Starting /dee2/code/volunteer_pipeline.sh SRR28623232 current disk space = 3053183254528 free memory = 1311481272 SRR28623232 SRAfilesize 726d41ff416aff4a20f390914f272919 SRR28623232.sra SRR28623232.sra file validated SRR28623232 is paired end SRR28623232 is conventional basespace SRR28623232 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623232_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.84675 37.0 37.0 37.0 37.0 37.0 2 36.3865 37.0 37.0 37.0 37.0 37.0 3 36.4645 37.0 37.0 37.0 37.0 37.0 4 36.5355 37.0 37.0 37.0 37.0 37.0 5 36.609 37.0 37.0 37.0 37.0 37.0 6 36.6045 37.0 37.0 37.0 37.0 37.0 7 36.5735 37.0 37.0 37.0 37.0 37.0 8 36.671 37.0 37.0 37.0 37.0 37.0 9 36.577 37.0 37.0 37.0 37.0 37.0 10-14 36.6112 37.0 37.0 37.0 37.0 37.0 15-19 36.5555 37.0 37.0 37.0 37.0 37.0 20-24 36.5529 37.0 37.0 37.0 37.0 37.0 25-29 36.48819999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.4588 37.0 37.0 37.0 37.0 37.0 35-39 36.35360000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.354400000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.2035 37.0 37.0 37.0 37.0 37.0 50-54 36.2054 37.0 37.0 37.0 37.0 37.0 55-59 36.1323 37.0 37.0 37.0 37.0 37.0 60-64 36.142 37.0 37.0 37.0 37.0 37.0 65-69 36.0114 37.0 37.0 37.0 37.0 37.0 70-74 36.03099999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.0458 37.0 37.0 37.0 37.0 37.0 80-84 36.014700000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.963499999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.936800000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.810199999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.7842 37.0 37.0 37.0 37.0 37.0 105-109 35.7465 37.0 37.0 37.0 37.0 37.0 110-114 35.6543 37.0 37.0 37.0 37.0 37.0 115-119 35.577600000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.5198 37.0 37.0 37.0 37.0 37.0 125-129 35.42999999999999 37.0 37.0 37.0 34.6 37.0 130-134 35.157500000000006 37.0 37.0 37.0 29.8 37.0 135-139 35.012699999999995 37.0 37.0 37.0 25.0 37.0 140-144 34.7294 37.0 37.0 37.0 25.0 37.0 145-149 34.4863 37.0 37.0 37.0 25.0 37.0 150-151 33.609 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 1.0 22 2.0 23 0.0 24 5.0 25 5.0 26 11.0 27 17.0 28 21.0 29 30.0 30 38.0 31 45.0 32 82.0 33 129.0 34 191.0 35 465.0 36 2805.0 37 151.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.97548161120841 14.285714285714285 10.382787090317738 41.35601701275957 2 18.15 16.875 35.55 29.425 3 17.4 19.900000000000002 27.6 35.099999999999994 4 21.425 26.55 25.074999999999996 26.950000000000003 5 25.35 30.525000000000002 23.45 20.674999999999997 6 20.875 35.8 22.875 20.45 7 15.425 29.075 38.925 16.575 8 16.875 29.925 31.85 21.349999999999998 9 17.8 25.5 33.900000000000006 22.8 10-14 18.73 31.064999999999998 27.315 22.89 15-19 19.009999999999998 29.565 27.785 23.64 20-24 19.445 29.575000000000003 27.62 23.36 25-29 19.365 29.830000000000002 27.560000000000002 23.244999999999997 30-34 19.615 29.87 26.61 23.905 35-39 19.34 29.62 27.68 23.36 40-44 19.905 30.259999999999998 26.685 23.150000000000002 45-49 19.99 29.509999999999998 26.995 23.505000000000003 50-54 19.564999999999998 29.715000000000003 26.57 24.15 55-59 19.49 29.5 27.634999999999998 23.375 60-64 19.825 28.525 27.67 23.98 65-69 19.57 30.470000000000002 26.479999999999997 23.48 70-74 20.549999999999997 29.365000000000002 26.400000000000002 23.685000000000002 75-79 20.380000000000003 29.485 26.724999999999998 23.41 80-84 20.419999999999998 28.99 27.250000000000004 23.34 85-89 20.505000000000003 28.935 27.305 23.255 90-94 20.48 29.74 26.224999999999998 23.555 95-99 20.294999999999998 29.39 26.465 23.849999999999998 100-104 21.21 29.42 26.11 23.26 105-109 21.255 29.065 25.965 23.715 110-114 21.295 29.715000000000003 25.895000000000003 23.095 115-119 21.55 29.604999999999997 25.215 23.630000000000003 120-124 22.145 29.475 25.09 23.29 125-129 22.43 28.634999999999998 24.82 24.115000000000002 130-134 22.115000000000002 29.220000000000002 24.65 24.015 135-139 21.855 28.595 25.41 24.14 140-144 23.085 28.294999999999998 24.72 23.9 145-149 22.555 27.79 25.590000000000003 24.065 150-151 22.775000000000002 27.762500000000003 24.575 24.887500000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.5 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 2.0 20 4.5 21 3.0 22 0.0 23 1.0 24 3.0 25 6.5 26 7.0 27 6.5 28 12.0 29 19.5 30 27.0 31 40.0 32 58.0 33 62.5 34 75.0 35 100.0 36 119.0 37 146.5 38 163.5 39 169.0 40 179.0 41 200.5 42 219.5 43 223.5 44 239.5 45 254.5 46 243.0 47 215.5 48 206.5 49 179.0 50 143.0 51 119.5 52 98.5 53 87.5 54 71.0 55 55.5 56 36.5 57 28.5 58 28.0 59 22.0 60 14.0 61 11.5 62 11.0 63 11.0 64 9.5 65 9.0 66 13.5 67 13.0 68 7.0 69 4.0 70 2.5 71 2.0 72 2.5 73 2.0 74 2.0 75 1.5 76 0.5 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.8 #Duplication Level Percentage of deduplicated Percentage of total 1 97.26239669421489 94.15 2 2.479338842975207 4.8 3 0.1291322314049587 0.375 4 0.05165289256198347 0.2 5 0.0 0.0 6 0.05165289256198347 0.3 7 0.025826446280991736 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCGAGTATCTCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 9 (97% over 37bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCGAGTATCGCGTAT 6 0.15 TruSeq Adapter, Index 9 (97% over 37bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCGAGTATCTCGTTT 6 0.15 TruSeq Adapter, Index 9 (97% over 37bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.325 0.0 0.0 0.0 0.0 72-73 0.5 0.0 0.0 0.0 0.0 74-75 0.55 0.0 0.0 0.0 0.0 76-77 0.7375 0.0 0.0 0.0 0.0 78-79 0.875 0.0 0.0 0.0 0.0 80-81 0.9874999999999999 0.0 0.0 0.0 0.0 82-83 1.1749999999999998 0.0 0.0 0.0 0.0 84-85 1.4 0.0 0.0 0.0 0.0 86-87 1.7625 0.0 0.0 0.0 0.0 88-89 2.1500000000000004 0.0 0.0 0.0 0.0 90-91 2.7125000000000004 0.0 0.0 0.0 0.0 92-93 3.1125 0.0 0.0 0.0 0.0 94-95 3.7 0.0 0.0 0.0 0.0 96-97 4.1625 0.0 0.0 0.0 0.0 98-99 4.8375 0.0 0.0 0.0 0.0 100-101 5.637499999999999 0.0 0.0 0.0 0.0 102-103 6.45 0.0 0.0 0.0 0.0 104-105 7.3625 0.0 0.0 0.0 0.0 106-107 8.1375 0.0 0.0 0.0 0.0 108-109 9.05 0.0 0.0 0.0 0.0 110-111 10.024999999999999 0.0 0.0 0.0 0.0 112-113 11.1375 0.0 0.0 0.0 0.0 114-115 12.225 0.0 0.0 0.0 0.0 116-117 13.125 0.0 0.0 0.0 0.0 118-119 14.375 0.0 0.0 0.0 0.0 120-121 15.7 0.0 0.0 0.0 0.0 122-123 17.1375 0.0 0.0 0.0 0.0 124-125 18.175 0.0 0.0 0.0 0.0 126-127 19.225 0.0 0.0 0.0 0.0 128-129 20.625 0.0 0.0 0.0 0.0 130-131 21.775 0.0 0.0 0.0 0.0 132-133 22.95 0.0 0.0 0.0 0.0 134-135 24.2375 0.0 0.0 0.0 0.0 136-137 25.6 0.0 0.0 0.0 0.0 138-139 26.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTCATA 10 0.006830828 145.0 4 AACTCAT 10 0.006830828 145.0 3 >>END_MODULE SRR28623232 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623232_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.269 37.0 37.0 37.0 37.0 37.0 2 36.4855 37.0 37.0 37.0 37.0 37.0 3 36.523 37.0 37.0 37.0 37.0 37.0 4 36.4785 37.0 37.0 37.0 37.0 37.0 5 36.394 37.0 37.0 37.0 37.0 37.0 6 36.5065 37.0 37.0 37.0 37.0 37.0 7 36.49 37.0 37.0 37.0 37.0 37.0 8 36.4985 37.0 37.0 37.0 37.0 37.0 9 36.4735 37.0 37.0 37.0 37.0 37.0 10-14 36.403200000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.343 37.0 37.0 37.0 37.0 37.0 20-24 36.2939 37.0 37.0 37.0 37.0 37.0 25-29 36.2188 37.0 37.0 37.0 37.0 37.0 30-34 36.1614 37.0 37.0 37.0 37.0 37.0 35-39 36.06230000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.1182 37.0 37.0 37.0 37.0 37.0 45-49 36.021699999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.989 37.0 37.0 37.0 37.0 37.0 55-59 35.91179999999999 37.0 37.0 37.0 37.0 37.0 60-64 35.950399999999995 37.0 37.0 37.0 37.0 37.0 65-69 35.909499999999994 37.0 37.0 37.0 37.0 37.0 70-74 35.8311 37.0 37.0 37.0 37.0 37.0 75-79 35.8226 37.0 37.0 37.0 37.0 37.0 80-84 35.789300000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.692899999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.719300000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.722899999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.602 37.0 37.0 37.0 37.0 37.0 105-109 35.5665 37.0 37.0 37.0 37.0 37.0 110-114 35.5165 37.0 37.0 37.0 37.0 37.0 115-119 35.4481 37.0 37.0 37.0 37.0 37.0 120-124 35.3275 37.0 37.0 37.0 34.6 37.0 125-129 35.321600000000004 37.0 37.0 37.0 34.6 37.0 130-134 35.2847 37.0 37.0 37.0 32.2 37.0 135-139 35.0579 37.0 37.0 37.0 25.0 37.0 140-144 35.0217 37.0 37.0 37.0 25.0 37.0 145-149 34.7107 37.0 37.0 37.0 25.0 37.0 150-151 34.295 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 2.0 15 4.0 16 4.0 17 3.0 18 4.0 19 1.0 20 5.0 21 5.0 22 5.0 23 10.0 24 15.0 25 17.0 26 10.0 27 18.0 28 14.0 29 26.0 30 32.0 31 43.0 32 58.0 33 80.0 34 151.0 35 505.0 36 2728.0 37 257.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.824999999999996 19.5 15.425 26.25 2 28.875 24.4 29.225 17.5 3 22.85 26.1 31.95 19.1 4 27.075 31.900000000000002 23.0 18.025 5 27.200000000000003 35.175 22.225 15.4 6 22.025 38.775 22.125 17.075000000000003 7 21.2 22.05 38.275 18.475 8 24.474999999999998 24.75 28.325 22.45 9 23.200000000000003 25.05 30.025000000000002 21.725 10-14 25.275 27.83 25.995 20.9 15-19 24.355 27.025 28.28 20.34 20-24 24.065 27.765 28.07 20.1 25-29 24.465 27.750000000000004 27.755000000000003 20.03 30-34 23.735 28.21 27.965 20.09 35-39 24.67 27.415 27.939999999999998 19.975 40-44 23.599999999999998 27.38 28.165000000000003 20.855 45-49 24.215 28.24 27.839999999999996 19.705000000000002 50-54 24.315 27.42 28.46 19.805 55-59 24.295 27.42 28.225 20.06 60-64 24.015 26.99 28.99 20.005 65-69 24.23 27.950000000000003 28.715000000000003 19.105 70-74 24.05 27.145000000000003 28.585 20.22 75-79 23.94 27.615000000000002 28.925 19.52 80-84 24.349999999999998 27.155 28.65 19.845 85-89 24.07 27.715 28.23 19.985 90-94 24.165 27.52 28.244999999999997 20.07 95-99 24.515 27.92 27.935 19.63 100-104 25.825 27.26 27.305 19.61 105-109 25.905 27.384999999999998 27.72 18.990000000000002 110-114 26.22 27.76 27.279999999999998 18.740000000000002 115-119 26.815 27.584999999999997 27.26 18.34 120-124 27.04 28.13 26.284999999999997 18.545 125-129 27.534999999999997 28.33 26.435 17.7 130-134 28.63 27.474999999999998 26.515 17.380000000000003 135-139 28.325 27.91 26.375 17.39 140-144 29.67 27.365000000000002 25.915 17.05 145-149 29.875 27.215 25.575 17.335 150-151 30.175 26.237500000000004 26.575 17.0125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 1.0 6 1.0 7 0.5 8 0.5 9 1.0 10 1.5 11 1.0 12 2.0 13 2.5 14 0.5 15 1.0 16 1.0 17 0.0 18 0.5 19 0.5 20 1.0 21 1.0 22 1.5 23 2.5 24 2.5 25 4.5 26 5.0 27 6.5 28 11.5 29 14.5 30 20.5 31 26.0 32 31.0 33 41.5 34 55.0 35 71.5 36 98.0 37 127.0 38 136.5 39 167.0 40 212.0 41 215.5 42 214.5 43 232.0 44 242.0 45 264.0 46 267.5 47 237.0 48 217.0 49 193.0 50 162.5 51 143.5 52 111.0 53 83.0 54 72.5 55 51.0 56 41.0 57 27.5 58 18.5 59 24.5 60 18.5 61 13.0 62 13.5 63 15.5 64 11.0 65 3.5 66 3.0 67 3.5 68 3.0 69 2.0 70 1.5 71 2.0 72 1.5 73 2.5 74 2.5 75 0.5 76 0.0 77 1.5 78 1.5 79 0.0 80 0.5 81 1.0 82 2.5 83 2.5 84 1.5 85 2.0 86 1.0 87 0.5 88 1.0 89 1.5 90 2.0 91 2.5 92 1.5 93 0.5 94 0.5 95 0.5 96 1.0 97 1.0 98 0.5 99 0.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 97.31196691651589 94.125 2 2.2744895321788574 4.3999999999999995 3 0.31015766347893514 0.8999999999999999 4 0.07753941586973379 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025846471956577927 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 11 0.27499999999999997 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.3 0.0 0.0 0.0 0.0 72-73 0.45 0.0 0.0 0.0 0.0 74-75 0.5 0.0 0.0 0.0 0.0 76-77 0.6625 0.0 0.0 0.0 0.0 78-79 0.8 0.0 0.0 0.0 0.0 80-81 0.9125 0.0 0.0 0.0 0.0 82-83 1.1 0.0 0.0 0.0 0.0 84-85 1.325 0.0 0.0 0.0 0.0 86-87 1.6875 0.0 0.0 0.0 0.0 88-89 2.0999999999999996 0.0 0.0 0.0 0.0 90-91 2.6624999999999996 0.0 0.0 0.0 0.0 92-93 3.0875 0.0 0.0 0.0 0.0 94-95 3.7 0.0 0.0 0.0 0.0 96-97 4.1625 0.0 0.0 0.0 0.0 98-99 4.9125 0.0 0.0 0.0 0.0 100-101 5.6875 0.0 0.0 0.0 0.0 102-103 6.5 0.0 0.0 0.0 0.0 104-105 7.4125 0.0 0.0 0.0 0.0 106-107 8.1875 0.0 0.0 0.0 0.0 108-109 9.087499999999999 0.0 0.0 0.0 0.0 110-111 10.0375 0.0 0.0 0.0 0.0 112-113 11.15 0.0 0.0 0.0 0.0 114-115 12.2 0.0 0.0 0.0 0.0 116-117 13.15 0.0 0.0 0.0 0.0 118-119 14.425 0.0 0.0 0.0 0.0 120-121 15.8125 0.0 0.0 0.0 0.0 122-123 17.299999999999997 0.0 0.0 0.0 0.0 124-125 18.4 0.0 0.0 0.0 0.0 126-127 19.4625 0.0 0.0 0.0 0.0 128-129 20.875 0.0 0.0 0.0 0.0 130-131 22.0625 0.0 0.0 0.0 0.0 132-133 23.2625 0.0 0.0 0.0 0.0 134-135 24.625 0.0 0.0 0.0 0.0 136-137 26.025 0.0 0.0 0.0 0.0 138-139 27.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGTTTG 10 0.006830828 145.0 145 AAAAAAA 40 2.9585467E-4 21.75 60-64 >>END_MODULE Read 704217 spots for SRR28623232.sra Written 704217 spots for SRR28623232.sra Read 704217 spots for SRR28623232.sra Written 704217 spots for SRR28623232.sra Read 704217 spots for SRR28623232.sra Written 704217 spots for SRR28623232.sra Read 704217 spots for SRR28623232.sra Written 704217 spots for SRR28623232.sra Read 704217 spots for SRR28623232.sra Written 704217 spots for SRR28623232.sra Read 704217 spots for SRR28623232.sra Written 704217 spots for SRR28623232.sra Read 704217 spots for SRR28623232.sra Written 704217 spots for SRR28623232.sra Read 704217 spots for SRR28623232.sra Written 704217 spots for SRR28623232.sra Read 704217 spots for SRR28623232.sra Written 704217 spots for SRR28623232.sra Read 704217 spots for SRR28623232.sra Written 704217 spots for SRR28623232.sra Read 704217 spots for SRR28623232.sra Written 704217 spots for SRR28623232.sra Read 704217 spots for SRR28623232.sra Written 704217 spots for SRR28623232.sra Read 704217 spots for SRR28623232.sra Written 704217 spots for SRR28623232.sra Read 704217 spots for SRR28623232.sra Written 704217 spots for SRR28623232.sra Read 704217 spots for SRR28623232.sra Written 704217 spots for SRR28623232.sra Read 704217 spots for SRR28623232.sra Written 704217 spots for SRR28623232.sra Read 704220 spots for SRR28623232.sra Written 704220 spots for SRR28623232.sra Read 704217 spots for SRR28623232.sra Written 704217 spots for SRR28623232.sra Read 704217 spots for SRR28623232.sra Written 704217 spots for SRR28623232.sra Read 704217 spots for SRR28623232.sra Written 704217 spots for SRR28623232.sra SRR ids: ['SRR28623232.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m_k_v4kx SRR28623232.sra spots: 14084343 blocks: [[1, 704217], [704218, 1408434], [1408435, 2112651], [2112652, 2816868], [2816869, 3521085], [3521086, 4225302], [4225303, 4929519], [4929520, 5633736], [5633737, 6337953], [6337954, 7042170], [7042171, 7746387], [7746388, 8450604], [8450605, 9154821], [9154822, 9859038], [9859039, 10563255], [10563256, 11267472], [11267473, 11971689], [11971690, 12675906], [12675907, 13380123], [13380124, 14084343]] SRR28623232 file size 5194655 SRR28623232 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623232 SRR28623232_1.fastq SRR28623232_2.fastq Input file: SRR28623232_1.fastq Paired file: SRR28623232_2.fastq trimmed: SRR28623232-trimmed-pair1.fastq, SRR28623232-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:31:32 2025 >> started Tue Feb 11 10:31:49 2025 >> done (17.280s) 14084343 read pairs processed; of these: 14 ( 0.00%) short read pairs filtered out after trimming by size control 98142 ( 0.70%) empty read pairs filtered out after trimming by size control 13986187 (99.30%) read pairs available; of these: 4753265 (33.99%) trimmed read pairs available after processing 9232922 (66.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 1 0.00% 21 1 0.00% 22 2 0.00% 23 0 0.00% 24 3 0.00% 25 1 0.00% 26 3 0.00% 27 4 0.00% 28 7 0.00% 29 5 0.00% 30 14 0.00% 31 12 0.00% 32 13 0.00% 33 11 0.00% 34 13 0.00% 35 23 0.00% 36 24 0.00% 37 33 0.00% 38 39 0.00% 39 55 0.00% 40 45 0.00% 41 74 0.00% 42 85 0.00% 43 90 0.00% 44 89 0.00% 45 110 0.00% 46 120 0.00% 47 168 0.00% 48 206 0.00% 49 242 0.00% 50 325 0.00% 51 328 0.00% 52 418 0.00% 53 451 0.00% 54 498 0.00% 55 578 0.00% 56 662 0.00% 57 828 0.01% 58 912 0.01% 59 1090 0.01% 60 1238 0.01% 61 1445 0.01% 62 1692 0.01% 63 1989 0.01% 64 2284 0.02% 65 2505 0.02% 66 2758 0.02% 67 3149 0.02% 68 3581 0.03% 69 4247 0.03% 70 4696 0.03% 71 5289 0.04% 72 6294 0.05% 73 7312 0.05% 74 8231 0.06% 75 9193 0.07% 76 10053 0.07% 77 11159 0.08% 78 12169 0.09% 79 13807 0.10% 80 14714 0.11% 81 16671 0.12% 82 18670 0.13% 83 20408 0.15% 84 22712 0.16% 85 25032 0.18% 86 26878 0.19% 87 28291 0.20% 88 29828 0.21% 89 31486 0.23% 90 33006 0.24% 91 34941 0.25% 92 37031 0.26% 93 40220 0.29% 94 43074 0.31% 95 45482 0.33% 96 48058 0.34% 97 50111 0.36% 98 51469 0.37% 99 52002 0.37% 100 54197 0.39% 101 55018 0.39% 102 56529 0.40% 103 58746 0.42% 104 61149 0.44% 105 63806 0.46% 106 65994 0.47% 107 67291 0.48% 108 68175 0.49% 109 69091 0.49% 110 69208 0.49% 111 69929 0.50% 112 70970 0.51% 113 72109 0.52% 114 73984 0.53% 115 76368 0.55% 116 77519 0.55% 117 79535 0.57% 118 79958 0.57% 119 80044 0.57% 120 79512 0.57% 121 80359 0.57% 122 80310 0.57% 123 80287 0.57% 124 80826 0.58% 125 81367 0.58% 126 84205 0.60% 127 84796 0.61% 128 84511 0.60% 129 85493 0.61% 130 85676 0.61% 131 84243 0.60% 132 83924 0.60% 133 84366 0.60% 134 83178 0.59% 135 83217 0.59% 136 84295 0.60% 137 84958 0.61% 138 86174 0.62% 139 86469 0.62% 140 86150 0.62% 141 85724 0.61% 142 85781 0.61% 143 83711 0.60% 144 83527 0.60% 145 83813 0.60% 146 82346 0.59% 147 83190 0.59% 148 83556 0.60% 149 83487 0.60% 150 83434 0.60% 151 9232922 66.01% 13986187 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=16.90 fanout-score-rank=3 prefix-density=0.22 prefix-fanout=16.9 sequence=GGATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCGAGTATCTCGTATGCCGTCTTCTGCTTGAAAA criterion=fanout-score sequence-density=0.13 sequence-density-rank=7 fanout-score=20.36 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=8.7 sequence=TTCTCATCAAGGT criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=30 prefix-density=0.22 prefix-fanout=2.2 sequence=AATAGGTTCTTGAAGACAGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=24 fanout-score=21.55 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=3.1 sequence=ATTTTTGCTTCTAATGCTCCAGCTCCAGCACCAGT SRR28623232 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:32:44 Started mapping on | Feb 11 10:32:44 Finished on | Feb 11 10:35:19 Mapping speed, Million of reads per hour | 324.84 Number of input reads | 13986187 Average input read length | 281 UNIQUE READS: Uniquely mapped reads number | 12213330 Uniquely mapped reads % | 87.32% Average mapped length | 279.53 Number of splices: Total | 8004265 Number of splices: Annotated (sjdb) | 7798580 Number of splices: GT/AG | 7868162 Number of splices: GC/AG | 97488 Number of splices: AT/AC | 7926 Number of splices: Non-canonical | 30689 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.04% Deletion average length | 2.79 Insertion rate per base | 0.03% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 268255 % of reads mapped to multiple loci | 1.92% Number of reads mapped to too many loci | 425128 % of reads mapped to too many loci | 3.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.13% % of reads unmapped: other | 0.59% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1504602 1504602 1504602 N_multimapping 268255 268255 268255 N_noFeature 516080 11978852 621965 N_ambiguous 177785 1468 48010 UnstrandedReadsAssigned:11519465 PositiveStrandReadsAssigned:233010 NegativeStrandReadsAssigned:11543355 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=127 echo kmer=123 SRR28623232 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623232-trimmed-pair1.fastq SRR28623232-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,986,187 reads, 12,051,826 reads pseudoaligned [quant] estimated average fragment length: 180.792 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,108 rounds 52401 SRR28623232.ke.tsv 34699 SRR28623232.se.tsv 87100 total ==> SRR28623232.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1838.21 319 16.3235 Potri.005G024800.1.v4.1 1035 855.208 111 12.2087 Potri.004G059700.1.v4.1 961 781.212 35 4.21421 Potri.007G009000.2.v4.1 1416 1236.21 0 0 Potri.003G141000.2.v4.1 2943 2763.21 150 5.10616 Potri.016G087400.1.v4.1 270 112.564 946.594 791.007 Potri.015G069301.1.v4.1 564 385.481 0 0 Potri.010G195200.1.v4.1 1773 1593.21 16 0.944636 Potri.012G127500.1.v4.1 977 797.212 671 79.1709 ==> SRR28623232.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1167 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 288 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 43 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR28623232 completed mapping pipeline successfully