Starting /dee2/code/volunteer_pipeline.sh SRR28623235 current disk space = 3052420886528 free memory = 1083285984 SRR28623235 SRAfilesize 3aeb96632e1e6857f9b5197e3d149ad8 SRR28623235.sra SRR28623235.sra file validated SRR28623235 is paired end SRR28623235 is conventional basespace SRR28623235 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623235_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.35425 37.0 37.0 37.0 37.0 37.0 2 36.469 37.0 37.0 37.0 37.0 37.0 3 36.638 37.0 37.0 37.0 37.0 37.0 4 36.6395 37.0 37.0 37.0 37.0 37.0 5 36.7085 37.0 37.0 37.0 37.0 37.0 6 36.649 37.0 37.0 37.0 37.0 37.0 7 36.54 37.0 37.0 37.0 37.0 37.0 8 36.455 37.0 37.0 37.0 37.0 37.0 9 36.662 37.0 37.0 37.0 37.0 37.0 10-14 36.610499999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.5809 37.0 37.0 37.0 37.0 37.0 20-24 36.561400000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.541599999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.49759999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.4454 37.0 37.0 37.0 37.0 37.0 40-44 36.451800000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.4422 37.0 37.0 37.0 37.0 37.0 50-54 36.3986 37.0 37.0 37.0 37.0 37.0 55-59 36.3296 37.0 37.0 37.0 37.0 37.0 60-64 36.355399999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.348600000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.25449999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.2252 37.0 37.0 37.0 37.0 37.0 80-84 36.131 37.0 37.0 37.0 37.0 37.0 85-89 36.212599999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.119699999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.9722 37.0 37.0 37.0 37.0 37.0 100-104 36.021699999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.0385 37.0 37.0 37.0 37.0 37.0 110-114 35.9514 37.0 37.0 37.0 37.0 37.0 115-119 35.9064 37.0 37.0 37.0 37.0 37.0 120-124 35.8367 37.0 37.0 37.0 37.0 37.0 125-129 35.727700000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.8361 37.0 37.0 37.0 37.0 37.0 135-139 35.6288 37.0 37.0 37.0 37.0 37.0 140-144 35.4018 37.0 37.0 37.0 34.6 37.0 145-149 35.2779 37.0 37.0 37.0 32.2 37.0 150-151 35.067750000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 3.0 24 0.0 25 2.0 26 9.0 27 6.0 28 19.0 29 15.0 30 20.0 31 32.0 32 53.0 33 83.0 34 173.0 35 379.0 36 2962.0 37 243.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.02640181040986 12.698013578073924 9.253205934121198 43.022378677395025 2 18.15 14.975 37.775 29.099999999999998 3 17.9 18.099999999999998 28.95 35.05 4 23.625 27.025 23.575 25.775 5 24.55 33.625 23.65 18.175 6 21.45 36.4 22.650000000000002 19.5 7 14.7 29.099999999999998 39.725 16.475 8 18.35 26.5 31.0 24.15 9 16.775000000000002 24.7 34.5 24.025 10-14 19.68 30.209999999999997 27.169999999999998 22.939999999999998 15-19 20.145 27.99 28.275 23.59 20-24 19.675 28.845 27.705000000000002 23.775 25-29 19.03 29.830000000000002 27.46 23.68 30-34 19.939999999999998 28.59 28.03 23.44 35-39 19.415 28.89 28.465 23.23 40-44 19.814999999999998 28.82 28.299999999999997 23.064999999999998 45-49 19.53 29.354999999999997 27.96 23.155 50-54 19.875 29.5 27.615000000000002 23.01 55-59 20.19 28.985 27.525 23.3 60-64 19.975 28.360000000000003 28.560000000000002 23.105 65-69 20.14 28.689999999999998 27.405 23.765 70-74 20.145 28.970000000000002 27.705000000000002 23.18 75-79 19.695 28.444999999999997 27.765 24.095 80-84 20.169999999999998 28.595 27.755000000000003 23.48 85-89 19.96 28.74 27.71 23.59 90-94 20.155 28.599999999999998 27.88 23.365 95-99 20.225 28.42 28.07 23.285 100-104 20.080000000000002 29.445 27.05 23.425 105-109 20.32 28.515 27.615000000000002 23.549999999999997 110-114 20.03 29.765000000000004 26.640000000000004 23.565 115-119 20.31 29.64 26.63 23.419999999999998 120-124 20.455000000000002 29.520000000000003 26.095000000000002 23.93 125-129 19.805 29.32 27.255000000000003 23.62 130-134 20.655 28.810000000000002 26.889999999999997 23.645 135-139 20.615 28.64 26.815 23.93 140-144 21.425 27.71 26.655 24.21 145-149 21.32 28.395 26.345000000000002 23.94 150-151 21.4875 28.1625 26.087500000000002 24.2625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 2.5 24 2.5 25 2.0 26 5.0 27 8.0 28 11.5 29 16.5 30 19.0 31 26.0 32 35.5 33 46.5 34 60.5 35 87.0 36 111.0 37 130.5 38 144.0 39 159.5 40 187.5 41 223.0 42 270.0 43 281.0 44 276.0 45 261.0 46 255.5 47 246.5 48 223.0 49 195.5 50 146.5 51 114.0 52 100.5 53 83.5 54 61.0 55 51.0 56 45.5 57 34.0 58 21.5 59 13.5 60 8.0 61 6.5 62 4.0 63 2.0 64 2.0 65 4.5 66 5.0 67 2.0 68 1.5 69 1.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 86.05461940732133 74.05000000000001 2 11.99883788495061 20.65 3 1.6560139453805929 4.275 4 0.26147588611272515 0.8999999999999999 5 0.029052876234747237 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGACTTGATCCTCAAGTAGGTGCTTAGAAATTAGAATGTCAAAAGCGTGT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.21250000000000002 0.0 0.0 0.0 0.0 74-75 0.2375 0.0 0.0 0.0 0.0 76-77 0.2875 0.0 0.0 0.0 0.0 78-79 0.42500000000000004 0.0 0.0 0.0 0.0 80-81 0.475 0.0 0.0 0.0 0.0 82-83 0.6875 0.0 0.0 0.0 0.0 84-85 0.9625 0.0 0.0 0.0 0.0 86-87 1.1124999999999998 0.0 0.0 0.0 0.0 88-89 1.2 0.0 0.0 0.0 0.0 90-91 1.325 0.0 0.0 0.0 0.0 92-93 1.45 0.0 0.0 0.0 0.0 94-95 1.8 0.0 0.0 0.0 0.0 96-97 2.3375000000000004 0.0 0.0 0.0 0.0 98-99 2.6625 0.0 0.0 0.0 0.0 100-101 2.9875 0.0 0.0 0.0 0.0 102-103 3.45 0.0 0.0 0.0 0.0 104-105 3.7625 0.0 0.0 0.0 0.0 106-107 4.0875 0.0 0.0 0.0 0.0 108-109 4.637499999999999 0.0 0.0 0.0 0.0 110-111 5.112500000000001 0.0 0.0 0.0 0.0 112-113 5.7875 0.0 0.0 0.0 0.0 114-115 6.2875 0.0 0.0 0.0 0.0 116-117 6.7625 0.0 0.0 0.0 0.0 118-119 7.3375 0.0 0.0 0.0 0.0 120-121 7.887499999999999 0.0 0.0 0.0 0.0 122-123 8.6375 0.0 0.0 0.0 0.0 124-125 9.25 0.0 0.0 0.0 0.0 126-127 9.8 0.0 0.0 0.0 0.0 128-129 10.4375 0.0 0.0 0.0 0.0 130-131 11.100000000000001 0.0 0.0 0.0 0.0 132-133 11.8125 0.0 0.0 0.0 0.0 134-135 12.5625 0.0 0.0 0.0 0.0 136-137 13.475 0.0 0.0 0.0 0.0 138-139 14.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCACCC 10 0.006830828 145.0 1 ACGTCTG 45 0.008957279 48.333332 145 TTTTTTT 80 0.0020131238 12.6875 100-104 >>END_MODULE SRR28623235 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623235_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.7465 37.0 37.0 37.0 37.0 37.0 2 36.159 37.0 37.0 37.0 37.0 37.0 3 36.143 37.0 37.0 37.0 37.0 37.0 4 36.2575 37.0 37.0 37.0 37.0 37.0 5 36.273 37.0 37.0 37.0 37.0 37.0 6 36.373 37.0 37.0 37.0 37.0 37.0 7 36.3555 37.0 37.0 37.0 37.0 37.0 8 36.3075 37.0 37.0 37.0 37.0 37.0 9 36.126 37.0 37.0 37.0 37.0 37.0 10-14 36.2434 37.0 37.0 37.0 37.0 37.0 15-19 36.23570000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.2395 37.0 37.0 37.0 37.0 37.0 25-29 36.18249999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.07690000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.0753 37.0 37.0 37.0 37.0 37.0 40-44 36.0798 37.0 37.0 37.0 37.0 37.0 45-49 36.0084 37.0 37.0 37.0 37.0 37.0 50-54 36.041399999999996 37.0 37.0 37.0 37.0 37.0 55-59 35.797000000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.82170000000001 37.0 37.0 37.0 37.0 37.0 65-69 35.914 37.0 37.0 37.0 37.0 37.0 70-74 35.94180000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.9534 37.0 37.0 37.0 37.0 37.0 80-84 35.837300000000006 37.0 37.0 37.0 37.0 37.0 85-89 35.7638 37.0 37.0 37.0 37.0 37.0 90-94 35.6553 37.0 37.0 37.0 37.0 37.0 95-99 35.7309 37.0 37.0 37.0 37.0 37.0 100-104 35.614000000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.5554 37.0 37.0 37.0 37.0 37.0 110-114 35.688900000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.6012 37.0 37.0 37.0 37.0 37.0 120-124 35.555400000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.1052 37.0 37.0 37.0 32.2 37.0 130-134 35.4622 37.0 37.0 37.0 37.0 37.0 135-139 35.1545 37.0 37.0 37.0 29.8 37.0 140-144 35.2835 37.0 37.0 37.0 32.2 37.0 145-149 35.2228 37.0 37.0 37.0 32.2 37.0 150-151 34.936 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 3.0 15 3.0 16 1.0 17 3.0 18 0.0 19 4.0 20 0.0 21 9.0 22 2.0 23 6.0 24 6.0 25 9.0 26 10.0 27 10.0 28 20.0 29 17.0 30 35.0 31 36.0 32 46.0 33 104.0 34 233.0 35 652.0 36 2508.0 37 280.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.15 20.875 11.725 26.25 2 25.8 25.4 32.525 16.275000000000002 3 21.05 27.575 31.225 20.150000000000002 4 23.9 33.825 23.125 19.15 5 24.625 36.025 22.45 16.900000000000002 6 19.025 40.550000000000004 22.95 17.474999999999998 7 21.4 21.224999999999998 38.15 19.225 8 21.0 27.500000000000004 28.7 22.8 9 23.724999999999998 23.65 30.75 21.875 10-14 23.395 29.225 26.44 20.94 15-19 23.09 28.48 27.944999999999997 20.485 20-24 22.545 28.705000000000002 28.025 20.724999999999998 25-29 22.915 29.099999999999998 27.46 20.525 30-34 22.98 28.49 27.944999999999997 20.585 35-39 22.919999999999998 28.215 28.244999999999997 20.62 40-44 23.21 28.79 27.735 20.265 45-49 23.745 28.4 28.035 19.82 50-54 23.119999999999997 29.145 27.775 19.96 55-59 23.21 28.13 28.7 19.96 60-64 23.285 28.694999999999997 28.17 19.85 65-69 23.78 28.725 28.09 19.405 70-74 23.73 27.894999999999996 27.92 20.455000000000002 75-79 23.405 28.71 27.85 20.035 80-84 23.169999999999998 27.894999999999996 28.365000000000002 20.57 85-89 23.265 28.335 28.01 20.39 90-94 23.335 29.385 27.395000000000003 19.885 95-99 23.905 28.865000000000002 27.755000000000003 19.475 100-104 24.29 28.465 27.485 19.759999999999998 105-109 24.005000000000003 29.115000000000002 26.955000000000002 19.925 110-114 24.46 28.515 27.384999999999998 19.64 115-119 24.935 28.395 27.544999999999998 19.125 120-124 25.11 28.275 27.62 18.995 125-129 25.155 28.18 27.339999999999996 19.325 130-134 25.395 28.665000000000003 26.724999999999998 19.215 135-139 25.7 29.26 26.345000000000002 18.695 140-144 25.61 29.020000000000003 26.97 18.4 145-149 26.179999999999996 28.084999999999997 27.045 18.69 150-151 25.887500000000003 28.0875 26.75 19.275000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 1.0 10 1.5 11 1.5 12 2.0 13 1.5 14 0.5 15 1.0 16 1.0 17 0.5 18 1.0 19 1.0 20 1.0 21 1.0 22 1.5 23 1.5 24 0.5 25 2.5 26 6.0 27 11.5 28 14.5 29 12.5 30 18.0 31 25.0 32 27.5 33 33.0 34 46.5 35 75.0 36 103.0 37 123.5 38 159.5 39 192.5 40 212.0 41 241.0 42 263.5 43 259.5 44 257.5 45 274.0 46 265.5 47 244.0 48 223.5 49 178.0 50 143.0 51 126.5 52 101.0 53 83.5 54 65.0 55 43.5 56 34.0 57 28.5 58 20.5 59 13.5 60 12.5 61 9.0 62 5.5 63 5.5 64 4.5 65 1.5 66 1.0 67 1.5 68 1.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.5 74 1.0 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 1.0 87 1.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.4 #Duplication Level Percentage of deduplicated Percentage of total 1 86.66087962962963 74.875 2 11.255787037037036 19.45 3 1.765046296296296 4.575 4 0.31828703703703703 1.0999999999999999 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.21250000000000002 0.0 0.0 0.0 0.0 74-75 0.2375 0.0 0.0 0.0 0.0 76-77 0.2875 0.0 0.0 0.0 0.0 78-79 0.42500000000000004 0.0 0.0 0.0 0.0 80-81 0.475 0.0 0.0 0.0 0.0 82-83 0.6875 0.0 0.0 0.0 0.0 84-85 0.9625 0.0 0.0 0.0 0.0 86-87 1.1124999999999998 0.0 0.0 0.0 0.0 88-89 1.2 0.0 0.0 0.0 0.0 90-91 1.325 0.0 0.0 0.0 0.0 92-93 1.45 0.0 0.0 0.0 0.0 94-95 1.8 0.0 0.0 0.0 0.0 96-97 2.3375000000000004 0.0 0.0 0.0 0.0 98-99 2.675 0.0 0.0 0.0 0.0 100-101 3.0125 0.0 0.0 0.0 0.0 102-103 3.475 0.0 0.0 0.0 0.0 104-105 3.8 0.0 0.0 0.0 0.0 106-107 4.1125 0.0 0.0 0.0 0.0 108-109 4.675 0.0 0.0 0.0 0.0 110-111 5.1625 0.0 0.0 0.0 0.0 112-113 5.8375 0.0 0.0 0.0 0.0 114-115 6.3375 0.0 0.0 0.0 0.0 116-117 6.8125 0.0 0.0 0.0 0.0 118-119 7.425000000000001 0.0 0.0 0.0 0.0 120-121 8.0 0.0 0.0 0.0 0.0 122-123 8.725 0.0 0.0 0.0 0.0 124-125 9.325 0.0 0.0 0.0 0.0 126-127 9.850000000000001 0.0 0.0 0.0 0.0 128-129 10.425 0.0 0.0 0.0 0.0 130-131 11.05 0.0 0.0 0.0 0.0 132-133 11.7375 0.0 0.0 0.0 0.0 134-135 12.4375 0.0 0.0 0.0 0.0 136-137 13.337499999999999 0.0 0.0 0.0 0.0 138-139 14.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTACTAT 10 0.006830828 145.0 5 GAAGTCT 10 0.006830828 145.0 3 TACTATG 10 0.006830828 145.0 6 AAGTCTT 10 0.006830828 145.0 4 CGTGTAG 40 0.005621335 54.375 145 >>END_MODULE Read 1930941 spots for SRR28623235.sra Written 1930941 spots for SRR28623235.sra Read 1930941 spots for SRR28623235.sra Written 1930941 spots for SRR28623235.sra Read 1930941 spots for SRR28623235.sra Written 1930941 spots for SRR28623235.sra Read 1930941 spots for SRR28623235.sra Written 1930941 spots for SRR28623235.sra Read 1930941 spots for SRR28623235.sra Written 1930941 spots for SRR28623235.sra Read 1930941 spots for SRR28623235.sra Written 1930941 spots for SRR28623235.sra Read 1930941 spots for SRR28623235.sra Written 1930941 spots for SRR28623235.sra Read 1930941 spots for SRR28623235.sra Written 1930941 spots for SRR28623235.sra Read 1930941 spots for SRR28623235.sra Written 1930941 spots for SRR28623235.sra Read 1930941 spots for SRR28623235.sra Written 1930941 spots for SRR28623235.sra Read 1930941 spots for SRR28623235.sra Written 1930941 spots for SRR28623235.sra Read 1930941 spots for SRR28623235.sra Written 1930941 spots for SRR28623235.sra Read 1930941 spots for SRR28623235.sra Written 1930941 spots for SRR28623235.sra Read 1930941 spots for SRR28623235.sra Written 1930941 spots for SRR28623235.sra Read 1930941 spots for SRR28623235.sra Written 1930941 spots for SRR28623235.sra Read 1930941 spots for SRR28623235.sra Written 1930941 spots for SRR28623235.sra Read 1930941 spots for SRR28623235.sra Written 1930941 spots for SRR28623235.sra Read 1930941 spots for SRR28623235.sra Written 1930941 spots for SRR28623235.sra Read 1930941 spots for SRR28623235.sra Written 1930941 spots for SRR28623235.sra Read 1930946 spots for SRR28623235.sra Written 1930946 spots for SRR28623235.sra SRR ids: ['SRR28623235.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ni4mch06 SRR28623235.sra spots: 38618825 blocks: [[1, 1930941], [1930942, 3861882], [3861883, 5792823], [5792824, 7723764], [7723765, 9654705], [9654706, 11585646], [11585647, 13516587], [13516588, 15447528], [15447529, 17378469], [17378470, 19309410], [19309411, 21240351], [21240352, 23171292], [23171293, 25102233], [25102234, 27033174], [27033175, 28964115], [28964116, 30895056], [30895057, 32825997], [32825998, 34756938], [34756939, 36687879], [36687880, 38618825]] SRR28623235 file size 14262475 SRR28623235 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623235 SRR28623235_1.fastq SRR28623235_2.fastq Input file: SRR28623235_1.fastq Paired file: SRR28623235_2.fastq trimmed: SRR28623235-trimmed-pair1.fastq, SRR28623235-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 11:15:05 2025 >> started Tue Feb 11 11:15:53 2025 >> done (47.792s) 38618825 read pairs processed; of these: 28 ( 0.00%) short read pairs filtered out after trimming by size control 17902 ( 0.05%) empty read pairs filtered out after trimming by size control 38600895 (99.95%) read pairs available; of these: 7419474 (19.22%) trimmed read pairs available after processing 31181421 (80.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 4 0.00% 20 5 0.00% 21 6 0.00% 22 5 0.00% 23 8 0.00% 24 10 0.00% 25 4 0.00% 26 14 0.00% 27 19 0.00% 28 21 0.00% 29 12 0.00% 30 17 0.00% 31 33 0.00% 32 39 0.00% 33 37 0.00% 34 40 0.00% 35 45 0.00% 36 50 0.00% 37 53 0.00% 38 66 0.00% 39 103 0.00% 40 117 0.00% 41 110 0.00% 42 167 0.00% 43 135 0.00% 44 181 0.00% 45 226 0.00% 46 201 0.00% 47 255 0.00% 48 325 0.00% 49 362 0.00% 50 414 0.00% 51 519 0.00% 52 550 0.00% 53 672 0.00% 54 695 0.00% 55 782 0.00% 56 867 0.00% 57 1041 0.00% 58 1278 0.00% 59 1457 0.00% 60 1663 0.00% 61 1882 0.00% 62 2135 0.01% 63 2440 0.01% 64 2799 0.01% 65 3228 0.01% 66 3653 0.01% 67 4189 0.01% 68 4772 0.01% 69 5297 0.01% 70 6034 0.02% 71 6837 0.02% 72 7822 0.02% 73 9151 0.02% 74 10396 0.03% 75 11548 0.03% 76 12983 0.03% 77 14174 0.04% 78 15871 0.04% 79 17323 0.04% 80 19190 0.05% 81 21315 0.06% 82 23738 0.06% 83 26335 0.07% 84 28610 0.07% 85 31117 0.08% 86 33647 0.09% 87 35681 0.09% 88 38670 0.10% 89 41023 0.11% 90 43211 0.11% 91 47053 0.12% 92 49213 0.13% 93 52647 0.14% 94 56824 0.15% 95 59758 0.15% 96 63006 0.16% 97 65734 0.17% 98 67691 0.18% 99 69856 0.18% 100 72257 0.19% 101 75682 0.20% 102 77652 0.20% 103 82010 0.21% 104 83859 0.22% 105 87558 0.23% 106 90938 0.24% 107 93541 0.24% 108 94998 0.25% 109 97755 0.25% 110 98399 0.25% 111 101052 0.26% 112 104299 0.27% 113 105733 0.27% 114 107869 0.28% 115 111323 0.29% 116 114057 0.30% 117 116484 0.30% 118 119335 0.31% 119 120198 0.31% 120 122462 0.32% 121 123605 0.32% 122 123509 0.32% 123 126392 0.33% 124 128235 0.33% 125 130443 0.34% 126 132002 0.34% 127 135237 0.35% 128 137013 0.35% 129 137642 0.36% 130 140422 0.36% 131 140462 0.36% 132 140474 0.36% 133 142034 0.37% 134 142539 0.37% 135 143844 0.37% 136 145385 0.38% 137 146537 0.38% 138 148243 0.38% 139 150417 0.39% 140 149998 0.39% 141 152685 0.40% 142 153458 0.40% 143 151909 0.39% 144 154152 0.40% 145 153774 0.40% 146 154287 0.40% 147 154623 0.40% 148 156958 0.41% 149 157529 0.41% 150 158737 0.41% 151 31181421 80.78% 38600895 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.65 fanout-score-rank=39 prefix-density=0.15 prefix-fanout=2.5 sequence=GTGGACTCCTTCTGGAT criterion=fanout-score sequence-density=0.06 sequence-density-rank=19 fanout-score=500.12 fanout-score-rank=1 prefix-density=0.98 prefix-fanout=32.4 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.87 fanout-score-rank=34 prefix-density=0.19 prefix-fanout=2.5 sequence=ATCACTCAAAGCAATGAAACCTG criterion=fanout-score sequence-density=0.09 sequence-density-rank=12 fanout-score=372.31 fanout-score-rank=1 prefix-density=0.98 prefix-fanout=32.4 sequence=AAGAAGAAGAAA SRR28623235 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 11:16:37 Started mapping on | Feb 11 11:16:38 Finished on | Feb 11 11:20:28 Mapping speed, Million of reads per hour | 604.19 Number of input reads | 38600895 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 36321545 Uniquely mapped reads % | 94.10% Average mapped length | 289.40 Number of splices: Total | 32505713 Number of splices: Annotated (sjdb) | 31639591 Number of splices: GT/AG | 31881312 Number of splices: GC/AG | 488162 Number of splices: AT/AC | 33235 Number of splices: Non-canonical | 103004 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.93 Insertion rate per base | 0.03% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 991430 % of reads mapped to multiple loci | 2.57% Number of reads mapped to too many loci | 183627 % of reads mapped to too many loci | 0.48% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.68% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1287920 1287920 1287920 N_multimapping 991430 991430 991430 N_noFeature 1702261 35831502 1966351 N_ambiguous 445647 3425 217365 UnstrandedReadsAssigned:34173637 PositiveStrandReadsAssigned:486618 NegativeStrandReadsAssigned:34137829 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623235 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623235-trimmed-pair1.fastq SRR28623235-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 38,600,895 reads, 34,536,734 reads pseudoaligned [quant] estimated average fragment length: 220.261 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,186 rounds 52401 SRR28623235.ke.tsv 34699 SRR28623235.se.tsv 87100 total ==> SRR28623235.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1798.74 2712 45.065 Potri.005G024800.1.v4.1 1035 815.739 2788 102.155 Potri.004G059700.1.v4.1 961 741.765 186 7.49487 Potri.007G009000.2.v4.1 1416 1196.74 0 0 Potri.003G141000.2.v4.1 2943 2723.74 1178.2 12.9292 Potri.016G087400.1.v4.1 270 99.2773 3054.82 919.715 Potri.015G069301.1.v4.1 564 350.08 0 0 Potri.010G195200.1.v4.1 1773 1553.74 81 1.5582 Potri.012G127500.1.v4.1 977 757.752 12913 509.351 ==> SRR28623235.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3686 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 607 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 6 SRR28623235 completed mapping pipeline successfully