Starting /dee2/code/volunteer_pipeline.sh SRR28623233 current disk space = 3051703123968 free memory = 1579818824 SRR28623233 SRAfilesize 5dbd68778e9c399a600cd02fa8f0c243 SRR28623233.sra SRR28623233.sra file validated SRR28623233 is paired end SRR28623233 is conventional basespace SRR28623233 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623233_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4475 37.0 37.0 37.0 37.0 37.0 2 36.4405 37.0 37.0 37.0 37.0 37.0 3 36.642 37.0 37.0 37.0 37.0 37.0 4 36.604 37.0 37.0 37.0 37.0 37.0 5 36.6705 37.0 37.0 37.0 37.0 37.0 6 36.639 37.0 37.0 37.0 37.0 37.0 7 36.4955 37.0 37.0 37.0 37.0 37.0 8 36.505 37.0 37.0 37.0 37.0 37.0 9 36.5785 37.0 37.0 37.0 37.0 37.0 10-14 36.6014 37.0 37.0 37.0 37.0 37.0 15-19 36.55069999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.5399 37.0 37.0 37.0 37.0 37.0 25-29 36.509899999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.4341 37.0 37.0 37.0 37.0 37.0 35-39 36.3974 37.0 37.0 37.0 37.0 37.0 40-44 36.3951 37.0 37.0 37.0 37.0 37.0 45-49 36.316500000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.2929 37.0 37.0 37.0 37.0 37.0 55-59 36.2762 37.0 37.0 37.0 37.0 37.0 60-64 36.28269999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.2332 37.0 37.0 37.0 37.0 37.0 70-74 36.180899999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.133599999999994 37.0 37.0 37.0 37.0 37.0 80-84 36.0686 37.0 37.0 37.0 37.0 37.0 85-89 36.095600000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.0172 37.0 37.0 37.0 37.0 37.0 95-99 35.8996 37.0 37.0 37.0 37.0 37.0 100-104 36.032799999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.9358 37.0 37.0 37.0 37.0 37.0 110-114 35.90859999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.881299999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.7858 37.0 37.0 37.0 37.0 37.0 125-129 35.6798 37.0 37.0 37.0 37.0 37.0 130-134 35.8032 37.0 37.0 37.0 37.0 37.0 135-139 35.61750000000001 37.0 37.0 37.0 37.0 37.0 140-144 35.3103 37.0 37.0 37.0 37.0 37.0 145-149 35.2162 37.0 37.0 37.0 29.8 37.0 150-151 34.986999999999995 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 4.0 24 5.0 25 5.0 26 7.0 27 10.0 28 20.0 29 22.0 30 22.0 31 45.0 32 57.0 33 84.0 34 148.0 35 388.0 36 2942.0 37 240.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.55967903711134 13.7913741223671 8.049147442326982 41.599799398194584 2 18.825 15.45 37.025000000000006 28.7 3 19.125 17.95 27.925 35.0 4 23.775 27.825 23.35 25.05 5 25.8 32.225 24.5 17.474999999999998 6 19.5 37.7 22.475 20.325 7 15.925 27.825 40.25 16.0 8 16.75 26.650000000000002 32.25 24.349999999999998 9 18.6 22.95 32.75 25.7 10-14 19.86 29.955 27.395000000000003 22.79 15-19 20.4 28.199999999999996 27.71 23.69 20-24 20.135 28.925 27.150000000000002 23.79 25-29 19.59 29.205 27.655 23.549999999999997 30-34 19.6 29.225 27.32 23.855 35-39 20.035 28.395 27.944999999999997 23.625 40-44 20.745 28.325 27.26 23.669999999999998 45-49 20.349999999999998 29.025000000000002 27.62 23.005 50-54 20.599999999999998 28.325 28.095 22.98 55-59 20.28 28.199999999999996 27.765 23.755000000000003 60-64 19.705000000000002 28.985 27.87 23.44 65-69 20.015 29.04 27.689999999999998 23.255 70-74 19.994999999999997 28.93 27.134999999999998 23.94 75-79 20.505000000000003 28.349999999999998 27.46 23.685000000000002 80-84 20.09 28.29 28.025 23.595 85-89 20.46 28.405 27.32 23.815 90-94 20.755000000000003 29.15 26.779999999999998 23.315 95-99 20.285 28.499999999999996 27.389999999999997 23.825 100-104 20.535 29.04 26.875 23.549999999999997 105-109 20.65 28.88 27.229999999999997 23.24 110-114 20.51 27.83 27.705000000000002 23.955000000000002 115-119 21.029999999999998 28.22 27.189999999999998 23.56 120-124 20.895 28.27 26.810000000000002 24.025 125-129 20.26 28.365000000000002 27.315 24.060000000000002 130-134 21.0 28.799999999999997 26.340000000000003 23.86 135-139 20.34 28.904999999999998 26.855 23.9 140-144 21.38 28.125 26.55 23.945 145-149 20.995 28.32 26.6 24.085 150-151 21.2375 28.6625 26.3125 23.7875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 1.0 19 1.0 20 0.5 21 2.0 22 3.5 23 3.5 24 1.5 25 3.0 26 6.0 27 5.0 28 10.0 29 15.0 30 20.5 31 26.0 32 34.5 33 48.5 34 70.5 35 86.0 36 84.0 37 97.5 38 129.5 39 169.0 40 191.5 41 203.0 42 228.5 43 253.0 44 284.0 45 283.5 46 242.0 47 224.0 48 219.0 49 193.0 50 174.0 51 154.5 52 123.5 53 106.5 54 75.5 55 45.5 56 43.5 57 37.0 58 21.0 59 15.0 60 14.5 61 11.5 62 7.0 63 6.0 64 6.0 65 4.5 66 4.5 67 2.5 68 1.5 69 2.5 70 1.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.575 #Duplication Level Percentage of deduplicated Percentage of total 1 86.57233612474732 74.95 2 11.695062084897488 20.25 3 1.3860814322841466 3.5999999999999996 4 0.34652035807103665 1.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.625 0.0 0.0 0.0 0.0 88-89 0.75 0.0 0.0 0.0 0.0 90-91 0.9375 0.0 0.0 0.0 0.0 92-93 1.075 0.0 0.0 0.0 0.0 94-95 1.3625 0.0 0.0 0.0 0.0 96-97 1.5375 0.0 0.0 0.0 0.0 98-99 1.7125 0.0 0.0 0.0 0.0 100-101 2.0999999999999996 0.0 0.0 0.0 0.0 102-103 2.575 0.0 0.0 0.0 0.0 104-105 2.8499999999999996 0.0 0.0 0.0 0.0 106-107 3.275 0.0 0.0 0.0 0.0 108-109 3.8125 0.0 0.0 0.0 0.0 110-111 4.300000000000001 0.0 0.0 0.0 0.0 112-113 4.7375 0.0 0.0 0.0 0.0 114-115 5.324999999999999 0.0 0.0 0.0 0.0 116-117 5.775 0.0 0.0 0.0 0.0 118-119 6.4 0.0 0.0 0.0 0.0 120-121 6.987500000000001 0.0 0.0 0.0 0.0 122-123 7.4125 0.0 0.0 0.0 0.0 124-125 7.9 0.0 0.0 0.0 0.0 126-127 8.6 0.0 0.0 0.0 0.0 128-129 9.2375 0.0 0.0 0.0 0.0 130-131 9.875 0.0 0.0 0.0 0.0 132-133 10.4125 0.0 0.0 0.0 0.0 134-135 11.3 0.0 0.0 0.0 0.0 136-137 12.05 0.0 0.0 0.0 0.0 138-139 12.649999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGGATT 10 0.006830828 145.0 2 GCACACG 45 1.0549343E-4 64.44444 145 >>END_MODULE SRR28623233 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623233_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.7775 37.0 37.0 37.0 37.0 37.0 2 36.278 37.0 37.0 37.0 37.0 37.0 3 36.206 37.0 37.0 37.0 37.0 37.0 4 36.15 37.0 37.0 37.0 37.0 37.0 5 36.4145 37.0 37.0 37.0 37.0 37.0 6 36.193 37.0 37.0 37.0 37.0 37.0 7 36.2365 37.0 37.0 37.0 37.0 37.0 8 36.18 37.0 37.0 37.0 37.0 37.0 9 36.2035 37.0 37.0 37.0 37.0 37.0 10-14 36.135000000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.122699999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.14960000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.088300000000004 37.0 37.0 37.0 37.0 37.0 30-34 35.9726 37.0 37.0 37.0 37.0 37.0 35-39 35.9355 37.0 37.0 37.0 37.0 37.0 40-44 35.9022 37.0 37.0 37.0 37.0 37.0 45-49 35.8775 37.0 37.0 37.0 37.0 37.0 50-54 35.88099999999999 37.0 37.0 37.0 37.0 37.0 55-59 35.7063 37.0 37.0 37.0 37.0 37.0 60-64 35.67 37.0 37.0 37.0 37.0 37.0 65-69 35.806799999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.772800000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.7452 37.0 37.0 37.0 37.0 37.0 80-84 35.5838 37.0 37.0 37.0 37.0 37.0 85-89 35.5697 37.0 37.0 37.0 37.0 37.0 90-94 35.577200000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.5465 37.0 37.0 37.0 37.0 37.0 100-104 35.4114 37.0 37.0 37.0 37.0 37.0 105-109 35.35029999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.424899999999994 37.0 37.0 37.0 37.0 37.0 115-119 35.3968 37.0 37.0 37.0 34.6 37.0 120-124 35.3644 37.0 37.0 37.0 34.6 37.0 125-129 34.8754 37.0 37.0 37.0 27.4 37.0 130-134 35.254999999999995 37.0 37.0 37.0 32.2 37.0 135-139 35.015499999999996 37.0 37.0 37.0 25.0 37.0 140-144 35.0053 37.0 37.0 37.0 25.0 37.0 145-149 34.963499999999996 37.0 37.0 37.0 25.0 37.0 150-151 34.6005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 6.0 14 7.0 15 3.0 16 5.0 17 2.0 18 4.0 19 3.0 20 5.0 21 7.0 22 3.0 23 7.0 24 7.0 25 8.0 26 10.0 27 15.0 28 22.0 29 28.0 30 24.0 31 43.0 32 69.0 33 111.0 34 230.0 35 690.0 36 2431.0 37 259.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.25 19.950000000000003 12.675 25.124999999999996 2 27.825 24.65 29.799999999999997 17.724999999999998 3 22.625 27.275 30.75 19.35 4 27.425 34.275 20.724999999999998 17.575 5 27.775 35.325 21.925 14.975 6 21.525 37.075 23.974999999999998 17.424999999999997 7 20.7 21.375 38.15 19.775000000000002 8 22.1 24.975 28.975 23.95 9 22.8 24.95 30.7 21.55 10-14 23.95 29.415000000000003 25.729999999999997 20.905 15-19 23.715 27.63 27.515 21.14 20-24 23.89 28.660000000000004 27.125 20.325 25-29 23.7 28.139999999999997 27.735 20.424999999999997 30-34 23.39 28.455000000000002 27.62 20.535 35-39 23.35 28.405 27.67 20.575 40-44 23.195 28.185 27.905 20.715 45-49 23.24 28.144999999999996 28.175 20.44 50-54 23.385 27.944999999999997 28.585 20.085 55-59 23.82 28.76 27.365000000000002 20.055 60-64 23.380000000000003 28.189999999999998 28.18 20.25 65-69 23.46 27.275 28.57 20.695 70-74 23.51 28.34 27.950000000000003 20.200000000000003 75-79 23.095 28.599999999999998 27.560000000000002 20.745 80-84 23.7 27.950000000000003 28.015 20.335 85-89 24.415 27.944999999999997 27.465 20.175 90-94 23.47 28.16 28.000000000000004 20.369999999999997 95-99 23.53 27.755000000000003 28.24 20.474999999999998 100-104 23.94 27.91 27.944999999999997 20.205000000000002 105-109 24.23 28.825 27.02 19.925 110-114 23.825 28.34 27.384999999999998 20.45 115-119 24.65 27.715 27.76 19.875 120-124 25.295 28.499999999999996 27.195000000000004 19.009999999999998 125-129 25.224999999999998 28.76 26.56 19.455 130-134 25.165 28.389999999999997 26.915 19.53 135-139 25.575 28.645 26.565 19.215 140-144 25.665 28.285 26.57 19.48 145-149 26.169999999999998 28.044999999999998 26.51 19.275000000000002 150-151 25.8625 27.5625 27.125 19.45 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 1.5 14 1.0 15 0.5 16 0.5 17 0.0 18 0.5 19 1.0 20 1.5 21 3.5 22 4.0 23 2.0 24 1.5 25 3.5 26 8.5 27 9.0 28 7.0 29 9.0 30 15.5 31 21.5 32 30.0 33 45.5 34 53.5 35 64.0 36 82.0 37 105.5 38 139.0 39 191.5 40 212.0 41 224.0 42 245.5 43 250.0 44 264.0 45 272.0 46 249.0 47 236.0 48 236.0 49 197.0 50 168.5 51 151.0 52 116.0 53 77.0 54 61.0 55 52.0 56 35.0 57 30.5 58 24.5 59 17.0 60 11.0 61 6.5 62 7.0 63 7.5 64 5.5 65 4.0 66 3.5 67 3.0 68 2.0 69 0.5 70 1.0 71 0.5 72 1.0 73 1.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.5 80 1.0 81 1.0 82 1.0 83 0.5 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 1.5 93 1.5 94 0.0 95 0.0 96 0.5 97 0.5 98 0.5 99 1.5 100 5.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 87.03061813980358 75.325 2 11.091854419410744 19.2 3 1.5020219526285385 3.9 4 0.34662045060658575 1.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.028885037550548814 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 15 0.375 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.625 0.0 0.0 0.0 0.0 88-89 0.75 0.0 0.0 0.0 0.0 90-91 0.9624999999999999 0.0 0.0 0.0 0.0 92-93 1.1124999999999998 0.0 0.0 0.0 0.0 94-95 1.4125 0.0 0.0 0.0 0.0 96-97 1.5875 0.0 0.0 0.0 0.0 98-99 1.7625000000000002 0.0 0.0 0.0 0.0 100-101 2.125 0.0 0.0 0.0 0.0 102-103 2.6375 0.0 0.0 0.0 0.0 104-105 2.925 0.0 0.0 0.0 0.0 106-107 3.35 0.0 0.0 0.0 0.0 108-109 3.8875 0.0 0.0 0.0 0.0 110-111 4.375 0.0 0.0 0.0 0.0 112-113 4.824999999999999 0.0 0.0 0.0 0.0 114-115 5.425000000000001 0.0 0.0 0.0 0.0 116-117 5.85 0.0 0.0 0.0 0.0 118-119 6.475 0.0 0.0 0.0 0.0 120-121 7.05 0.0 0.0 0.0 0.0 122-123 7.4625 0.0 0.0 0.0 0.0 124-125 7.9125 0.0 0.0 0.0 0.0 126-127 8.625 0.0 0.0 0.0 0.0 128-129 9.225000000000001 0.0 0.0 0.0 0.0 130-131 9.85 0.0 0.0 0.0 0.0 132-133 10.3875 0.0 0.0 0.0 0.0 134-135 11.275 0.0 0.0 0.0 0.0 136-137 12.025 0.0 0.0 0.0 0.0 138-139 12.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACTGGA 10 0.006830828 145.0 5 ATTTCAT 10 0.006830828 145.0 4 GCGTCGT 45 1.0549343E-4 64.44444 145 >>END_MODULE Read 1599523 spots for SRR28623233.sra Written 1599523 spots for SRR28623233.sra Read 1599523 spots for SRR28623233.sra Written 1599523 spots for SRR28623233.sra Read 1599523 spots for SRR28623233.sra Written 1599523 spots for SRR28623233.sra Read 1599523 spots for SRR28623233.sra Written 1599523 spots for SRR28623233.sra Read 1599523 spots for SRR28623233.sra Written 1599523 spots for SRR28623233.sra Read 1599523 spots for SRR28623233.sra Written 1599523 spots for SRR28623233.sra Read 1599523 spots for SRR28623233.sra Written 1599523 spots for SRR28623233.sra Read 1599523 spots for SRR28623233.sra Written 1599523 spots for SRR28623233.sra Read 1599523 spots for SRR28623233.sra Written 1599523 spots for SRR28623233.sra Read 1599523 spots for SRR28623233.sra Written 1599523 spots for SRR28623233.sra Read 1599523 spots for SRR28623233.sra Written 1599523 spots for SRR28623233.sra Read 1599523 spots for SRR28623233.sra Written 1599523 spots for SRR28623233.sra Read 1599523 spots for SRR28623233.sra Written 1599523 spots for SRR28623233.sra Read 1599523 spots for SRR28623233.sra Written 1599523 spots for SRR28623233.sra Read 1599523 spots for SRR28623233.sra Written 1599523 spots for SRR28623233.sra Read 1599523 spots for SRR28623233.sra Written 1599523 spots for SRR28623233.sra Read 1599523 spots for SRR28623233.sra Written 1599523 spots for SRR28623233.sra Read 1599523 spots for SRR28623233.sra Written 1599523 spots for SRR28623233.sra Read 1599523 spots for SRR28623233.sra Written 1599523 spots for SRR28623233.sra Read 1599541 spots for SRR28623233.sra Written 1599541 spots for SRR28623233.sra SRR ids: ['SRR28623233.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j4vzupil SRR28623233.sra spots: 31990478 blocks: [[1, 1599523], [1599524, 3199046], [3199047, 4798569], [4798570, 6398092], [6398093, 7997615], [7997616, 9597138], [9597139, 11196661], [11196662, 12796184], [12796185, 14395707], [14395708, 15995230], [15995231, 17594753], [17594754, 19194276], [19194277, 20793799], [20793800, 22393322], [22393323, 23992845], [23992846, 25592368], [25592369, 27191891], [27191892, 28791414], [28791415, 30390937], [30390938, 31990478]] SRR28623233 file size 11812663 SRR28623233 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623233 SRR28623233_1.fastq SRR28623233_2.fastq Input file: SRR28623233_1.fastq Paired file: SRR28623233_2.fastq trimmed: SRR28623233-trimmed-pair1.fastq, SRR28623233-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 11:35:28 2025 >> started Tue Feb 11 11:36:05 2025 >> done (37.059s) 31990478 read pairs processed; of these: 28 ( 0.00%) short read pairs filtered out after trimming by size control 6290 ( 0.02%) empty read pairs filtered out after trimming by size control 31984160 (99.98%) read pairs available; of these: 5709898 (17.85%) trimmed read pairs available after processing 26274262 (82.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 4 0.00% 21 5 0.00% 22 4 0.00% 23 4 0.00% 24 2 0.00% 25 8 0.00% 26 6 0.00% 27 1 0.00% 28 11 0.00% 29 16 0.00% 30 17 0.00% 31 14 0.00% 32 13 0.00% 33 15 0.00% 34 22 0.00% 35 23 0.00% 36 19 0.00% 37 24 0.00% 38 38 0.00% 39 46 0.00% 40 54 0.00% 41 38 0.00% 42 51 0.00% 43 81 0.00% 44 86 0.00% 45 69 0.00% 46 88 0.00% 47 112 0.00% 48 134 0.00% 49 183 0.00% 50 206 0.00% 51 223 0.00% 52 266 0.00% 53 290 0.00% 54 335 0.00% 55 382 0.00% 56 424 0.00% 57 465 0.00% 58 650 0.00% 59 638 0.00% 60 755 0.00% 61 898 0.00% 62 1062 0.00% 63 1178 0.00% 64 1462 0.00% 65 1579 0.00% 66 1812 0.01% 67 2036 0.01% 68 2315 0.01% 69 2670 0.01% 70 3235 0.01% 71 3544 0.01% 72 4285 0.01% 73 4764 0.01% 74 5565 0.02% 75 6187 0.02% 76 6902 0.02% 77 7628 0.02% 78 8562 0.03% 79 9784 0.03% 80 10600 0.03% 81 11881 0.04% 82 13387 0.04% 83 15058 0.05% 84 16643 0.05% 85 18630 0.06% 86 19887 0.06% 87 21711 0.07% 88 23596 0.07% 89 25354 0.08% 90 27017 0.08% 91 29250 0.09% 92 31378 0.10% 93 33771 0.11% 94 36511 0.11% 95 39145 0.12% 96 41393 0.13% 97 43916 0.14% 98 46302 0.14% 99 48496 0.15% 100 50213 0.16% 101 52295 0.16% 102 54755 0.17% 103 57496 0.18% 104 59650 0.19% 105 62584 0.20% 106 66379 0.21% 107 68109 0.21% 108 69795 0.22% 109 72709 0.23% 110 73708 0.23% 111 75095 0.23% 112 78117 0.24% 113 79120 0.25% 114 82521 0.26% 115 85650 0.27% 116 86553 0.27% 117 89202 0.28% 118 91538 0.29% 119 93209 0.29% 120 94820 0.30% 121 96561 0.30% 122 97571 0.31% 123 99363 0.31% 124 102056 0.32% 125 103203 0.32% 126 105230 0.33% 127 107770 0.34% 128 109270 0.34% 129 110695 0.35% 130 112722 0.35% 131 113083 0.35% 132 114393 0.36% 133 116061 0.36% 134 116537 0.36% 135 117879 0.37% 136 119344 0.37% 137 121636 0.38% 138 122580 0.38% 139 124567 0.39% 140 124526 0.39% 141 126304 0.39% 142 127040 0.40% 143 126932 0.40% 144 128580 0.40% 145 129369 0.40% 146 129211 0.40% 147 130105 0.41% 148 132300 0.41% 149 132622 0.41% 150 133650 0.42% 151 26274262 82.15% 31984160 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=12.06 fanout-score-rank=14 prefix-density=0.11 prefix-fanout=12.1 sequence=GGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCACAGCAATCTCGTATGCCGTCTT criterion=fanout-score sequence-density=0.06 sequence-density-rank=21 fanout-score=298.48 fanout-score-rank=1 prefix-density=1.00 prefix-fanout=18.5 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=38 prefix-density=0.11 prefix-fanout=2.0 sequence=CCAGACCAGCAGAGG criterion=fanout-score sequence-density=0.07 sequence-density-rank=14 fanout-score=337.25 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=25.6 sequence=AAGAAGAAGAAA SRR28623233 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 11:36:49 Started mapping on | Feb 11 11:36:49 Finished on | Feb 11 11:40:02 Mapping speed, Million of reads per hour | 596.60 Number of input reads | 31984160 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 30094734 Uniquely mapped reads % | 94.09% Average mapped length | 290.81 Number of splices: Total | 27001600 Number of splices: Annotated (sjdb) | 26386632 Number of splices: GT/AG | 26539946 Number of splices: GC/AG | 358206 Number of splices: AT/AC | 26800 Number of splices: Non-canonical | 76648 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 3.00 Insertion rate per base | 0.03% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 724787 % of reads mapped to multiple loci | 2.27% Number of reads mapped to too many loci | 137049 % of reads mapped to too many loci | 0.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.01% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1164639 1164639 1164639 N_multimapping 724787 724787 724787 N_noFeature 1276843 29691484 1486380 N_ambiguous 366975 2533 171439 UnstrandedReadsAssigned:28450916 PositiveStrandReadsAssigned:400717 NegativeStrandReadsAssigned:28436915 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623233 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623233-trimmed-pair1.fastq SRR28623233-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,984,160 reads, 28,824,894 reads pseudoaligned [quant] estimated average fragment length: 220.546 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,153 rounds 52401 SRR28623233.ke.tsv 34699 SRR28623233.se.tsv 87100 total ==> SRR28623233.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1798.45 1234 25.0299 Potri.005G024800.1.v4.1 1035 815.454 1247 55.7841 Potri.004G059700.1.v4.1 961 741.459 87 4.28031 Potri.007G009000.2.v4.1 1416 1196.45 0 0 Potri.003G141000.2.v4.1 2943 2723.45 926.343 12.4078 Potri.016G087400.1.v4.1 270 96.0298 1792.06 680.754 Potri.015G069301.1.v4.1 564 348.782 0 0 Potri.010G195200.1.v4.1 1773 1553.45 164 3.85114 Potri.012G127500.1.v4.1 977 757.454 9295 447.648 ==> SRR28623233.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1081 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 563 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR28623233 completed mapping pipeline successfully