Starting /dee2/code/volunteer_pipeline.sh SRR28623234 current disk space = 3052637741056 free memory = 1482109496 SRR28623234 SRAfilesize 9afb3b121a6b4754390381a12ec3dc46 SRR28623234.sra SRR28623234.sra file validated SRR28623234 is paired end SRR28623234 is conventional basespace SRR28623234 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623234_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.388 37.0 37.0 37.0 37.0 37.0 2 36.4565 37.0 37.0 37.0 37.0 37.0 3 36.684 37.0 37.0 37.0 37.0 37.0 4 36.7405 37.0 37.0 37.0 37.0 37.0 5 36.724 37.0 37.0 37.0 37.0 37.0 6 36.7485 37.0 37.0 37.0 37.0 37.0 7 36.642 37.0 37.0 37.0 37.0 37.0 8 36.4385 37.0 37.0 37.0 37.0 37.0 9 36.587 37.0 37.0 37.0 37.0 37.0 10-14 36.628299999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.6172 37.0 37.0 37.0 37.0 37.0 20-24 36.5897 37.0 37.0 37.0 37.0 37.0 25-29 36.544200000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.539 37.0 37.0 37.0 37.0 37.0 35-39 36.5465 37.0 37.0 37.0 37.0 37.0 40-44 36.4587 37.0 37.0 37.0 37.0 37.0 45-49 36.346900000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.3208 37.0 37.0 37.0 37.0 37.0 55-59 36.1999 37.0 37.0 37.0 37.0 37.0 60-64 36.2222 37.0 37.0 37.0 37.0 37.0 65-69 36.1487 37.0 37.0 37.0 37.0 37.0 70-74 36.1295 37.0 37.0 37.0 37.0 37.0 75-79 36.203199999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.102599999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.089 37.0 37.0 37.0 37.0 37.0 90-94 36.1056 37.0 37.0 37.0 37.0 37.0 95-99 35.9512 37.0 37.0 37.0 37.0 37.0 100-104 36.0433 37.0 37.0 37.0 37.0 37.0 105-109 35.988899999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.8825 37.0 37.0 37.0 37.0 37.0 115-119 35.851 37.0 37.0 37.0 37.0 37.0 120-124 35.7903 37.0 37.0 37.0 37.0 37.0 125-129 35.7389 37.0 37.0 37.0 37.0 37.0 130-134 35.832800000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.7047 37.0 37.0 37.0 37.0 37.0 140-144 35.4218 37.0 37.0 37.0 37.0 37.0 145-149 35.3676 37.0 37.0 37.0 34.6 37.0 150-151 35.23775 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 4.0 25 6.0 26 9.0 27 10.0 28 9.0 29 14.0 30 30.0 31 33.0 32 61.0 33 106.0 34 146.0 35 375.0 36 2904.0 37 292.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 27.56024096385542 10.843373493975903 14.78413654618474 46.812248995983936 2 17.05 16.75 35.949999999999996 30.25 3 18.05 17.599999999999998 26.474999999999998 37.875 4 21.25 27.775 22.325 28.65 5 23.7 32.574999999999996 23.150000000000002 20.575 6 21.5 34.35 25.275 18.875 7 14.674999999999999 28.65 41.525 15.15 8 18.65 27.200000000000003 31.85 22.3 9 17.9 23.799999999999997 35.175 23.125 10-14 19.29 30.605 27.455000000000002 22.650000000000002 15-19 19.555 27.725 28.395 24.325 20-24 19.965 29.645 27.77 22.62 25-29 19.384999999999998 29.035 27.99 23.59 30-34 19.59 29.03 27.675 23.705000000000002 35-39 19.900000000000002 28.945 27.994999999999997 23.16 40-44 19.42 28.99 28.275 23.315 45-49 19.384999999999998 28.77 28.050000000000004 23.794999999999998 50-54 19.75 28.065 28.175 24.01 55-59 19.245 28.88 27.894999999999996 23.98 60-64 19.794999999999998 28.244999999999997 28.075 23.885 65-69 19.675 28.615000000000002 28.37 23.34 70-74 20.39 27.755000000000003 28.32 23.535 75-79 20.195 28.444999999999997 27.250000000000004 24.11 80-84 20.974999999999998 29.099999999999998 26.895000000000003 23.03 85-89 21.04 29.459999999999997 26.8 22.7 90-94 20.919999999999998 28.52 27.13 23.43 95-99 20.544999999999998 28.65 27.73 23.075000000000003 100-104 20.880000000000003 28.754999999999995 27.425 22.939999999999998 105-109 20.735 28.42 26.895000000000003 23.95 110-114 21.78 28.37 26.840000000000003 23.01 115-119 21.04 28.7 27.525 22.735 120-124 21.4 27.96 27.060000000000002 23.580000000000002 125-129 21.32 27.925 27.175 23.580000000000002 130-134 21.335 28.910000000000004 26.515 23.24 135-139 22.33 27.665 26.38 23.625 140-144 21.84 27.26 27.165 23.735 145-149 22.105 27.675 26.369999999999997 23.849999999999998 150-151 22.2625 27.1375 26.224999999999998 24.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.5 21 2.5 22 1.5 23 0.5 24 1.5 25 3.5 26 4.5 27 7.5 28 12.5 29 18.0 30 25.0 31 32.0 32 52.0 33 56.5 34 51.5 35 69.5 36 107.0 37 125.5 38 133.0 39 171.0 40 191.5 41 212.0 42 260.0 43 275.0 44 250.5 45 252.0 46 260.5 47 247.0 48 227.5 49 198.5 50 160.5 51 128.0 52 103.0 53 79.5 54 58.5 55 46.0 56 38.5 57 26.0 58 19.5 59 11.5 60 5.5 61 5.5 62 7.5 63 6.0 64 3.5 65 8.5 66 12.5 67 10.0 68 5.5 69 4.5 70 3.0 71 1.5 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.075 #Duplication Level Percentage of deduplicated Percentage of total 1 85.13232233125187 71.575 2 12.042818911685995 20.25 3 2.31935771632471 5.8500000000000005 4 0.35682426404995543 1.2 5 0.11894142134998512 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02973535533749628 0.625 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTTGAGTATCTCGTAT 25 0.625 TruSeq Adapter, Index 2 (97% over 38bp) CAACAAGTAGACAAGTAGTACAAAGTGCAGTAAATATGAAGGCAAAATGA 5 0.125 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTTGAGTATCGCGTAT 5 0.125 TruSeq Adapter, Index 2 (97% over 38bp) CCCGTTTCATGGCACCTTTGAGGAAAGGGTCATGCAATCCGTACACGTTA 5 0.125 No Hit TAGGGAATGTCTCAGTTCCAACACGATTGATTGACCCAACAAAGTAGCTG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.275 0.0 0.0 0.0 0.0 74-75 0.3125 0.0 0.0 0.0 0.0 76-77 0.325 0.0 0.0 0.0 0.0 78-79 0.4625 0.0 0.0 0.0 0.0 80-81 0.5875 0.0 0.0 0.0 0.0 82-83 0.625 0.0 0.0 0.0 0.0 84-85 0.6875 0.0 0.0 0.0 0.0 86-87 0.8625 0.0 0.0 0.0 0.0 88-89 1.0375 0.0 0.0 0.0 0.0 90-91 1.25 0.0 0.0 0.0 0.0 92-93 1.45 0.0 0.0 0.0 0.0 94-95 1.6625 0.0 0.0 0.0 0.0 96-97 1.8125 0.0 0.0 0.0 0.0 98-99 2.1125 0.0 0.0 0.0 0.0 100-101 2.425 0.0 0.0 0.0 0.0 102-103 2.7249999999999996 0.0 0.0 0.0 0.0 104-105 3.0999999999999996 0.0 0.0 0.0 0.0 106-107 3.375 0.0 0.0 0.0 0.0 108-109 4.0 0.0 0.0 0.0 0.0 110-111 4.6125 0.0 0.0 0.0 0.0 112-113 5.15 0.0 0.0 0.0 0.0 114-115 5.4375 0.0 0.0 0.0 0.0 116-117 5.8125 0.0 0.0 0.0 0.0 118-119 6.300000000000001 0.0 0.0 0.0 0.0 120-121 6.6875 0.0 0.0 0.0 0.0 122-123 7.2125 0.0 0.0 0.0 0.0 124-125 8.05 0.0 0.0 0.0 0.0 126-127 8.575 0.0 0.0 0.0 0.0 128-129 8.975000000000001 0.0 0.0 0.0 0.0 130-131 9.7 0.0 0.0 0.0 0.0 132-133 10.425 0.0 0.0 0.0 0.0 134-135 11.0125 0.0 0.0 0.0 0.0 136-137 11.8 0.0 0.0 0.0 0.0 138-139 12.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGAAGA 10 0.006830828 145.0 3 TCAGATC 10 0.006830828 145.0 145 CACTCTT 10 0.006830828 145.0 4 >>END_MODULE SRR28623234 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623234_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.7335 37.0 37.0 37.0 37.0 37.0 2 36.306 37.0 37.0 37.0 37.0 37.0 3 36.0285 37.0 37.0 37.0 37.0 37.0 4 36.084 37.0 37.0 37.0 37.0 37.0 5 36.2505 37.0 37.0 37.0 37.0 37.0 6 36.243 37.0 37.0 37.0 37.0 37.0 7 36.283 37.0 37.0 37.0 37.0 37.0 8 36.028 37.0 37.0 37.0 37.0 37.0 9 35.982 37.0 37.0 37.0 37.0 37.0 10-14 35.9663 37.0 37.0 37.0 37.0 37.0 15-19 35.9045 37.0 37.0 37.0 37.0 37.0 20-24 35.9691 37.0 37.0 37.0 37.0 37.0 25-29 35.8024 37.0 37.0 37.0 37.0 37.0 30-34 35.725 37.0 37.0 37.0 37.0 37.0 35-39 35.7298 37.0 37.0 37.0 37.0 37.0 40-44 35.6601 37.0 37.0 37.0 37.0 37.0 45-49 35.712900000000005 37.0 37.0 37.0 37.0 37.0 50-54 35.6474 37.0 37.0 37.0 37.0 37.0 55-59 35.4996 37.0 37.0 37.0 37.0 37.0 60-64 35.5346 37.0 37.0 37.0 37.0 37.0 65-69 35.55009999999999 37.0 37.0 37.0 37.0 37.0 70-74 35.6113 37.0 37.0 37.0 37.0 37.0 75-79 35.559400000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.439499999999995 37.0 37.0 37.0 37.0 37.0 85-89 35.406800000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.331900000000005 37.0 37.0 37.0 34.6 37.0 95-99 35.372 37.0 37.0 37.0 34.6 37.0 100-104 35.300799999999995 37.0 37.0 37.0 32.2 37.0 105-109 35.2385 37.0 37.0 37.0 34.6 37.0 110-114 35.3969 37.0 37.0 37.0 34.6 37.0 115-119 35.338499999999996 37.0 37.0 37.0 34.6 37.0 120-124 35.2864 37.0 37.0 37.0 34.6 37.0 125-129 34.6769 37.0 37.0 37.0 25.0 37.0 130-134 35.1245 37.0 37.0 37.0 25.0 37.0 135-139 34.892199999999995 37.0 37.0 37.0 25.0 37.0 140-144 34.9555 37.0 37.0 37.0 25.0 37.0 145-149 34.76610000000001 37.0 37.0 37.0 25.0 37.0 150-151 34.449 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 10.0 15 4.0 16 3.0 17 4.0 18 4.0 19 2.0 20 3.0 21 9.0 22 14.0 23 6.0 24 17.0 25 15.0 26 10.0 27 15.0 28 10.0 29 24.0 30 32.0 31 49.0 32 76.0 33 135.0 34 283.0 35 735.0 36 2322.0 37 213.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.175 18.325 21.575 31.924999999999997 2 27.825 22.75 32.324999999999996 17.1 3 22.775000000000002 26.650000000000002 30.2 20.375 4 23.45 31.324999999999996 26.525 18.7 5 26.375 34.5 23.200000000000003 15.925 6 21.525 36.475 23.799999999999997 18.2 7 21.075 19.425 38.875 20.625 8 22.400000000000002 24.725 27.900000000000002 24.975 9 23.1 24.65 29.375 22.875 10-14 24.36 28.904999999999998 25.525 21.21 15-19 22.985 27.375 28.565 21.075 20-24 23.669999999999998 27.529999999999998 28.275 20.525 25-29 23.605 27.845 27.58 20.97 30-34 23.1 28.16 28.134999999999998 20.605 35-39 23.549999999999997 28.560000000000002 27.98 19.91 40-44 23.345 28.42 28.12 20.115 45-49 23.39 28.345 28.110000000000003 20.155 50-54 23.885 28.665000000000003 27.339999999999996 20.11 55-59 23.294999999999998 28.494999999999997 27.85 20.36 60-64 23.830000000000002 27.884999999999998 28.08 20.205000000000002 65-69 23.64 28.09 28.46 19.81 70-74 23.830000000000002 28.435 28.035 19.7 75-79 23.28 28.634999999999998 27.88 20.205000000000002 80-84 23.24 28.43 28.265 20.064999999999998 85-89 24.325 27.77 28.04 19.865 90-94 24.395 28.244999999999997 27.839999999999996 19.52 95-99 24.29 28.305000000000003 27.544999999999998 19.86 100-104 24.88 27.935 27.365000000000002 19.82 105-109 24.64 27.529999999999998 28.48 19.35 110-114 25.055 27.29 27.905 19.75 115-119 25.174999999999997 28.475 26.474999999999998 19.875 120-124 25.61 28.21 26.86 19.32 125-129 25.27 28.305000000000003 27.339999999999996 19.085 130-134 26.145000000000003 28.63 26.584999999999997 18.64 135-139 26.32 27.905 27.134999999999998 18.64 140-144 26.724999999999998 27.72 26.795 18.759999999999998 145-149 27.865000000000002 27.384999999999998 26.495 18.255 150-151 26.875 27.1125 28.012500000000003 18.0 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 2.5 15 0.5 16 1.0 17 1.5 18 1.5 19 1.5 20 0.5 21 1.0 22 2.5 23 2.0 24 2.5 25 6.5 26 8.0 27 12.0 28 13.0 29 15.5 30 17.5 31 20.0 32 32.5 33 46.0 34 59.0 35 69.0 36 89.0 37 116.5 38 145.5 39 170.0 40 208.5 41 245.5 42 268.0 43 271.0 44 254.0 45 242.0 46 242.0 47 249.0 48 223.5 49 184.5 50 146.5 51 126.0 52 113.5 53 82.0 54 59.5 55 47.0 56 35.5 57 27.5 58 22.0 59 17.0 60 12.0 61 8.0 62 8.5 63 8.5 64 6.0 65 3.0 66 2.5 67 3.0 68 2.5 69 2.0 70 1.0 71 2.5 72 2.5 73 2.0 74 3.5 75 3.0 76 1.5 77 2.0 78 3.0 79 1.5 80 0.5 81 1.5 82 2.5 83 1.5 84 0.0 85 0.0 86 0.0 87 1.0 88 1.5 89 1.5 90 1.0 91 0.5 92 0.5 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.475 #Duplication Level Percentage of deduplicated Percentage of total 1 86.25329043579994 73.725 2 11.114360924246856 19.0 3 2.222872184849371 5.7 4 0.2924831822170225 1.0 5 0.08774495466510676 0.375 6 0.0 0.0 7 0.0 0.0 8 0.029248318221702253 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit AGATAATTGATTGAAAAGACGGATATTGTTATTTGGATCTTGATTCAATG 5 0.125 No Hit GTGACATTATCGTATGCTTGTTAACACAGTTGTTGATACTTTGTCATCAC 5 0.125 No Hit TCACAAGCACCCCATTAAGATCGAAAATCATAGCCGTCCATCTTGCATAC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.25 0.0 0.0 0.0 0.0 74-75 0.30000000000000004 0.0 0.0 0.0 0.0 76-77 0.325 0.0 0.0 0.0 0.0 78-79 0.4625 0.0 0.0 0.0 0.0 80-81 0.5875 0.0 0.0 0.0 0.0 82-83 0.625 0.0 0.0 0.0 0.0 84-85 0.6875 0.0 0.0 0.0 0.0 86-87 0.8625 0.0 0.0 0.0 0.0 88-89 1.025 0.0 0.0 0.0 0.0 90-91 1.225 0.0 0.0 0.0 0.0 92-93 1.425 0.0 0.0 0.0 0.0 94-95 1.6375000000000002 0.0 0.0 0.0 0.0 96-97 1.7875 0.0 0.0 0.0 0.0 98-99 2.1 0.0 0.0 0.0 0.0 100-101 2.4000000000000004 0.0 0.0 0.0 0.0 102-103 2.7 0.0 0.0 0.0 0.0 104-105 3.075 0.0 0.0 0.0 0.0 106-107 3.375 0.0 0.0 0.0 0.0 108-109 4.0375 0.0 0.0 0.0 0.0 110-111 4.6625 0.0 0.0 0.0 0.0 112-113 5.2 0.0 0.0 0.0 0.0 114-115 5.4875 0.0 0.0 0.0 0.0 116-117 5.8625 0.0 0.0 0.0 0.0 118-119 6.324999999999999 0.0 0.0 0.0 0.0 120-121 6.725 0.0 0.0 0.0 0.0 122-123 7.262499999999999 0.0 0.0 0.0 0.0 124-125 8.149999999999999 0.0 0.0 0.0 0.0 126-127 8.725000000000001 0.0 0.0 0.0 0.0 128-129 9.125 0.0 0.0 0.0 0.0 130-131 9.850000000000001 0.0 0.0 0.0 0.0 132-133 10.6125 0.0 0.0 0.0 0.0 134-135 11.225 0.0 0.0 0.0 0.0 136-137 11.9875 0.0 0.0 0.0 0.0 138-139 12.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGAACA 10 0.006830828 145.0 6 GTCCAGG 10 0.006830828 145.0 8 >>END_MODULE Read 2049653 spots for SRR28623234.sra Written 2049653 spots for SRR28623234.sra Read 2049653 spots for SRR28623234.sra Written 2049653 spots for SRR28623234.sra Read 2049653 spots for SRR28623234.sra Written 2049653 spots for SRR28623234.sra Read 2049653 spots for SRR28623234.sra Written 2049653 spots for SRR28623234.sra Read 2049653 spots for SRR28623234.sra Written 2049653 spots for SRR28623234.sra Read 2049653 spots for SRR28623234.sra Written 2049653 spots for SRR28623234.sra Read 2049653 spots for SRR28623234.sra Written 2049653 spots for SRR28623234.sra Read 2049653 spots for SRR28623234.sra Written 2049653 spots for SRR28623234.sra Read 2049653 spots for SRR28623234.sra Written 2049653 spots for SRR28623234.sra Read 2049653 spots for SRR28623234.sra Written 2049653 spots for SRR28623234.sra Read 2049653 spots for SRR28623234.sra Written 2049653 spots for SRR28623234.sra Read 2049653 spots for SRR28623234.sra Written 2049653 spots for SRR28623234.sra Read 2049659 spots for SRR28623234.sra Written 2049659 spots for SRR28623234.sra Read 2049653 spots for SRR28623234.sra Written 2049653 spots for SRR28623234.sra Read 2049653 spots for SRR28623234.sra Written 2049653 spots for SRR28623234.sra Read 2049653 spots for SRR28623234.sra Written 2049653 spots for SRR28623234.sra Read 2049653 spots for SRR28623234.sra Written 2049653 spots for SRR28623234.sra Read 2049653 spots for SRR28623234.sra Written 2049653 spots for SRR28623234.sra Read 2049653 spots for SRR28623234.sra Written 2049653 spots for SRR28623234.sra Read 2049653 spots for SRR28623234.sra Written 2049653 spots for SRR28623234.sra SRR ids: ['SRR28623234.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ubn1cnxm SRR28623234.sra spots: 40993066 blocks: [[1, 2049653], [2049654, 4099306], [4099307, 6148959], [6148960, 8198612], [8198613, 10248265], [10248266, 12297918], [12297919, 14347571], [14347572, 16397224], [16397225, 18446877], [18446878, 20496530], [20496531, 22546183], [22546184, 24595836], [24595837, 26645489], [26645490, 28695142], [28695143, 30744795], [30744796, 32794448], [32794449, 34844101], [34844102, 36893754], [36893755, 38943407], [38943408, 40993066]] SRR28623234 file size 15139957 SRR28623234 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623234 SRR28623234_1.fastq SRR28623234_2.fastq Input file: SRR28623234_1.fastq Paired file: SRR28623234_2.fastq trimmed: SRR28623234-trimmed-pair1.fastq, SRR28623234-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 11:02:23 2025 >> started Tue Feb 11 11:03:10 2025 >> done (47.437s) 40993066 read pairs processed; of these: 55 ( 0.00%) short read pairs filtered out after trimming by size control 338585 ( 0.83%) empty read pairs filtered out after trimming by size control 40654426 (99.17%) read pairs available; of these: 6556086 (16.13%) trimmed read pairs available after processing 34098340 (83.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 11 0.00% 21 7 0.00% 22 9 0.00% 23 12 0.00% 24 12 0.00% 25 9 0.00% 26 24 0.00% 27 25 0.00% 28 26 0.00% 29 20 0.00% 30 31 0.00% 31 49 0.00% 32 40 0.00% 33 53 0.00% 34 57 0.00% 35 62 0.00% 36 75 0.00% 37 88 0.00% 38 166 0.00% 39 116 0.00% 40 185 0.00% 41 117 0.00% 42 155 0.00% 43 185 0.00% 44 200 0.00% 45 169 0.00% 46 212 0.00% 47 263 0.00% 48 306 0.00% 49 327 0.00% 50 400 0.00% 51 475 0.00% 52 509 0.00% 53 634 0.00% 54 710 0.00% 55 761 0.00% 56 822 0.00% 57 967 0.00% 58 1155 0.00% 59 1283 0.00% 60 1633 0.00% 61 1719 0.00% 62 2132 0.01% 63 2474 0.01% 64 3259 0.01% 65 3093 0.01% 66 3374 0.01% 67 3829 0.01% 68 4336 0.01% 69 4824 0.01% 70 5719 0.01% 71 6604 0.02% 72 7720 0.02% 73 8830 0.02% 74 10004 0.02% 75 10909 0.03% 76 12185 0.03% 77 12942 0.03% 78 14105 0.03% 79 15748 0.04% 80 17405 0.04% 81 19225 0.05% 82 21366 0.05% 83 24131 0.06% 84 26220 0.06% 85 28568 0.07% 86 30125 0.07% 87 31517 0.08% 88 33598 0.08% 89 35816 0.09% 90 37749 0.09% 91 40010 0.10% 92 42504 0.10% 93 45080 0.11% 94 48847 0.12% 95 50646 0.12% 96 53427 0.13% 97 55407 0.14% 98 57039 0.14% 99 58860 0.14% 100 60498 0.15% 101 62361 0.15% 102 65757 0.16% 103 68815 0.17% 104 71539 0.18% 105 73644 0.18% 106 76512 0.19% 107 78365 0.19% 108 79152 0.19% 109 82223 0.20% 110 82929 0.20% 111 85309 0.21% 112 87828 0.22% 113 89681 0.22% 114 91752 0.23% 115 95709 0.24% 116 98331 0.24% 117 99781 0.25% 118 102230 0.25% 119 102731 0.25% 120 103770 0.26% 121 105761 0.26% 122 107974 0.27% 123 109461 0.27% 124 112726 0.28% 125 114561 0.28% 126 117654 0.29% 127 120138 0.30% 128 120813 0.30% 129 121445 0.30% 130 123635 0.30% 131 124756 0.31% 132 124690 0.31% 133 127097 0.31% 134 128294 0.32% 135 128592 0.32% 136 132648 0.33% 137 134703 0.33% 138 134890 0.33% 139 136997 0.34% 140 137472 0.34% 141 137059 0.34% 142 139326 0.34% 143 139186 0.34% 144 141016 0.35% 145 142430 0.35% 146 143410 0.35% 147 143908 0.35% 148 147390 0.36% 149 147368 0.36% 150 148055 0.36% 151 34098340 83.87% 40654426 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=35 prefix-density=0.15 prefix-fanout=2.0 sequence=TGCGACATGGTTGGCAAGAATCCTTCTGCGAATTTAGCAACAACCGAAGAATCAAGATACTCCTGCAAGCCCTCCAGATCATCAAAGGTAGTTTCAAAAGCATGAGTATATCCGAAATTGAGGTCGTGAATACCCAGATTAGTGCCCCAGTGTAAGCTCTTCAAGGGTTCAACTTGATTGACCAGATGAGTGAAGTCGTTTATGATTTTCTCAATTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=23 fanout-score=113.23 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=18.1 sequence=TCTTCATCTTCCT criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.77 fanout-score-rank=35 prefix-density=0.34 prefix-fanout=2.5 sequence=ATAGAGAGAAAGA criterion=fanout-score sequence-density=0.08 sequence-density-rank=14 fanout-score=338.10 fanout-score-rank=1 prefix-density=0.90 prefix-fanout=29.3 sequence=AAGAAGAAGAAA SRR28623234 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 11:03:51 Started mapping on | Feb 11 11:03:52 Finished on | Feb 11 11:08:09 Mapping speed, Million of reads per hour | 569.48 Number of input reads | 40654426 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 37785807 Uniquely mapped reads % | 92.94% Average mapped length | 291.27 Number of splices: Total | 34120441 Number of splices: Annotated (sjdb) | 33363401 Number of splices: GT/AG | 33548652 Number of splices: GC/AG | 436188 Number of splices: AT/AC | 30872 Number of splices: Non-canonical | 104729 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.95 Insertion rate per base | 0.03% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1142468 % of reads mapped to multiple loci | 2.81% Number of reads mapped to too many loci | 223146 % of reads mapped to too many loci | 0.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.45% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1726151 1726151 1726151 N_multimapping 1142468 1142468 1142468 N_noFeature 1423755 37376068 1614207 N_ambiguous 433343 2933 212051 UnstrandedReadsAssigned:35928709 PositiveStrandReadsAssigned:406806 NegativeStrandReadsAssigned:35959549 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623234 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623234-trimmed-pair1.fastq SRR28623234-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 40,654,426 reads, 36,531,933 reads pseudoaligned [quant] estimated average fragment length: 231.779 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,233 rounds 52401 SRR28623234.ke.tsv 34699 SRR28623234.se.tsv 87100 total ==> SRR28623234.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1787.22 1346 20.1336 Potri.005G024800.1.v4.1 1035 804.221 554 18.4158 Potri.004G059700.1.v4.1 961 730.235 92 3.36807 Potri.007G009000.2.v4.1 1416 1185.22 0 0 Potri.003G141000.2.v4.1 2943 2712.22 955.11 9.41421 Potri.016G087400.1.v4.1 270 94.3139 2942.78 834.137 Potri.015G069301.1.v4.1 564 339.924 0 0 Potri.010G195200.1.v4.1 1773 1542.22 49.569 0.859249 Potri.012G127500.1.v4.1 977 746.228 10074 360.899 ==> SRR28623234.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2429 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 591 Potri.001G212900.v4.1 75 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 1 SRR28623234 completed mapping pipeline successfully