0 37.0 37.0 37.0 37.0 60-64 35.3448 37.0 37.0 37.0 37.0 37.0 65-69 35.38459999999999 37.0 37.0 37.0 37.0 37.0 70-74 35.337 37.0 37.0 37.0 37.0 37.0 75-79 35.3662 37.0 37.0 37.0 37.0 37.0 80-84 35.231300000000005 37.0 37.0 37.0 34.6 37.0 85-89 35.2723 37.0 37.0 37.0 34.6 37.0 90-94 35.28869999999999 37.0 37.0 37.0 34.6 37.0 95-99 35.2872 37.0 37.0 37.0 34.6 37.0 100-104 35.2297 37.0 37.0 37.0 32.2 37.0 105-109 35.257600000000004 37.0 37.0 37.0 34.6 37.0 110-114 35.388600000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.3064 37.0 37.0 37.0 37.0 37.0 120-124 35.334999999999994 37.0 37.0 37.0 34.6 37.0 125-129 34.7784 37.0 37.0 37.0 25.0 37.0 130-134 35.2247 37.0 37.0 37.0 32.2 37.0 135-139 34.9473 37.0 37.0 37.0 25.0 37.0 140-144 34.92099999999999 37.0 37.0 37.0 25.0 37.0 145-149 34.9565 37.0 37.0 37.0 27.4 37.0 150-151 34.6825 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 4.0 13 13.0 14 6.0 15 4.0 16 8.0 17 9.0 18 4.0 19 5.0 20 5.0 21 7.0 22 4.0 23 20.0 24 24.0 25 16.0 26 12.0 27 20.0 28 14.0 29 22.0 30 30.0 31 37.0 32 77.0 33 108.0 34 260.0 35 634.0 36 2428.0 37 229.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.45 19.05 20.549999999999997 29.95 2 30.675 23.375 28.675 17.275 3 24.0 26.700000000000003 28.95 20.349999999999998 4 25.474999999999998 31.55 24.0 18.975 5 27.6 33.85 21.4 17.150000000000002 6 22.125 37.175000000000004 22.975 17.724999999999998 7 22.95 20.849999999999998 38.7 17.5 8 25.05 25.124999999999996 27.55 22.275 9 24.325 24.9 29.625 21.15 10-14 25.814999999999998 28.139999999999997 26.195 19.85 15-19 24.865000000000002 27.67 27.18 20.285 20-24 24.425 27.800000000000004 27.735 20.04 25-29 24.97 27.48 27.555000000000003 19.994999999999997 30-34 24.23 27.495000000000005 28.294999999999998 19.98 35-39 24.165 27.800000000000004 27.584999999999997 20.45 40-44 24.115000000000002 27.765 28.585 19.535 45-49 24.245 28.449999999999996 27.48 19.825 50-54 24.560000000000002 28.08 27.560000000000002 19.8 55-59 24.595 27.655 27.965 19.785 60-64 24.215 28.035 27.955000000000002 19.794999999999998 65-69 23.855 28.255000000000003 27.88 20.01 70-74 23.16 28.910000000000004 28.035 19.895 75-79 23.200000000000003 29.2 27.855 19.744999999999997 80-84 23.74 28.78 27.54 19.939999999999998 85-89 24.375 27.595 28.310000000000002 19.72 90-94 24.91 28.21 27.755000000000003 19.125 95-99 25.130000000000003 27.560000000000002 27.35 19.96 100-104 25.22 27.744999999999997 27.395000000000003 19.64 105-109 25.355 28.139999999999997 27.185 19.32 110-114 25.569999999999997 27.500000000000004 27.205000000000002 19.725 115-119 26.21 28.535 26.784999999999997 18.47 120-124 25.979999999999997 28.21 26.51 19.3 125-129 26.650000000000002 27.805000000000003 26.755000000000003 18.790000000000003 130-134 26.064999999999998 27.884999999999998 26.445 19.605 135-139 25.955000000000002 28.439999999999998 26.365 19.24 140-144 27.084999999999997 28.505000000000003 25.27 19.139999999999997 145-149 27.575 27.48 26.325 18.62 150-151 26.887499999999996 27.3625 26.05 19.7 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 1.0 9 1.5 10 1.0 11 1.5 12 1.0 13 0.0 14 2.0 15 2.0 16 0.5 17 0.5 18 0.5 19 1.5 20 1.5 21 3.0 22 3.5 23 2.0 24 3.5 25 3.5 26 6.0 27 7.5 28 9.5 29 15.5 30 20.0 31 26.5 32 30.5 33 31.0 34 47.0 35 72.0 36 97.0 37 126.5 38 155.0 39 178.0 40 206.5 41 247.5 42 260.5 43 259.0 44 264.5 45 247.5 46 232.0 47 230.5 48 206.0 49 190.0 50 164.0 51 123.0 52 88.5 53 71.0 54 65.0 55 50.5 56 46.5 57 37.0 58 24.0 59 12.5 60 7.0 61 7.0 62 6.5 63 5.5 64 5.5 65 4.0 66 3.0 67 1.5 68 1.0 69 3.0 70 2.5 71 1.0 72 1.0 73 1.5 74 1.0 75 1.0 76 2.0 77 1.0 78 0.5 79 1.5 80 3.0 81 3.5 82 3.0 83 3.0 84 3.5 85 2.5 86 1.5 87 4.0 88 4.5 89 2.0 90 3.5 91 3.5 92 0.5 93 0.5 94 1.5 95 2.5 96 2.0 97 2.5 98 3.0 99 1.0 100 6.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.8 #Duplication Level Percentage of deduplicated Percentage of total 1 86.42191142191142 74.15 2 11.596736596736596 19.900000000000002 3 1.6317016317016315 4.2 4 0.2331002331002331 0.8 5 0.08741258741258741 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.029137529137529136 0.575 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 23 0.575 No Hit AGAAATTCAGCGAATTCCGAACAAAGCTGGTTGGACTGACCACTGTGACA 5 0.125 No Hit TGAAACTGGAAGATCTCGCGGCTTTGGATTTGTTACCTTCAACAACGAGA 5 0.125 No Hit AAAAAACGATTTCTGATCTTATGTCTTTCTATGATACCAATCTTCAGCGA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.4375 0.0 0.0 0.0 0.0 86-87 0.525 0.0 0.0 0.0 0.0 88-89 0.6 0.0 0.0 0.0 0.0 90-91 0.8375 0.0 0.0 0.0 0.0 92-93 1.0625 0.0 0.0 0.0 0.0 94-95 1.275 0.0 0.0 0.0 0.0 96-97 1.425 0.0 0.0 0.0 0.0 98-99 1.625 0.0 0.0 0.0 0.0 100-101 1.9625 0.0 0.0 0.0 0.0 102-103 2.2 0.0 0.0 0.0 0.0 104-105 2.45 0.0 0.0 0.0 0.0 106-107 2.8125 0.0 0.0 0.0 0.0 108-109 3.1625 0.0 0.0 0.0 0.0 110-111 3.45 0.0 0.0 0.0 0.0 112-113 3.7625 0.0 0.0 0.0 0.0 114-115 4.125 0.0 0.0 0.0 0.0 116-117 4.95 0.0 0.0 0.0 0.0 118-119 5.612500000000001 0.0 0.0 0.0 0.0 120-121 6.1125 0.0 0.0 0.0 0.0 122-123 6.65 0.0 0.0 0.0 0.0 124-125 7.112500000000001 0.0 0.0 0.0 0.0 126-127 7.5375 0.0 0.0 0.0 0.0 128-129 8.275 0.0 0.0 0.0 0.0 130-131 8.8875 0.0 0.0 0.0 0.0 132-133 9.5625 0.0 0.0 0.0 0.0 134-135 10.162500000000001 0.0 0.0 0.0 0.0 136-137 10.9375 0.0 0.0 0.0 0.0 138-139 11.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTTCTC 10 0.006830828 145.0 3 >>END_MODULE Read 1965730 spots for SRR28623231.sra Written 1965730 spots for SRR28623231.sra Read 1965730 spots for SRR28623231.sra Written 1965730 spots for SRR28623231.sra Read 1965730 spots for SRR28623231.sra Written 1965730 spots for SRR28623231.sra Read 1965730 spots for SRR28623231.sra Written 1965730 spots for SRR28623231.sra Read 1965730 spots for SRR28623231.sra Written 1965730 spots for SRR28623231.sra Read 1965730 spots for SRR28623231.sra Written 1965730 spots for SRR28623231.sra Read 1965730 spots for SRR28623231.sra Written 1965730 spots for SRR28623231.sra Read 1965730 spots for SRR28623231.sra Written 1965730 spots for SRR28623231.sra Read 1965730 spots for SRR28623231.sra Written 1965730 spots for SRR28623231.sra Read 1965730 spots for SRR28623231.sra Written 1965730 spots for SRR28623231.sra Read 1965730 spots for SRR28623231.sra Written 1965730 spots for SRR28623231.sra Read 1965730 spots for SRR28623231.sra Written 1965730 spots for SRR28623231.sra Read 1965730 spots for SRR28623231.sra Written 1965730 spots for SRR28623231.sra Read 1965747 spots for SRR28623231.sra Written 1965747 spots for SRR28623231.sra Read 1965730 spots for SRR28623231.sra Written 1965730 spots for SRR28623231.sra Read 1965730 spots for SRR28623231.sra Written 1965730 spots for SRR28623231.sra Read 1965730 spots for SRR28623231.sra Written 1965730 spots for SRR28623231.sra Read 1965730 spots for SRR28623231.sra Written 1965730 spots for SRR28623231.sra Read 1965730 spots for SRR28623231.sra Written 1965730 spots for SRR28623231.sra Read 1965730 spots for SRR28623231.sra Written 1965730 spots for SRR28623231.sra SRR ids: ['SRR28623231.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_29g0feaz SRR28623231.sra spots: 39314617 blocks: [[1, 1965730], [1965731, 3931460], [3931461, 5897190], [5897191, 7862920], [7862921, 9828650], [9828651, 11794380], [11794381, 13760110], [13760111, 15725840], [15725841, 17691570], [17691571, 19657300], [19657301, 21623030], [21623031, 23588760], [23588761, 25554490], [25554491, 27520220], [27520221, 29485950], [29485951, 31451680], [31451681, 33417410], [33417411, 35383140], [35383141, 37348870], [37348871, 39314617]] SRR28623231 file size 14519643 SRR28623231 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623231 SRR28623231_1.fastq SRR28623231_2.fastq Input file: SRR28623231_1.fastq Paired file: SRR28623231_2.fastq trimmed: SRR28623231-trimmed-pair1.fastq, SRR28623231-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:38:16 2025 >> started Tue Feb 11 10:39:16 2025 >> done (60.313s) 39314617 read pairs processed; of these: 45 ( 0.00%) short read pairs filtered out after trimming by size control 453462 ( 1.15%) empty read pairs filtered out after trimming by size control 38861110 (98.85%) read pairs available; of these: 5991710 (15.42%) trimmed read pairs available after processing 32869400 (84.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 5 0.00% 21 6 0.00% 22 13 0.00% 23 11 0.00% 24 11 0.00% 25 10 0.00% 26 7 0.00% 27 15 0.00% 28 22 0.00% 29 30 0.00% 30 23 0.00% 31 23 0.00% 32 39 0.00% 33 28 0.00% 34 37 0.00% 35 41 0.00% 36 34 0.00% 37 57 0.00% 38 85 0.00% 39 58 0.00% 40 98 0.00% 41 117 0.00% 42 120 0.00% 43 160 0.00% 44 147 0.00% 45 180 0.00% 46 168 0.00% 47 221 0.00% 48 218 0.00% 49 257 0.00% 50 337 0.00% 51 365 0.00% 52 442 0.00% 53 422 0.00% 54 516 0.00% 55 565 0.00% 56 659 0.00% 57 654 0.00% 58 829 0.00% 59 841 0.00% 60 1031 0.00% 61 1280 0.00% 62 1406 0.00% 63 1721 0.00% 64 1979 0.01% 65 1957 0.01% 66 2188 0.01% 67 2493 0.01% 68 2682 0.01% 69 3205 0.01% 70 3500 0.01% 71 4152 0.01% 72 4638 0.01% 73 5466 0.01% 74 6057 0.02% 75 6935 0.02% 76 7367 0.02% 77 8408 0.02% 78 9149 0.02% 79 10266 0.03% 80 11284 0.03% 81 12738 0.03% 82 14439 0.04% 83 16176 0.04% 84 18248 0.05% 85 20256 0.05% 86 21641 0.06% 87 23137 0.06% 88 24532 0.06% 89 26129 0.07% 90 28211 0.07% 91 30691 0.08% 92 33159 0.09% 93 36053 0.09% 94 39060 0.10% 95 41695 0.11% 96 44133 0.11% 97 46609 0.12% 98 48252 0.12% 99 49756 0.13% 100 52184 0.13% 101 53893 0.14% 102 57163 0.15% 103 59341 0.15% 104 62780 0.16% 105 65895 0.17% 106 69865 0.18% 107 71255 0.18% 108 72721 0.19% 109 74575 0.19% 110 75547 0.19% 111 77734 0.20% 112 80700 0.21% 113 82447 0.21% 114 85351 0.22% 115 89467 0.23% 116 91543 0.24% 117 94017 0.24% 118 95547 0.25% 119 97879 0.25% 120 98281 0.25% 121 99555 0.26% 122 100482 0.26% 123 102742 0.26% 124 105447 0.27% 125 107976 0.28% 126 110840 0.29% 127 114277 0.29% 128 114480 0.29% 129 115806 0.30% 130 117544 0.30% 131 118283 0.30% 132 118654 0.31% 133 120398 0.31% 134 121619 0.31% 135 122847 0.32% 136 125609 0.32% 137 128548 0.33% 138 129744 0.33% 139 131408 0.34% 140 131126 0.34% 141 131900 0.34% 142 133399 0.34% 143 133774 0.34% 144 134753 0.35% 145 135143 0.35% 146 136454 0.35% 147 138557 0.36% 148 139544 0.36% 149 140598 0.36% 150 142062 0.37% 151 32869400 84.58% 38861110 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=34 prefix-density=0.12 prefix-fanout=2.3 sequence=GTGGACTCCTTCTGGAT criterion=fanout-score sequence-density=0.06 sequence-density-rank=19 fanout-score=309.93 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=19.6 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=6.13 fanout-score-rank=21 prefix-density=0.17 prefix-fanout=4.3 sequence=AATGGCCACTGTTGAGGTTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=12 fanout-score=339.51 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=27.2 sequence=AAGAAGAAGAAA SRR28623231 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:40:00 Started mapping on | Feb 11 10:40:00 Finished on | Feb 11 10:44:21 Mapping speed, Million of reads per hour | 536.02 Number of input reads | 38861110 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 36153085 Uniquely mapped reads % | 93.03% Average mapped length | 292.04 Number of splices: Total | 32891072 Number of splices: Annotated (sjdb) | 32132775 Number of splices: GT/AG | 32330894 Number of splices: GC/AG | 433149 Number of splices: AT/AC | 33988 Number of splices: Non-canonical | 93041 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.97 Insertion rate per base | 0.03% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 934319 % of reads mapped to multiple loci | 2.40% Number of reads mapped to too many loci | 195321 % of reads mapped to too many loci | 0.50% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.74% % of reads unmapped: other | 0.32% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1773706 1773706 1773706 N_multimapping 934319 934319 934319 N_noFeature 1483804 35696507 1706465 N_ambiguous 449982 3141 213794 UnstrandedReadsAssigned:34219299 PositiveStrandReadsAssigned:453437 NegativeStrandReadsAssigned:34232826 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623231 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623231-trimmed-pair1.fastq SRR28623231-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 38,861,110 reads, 34,787,845 reads pseudoaligned [quant] estimated average fragment length: 233.211 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,093 rounds 52401 SRR28623231.ke.tsv 34699 SRR28623231.se.tsv 87100 total ==> SRR28623231.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1785.79 1357 22.1623 Potri.005G024800.1.v4.1 1035 802.789 1088 39.5269 Potri.004G059700.1.v4.1 961 728.815 127 5.0822 Potri.007G009000.2.v4.1 1416 1183.79 0 0 Potri.003G141000.2.v4.1 2943 2710.79 1162.39 12.5061 Potri.016G087400.1.v4.1 270 94.1203 2649.16 820.898 Potri.015G069301.1.v4.1 564 338.288 0 0 Potri.010G195200.1.v4.1 1773 1540.79 102 1.93073 Potri.012G127500.1.v4.1 977 744.8 10587 414.571 ==> SRR28623231.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1342 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 694 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 8 SRR28623231 completed mapping pipeline successfully