Starting /dee2/code/volunteer_pipeline.sh SRR28623236 current disk space = 3089073610752 free memory = 1435905896 SRR28623236 SRAfilesize d004d4088d6814c91e8bffbcfbfeaba4 SRR28623236.sra SRR28623236.sra file validated SRR28623236 is paired end SRR28623236 is conventional basespace SRR28623236 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623236_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4495 37.0 37.0 37.0 37.0 37.0 2 36.4255 37.0 37.0 37.0 37.0 37.0 3 36.6035 37.0 37.0 37.0 37.0 37.0 4 36.614 37.0 37.0 37.0 37.0 37.0 5 36.6815 37.0 37.0 37.0 37.0 37.0 6 36.6435 37.0 37.0 37.0 37.0 37.0 7 36.5855 37.0 37.0 37.0 37.0 37.0 8 36.4365 37.0 37.0 37.0 37.0 37.0 9 36.584 37.0 37.0 37.0 37.0 37.0 10-14 36.6136 37.0 37.0 37.0 37.0 37.0 15-19 36.570899999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.575900000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.492 37.0 37.0 37.0 37.0 37.0 30-34 36.458 37.0 37.0 37.0 37.0 37.0 35-39 36.3994 37.0 37.0 37.0 37.0 37.0 40-44 36.3965 37.0 37.0 37.0 37.0 37.0 45-49 35.9659 37.0 37.0 37.0 37.0 37.0 50-54 36.025099999999995 37.0 37.0 37.0 37.0 37.0 55-59 35.7147 37.0 37.0 37.0 37.0 37.0 60-64 35.7763 37.0 37.0 37.0 37.0 37.0 65-69 35.708299999999994 37.0 37.0 37.0 37.0 37.0 70-74 35.777300000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.096199999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.05980000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.0962 37.0 37.0 37.0 37.0 37.0 90-94 36.025099999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.914100000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.983 37.0 37.0 37.0 37.0 37.0 105-109 35.9542 37.0 37.0 37.0 37.0 37.0 110-114 35.936400000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.8882 37.0 37.0 37.0 37.0 37.0 120-124 35.735 37.0 37.0 37.0 37.0 37.0 125-129 35.6507 37.0 37.0 37.0 37.0 37.0 130-134 35.7709 37.0 37.0 37.0 37.0 37.0 135-139 35.621700000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.348800000000004 37.0 37.0 37.0 34.6 37.0 145-149 35.3245 37.0 37.0 37.0 34.6 37.0 150-151 35.096000000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 4.0 23 3.0 24 2.0 25 10.0 26 7.0 27 7.0 28 15.0 29 26.0 30 25.0 31 29.0 32 72.0 33 185.0 34 143.0 35 386.0 36 2820.0 37 265.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.767301905717154 12.337011033099298 14.44332998996991 42.45235707121364 2 19.125 18.65 34.5 27.725 3 17.125 20.3 27.05 35.525 4 19.8 28.325 22.25 29.625 5 23.575 33.525 22.575 20.325 6 22.725 35.725 23.0 18.55 7 14.2 30.45 40.050000000000004 15.299999999999999 8 18.65 29.575000000000003 30.45 21.325 9 19.1 24.125 35.3 21.475 10-14 18.595 31.705 26.455000000000002 23.244999999999997 15-19 18.584999999999997 29.709999999999997 27.43 24.275 20-24 18.845 30.65 27.605 22.900000000000002 25-29 19.465 29.75 26.685 24.099999999999998 30-34 19.025 29.815 27.925 23.235 35-39 19.36 29.755 26.905 23.98 40-44 18.705 29.775000000000002 28.005000000000003 23.515 45-49 19.64 29.215000000000003 27.565 23.580000000000002 50-54 19.425 29.349999999999998 27.445000000000004 23.78 55-59 19.55 29.080000000000002 28.444999999999997 22.925 60-64 20.119999999999997 28.76 27.855 23.265 65-69 19.705000000000002 29.98 27.435 22.88 70-74 21.07 29.705 26.6 22.625 75-79 20.880000000000003 29.375 26.619999999999997 23.125 80-84 21.65 29.160000000000004 26.665 22.525000000000002 85-89 22.065 29.385 25.765 22.785 90-94 21.92 28.884999999999998 26.345000000000002 22.85 95-99 21.265 28.865000000000002 26.83 23.04 100-104 21.93 28.935 26.955000000000002 22.18 105-109 22.275 29.095 25.965 22.665 110-114 22.045 29.485 25.71 22.759999999999998 115-119 22.305 28.435 26.13 23.13 120-124 22.095000000000002 28.810000000000002 25.44 23.655 125-129 22.975 27.939999999999998 25.645 23.44 130-134 22.625 28.189999999999998 25.75 23.435 135-139 22.39 28.115000000000002 25.990000000000002 23.505000000000003 140-144 23.07 27.785 25.924999999999997 23.22 145-149 23.005 28.115000000000002 25.94 22.939999999999998 150-151 23.575 27.487499999999997 25.387500000000003 23.549999999999997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.5 17 0.5 18 0.5 19 1.0 20 1.5 21 2.5 22 2.0 23 2.0 24 1.5 25 5.5 26 9.5 27 11.5 28 17.0 29 21.0 30 27.0 31 38.5 32 52.0 33 65.5 34 93.5 35 108.5 36 124.0 37 141.5 38 160.0 39 183.5 40 200.5 41 214.5 42 226.0 43 243.5 44 239.5 45 217.0 46 214.5 47 223.0 48 212.5 49 185.0 50 150.0 51 113.5 52 86.5 53 66.5 54 49.5 55 41.0 56 37.0 57 31.5 58 19.0 59 13.0 60 7.5 61 3.0 62 4.5 63 7.5 64 6.5 65 8.5 66 18.0 67 19.5 68 17.5 69 18.5 70 14.5 71 8.5 72 6.0 73 3.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.675 #Duplication Level Percentage of deduplicated Percentage of total 1 84.9107952827336 70.19999999999999 2 12.27698820683399 20.3 3 1.9655276685817962 4.875 4 0.5442999697611128 1.7999999999999998 5 0.15119443604475355 0.625 6 0.03023888720895071 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.12095554883580284 2.0500000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGTACCGTATCTCGTAT 36 0.8999999999999999 TruSeq Adapter, Index 22 (97% over 38bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGTACCGTATCGCGTAT 22 0.5499999999999999 TruSeq Adapter, Index 22 (97% over 38bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGTACCGTATCTCGTTT 13 0.325 TruSeq Adapter, Index 22 (97% over 38bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGTACCGTATCTCGGAT 11 0.27499999999999997 TruSeq Adapter, Index 22 (97% over 38bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGTACCGTATCGCGTTT 6 0.15 TruSeq Adapter, Index 22 (97% over 38bp) CCAATGTTGGGCATCAAAGTGCATCCTTTGAACTTCCTCCTGACCCTTGA 5 0.125 No Hit AAACCAAAGAAAGAGGAAGACGGGGCGGAGTTGACGTGCAATGTGCATAC 5 0.125 No Hit CATGATCCTGAGAAGTTCTGGAATGTCACCGTGTTAGTCGAGTTACTCGT 5 0.125 No Hit TTCTAGGAGTCCTTTAACGGGTTCATGTTCATGAGCCCATGGTTTCTTGA 5 0.125 No Hit CCAGCATTATCAAGGCCCAAGAACAAGATCTTGGCTTCTTTTTGCCACAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1625 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.5375000000000001 0.0 0.0 0.0 0.0 86-87 0.6375 0.0 0.0 0.0 0.0 88-89 0.7124999999999999 0.0 0.0 0.0 0.0 90-91 0.7749999999999999 0.0 0.0 0.0 0.0 92-93 0.9875 0.0 0.0 0.0 0.0 94-95 1.2375 0.0 0.0 0.0 0.0 96-97 1.5125000000000002 0.0 0.0 0.0 0.0 98-99 1.75 0.0 0.0 0.0 0.0 100-101 2.075 0.0 0.0 0.0 0.0 102-103 2.3875 0.0 0.0 0.0 0.0 104-105 2.9 0.0 0.0 0.0 0.0 106-107 3.325 0.0 0.0 0.0 0.0 108-109 3.6625 0.0 0.0 0.0 0.0 110-111 4.1625 0.0 0.0 0.0 0.0 112-113 4.525 0.0 0.0 0.0 0.0 114-115 5.050000000000001 0.0 0.0 0.0 0.0 116-117 5.525 0.0 0.0 0.0 0.0 118-119 5.875 0.0 0.0 0.0 0.0 120-121 6.362500000000001 0.0 0.0 0.0 0.0 122-123 6.8875 0.0 0.0 0.0 0.0 124-125 7.35 0.0 0.0 0.0 0.0 126-127 7.9125 0.0 0.0 0.0 0.0 128-129 8.4125 0.0 0.0 0.0 0.0 130-131 9.0125 0.0 0.0 0.0 0.0 132-133 9.725 0.0 0.0 0.0 0.0 134-135 10.45 0.0 0.0 0.0 0.0 136-137 11.0375 0.0 0.0 0.0 0.0 138-139 12.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCCTGC 10 0.006830828 145.0 7 TTTTTTT 85 0.002429728 34.11765 2 >>END_MODULE SRR28623236 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623236_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.083 37.0 37.0 37.0 37.0 37.0 2 36.3005 37.0 37.0 37.0 37.0 37.0 3 36.271 37.0 37.0 37.0 37.0 37.0 4 36.113 37.0 37.0 37.0 37.0 37.0 5 36.322 37.0 37.0 37.0 37.0 37.0 6 36.2375 37.0 37.0 37.0 37.0 37.0 7 36.201 37.0 37.0 37.0 37.0 37.0 8 36.09 37.0 37.0 37.0 37.0 37.0 9 36.169 37.0 37.0 37.0 37.0 37.0 10-14 35.9491 37.0 37.0 37.0 37.0 37.0 15-19 35.9151 37.0 37.0 37.0 37.0 37.0 20-24 35.8358 37.0 37.0 37.0 37.0 37.0 25-29 35.626900000000006 37.0 37.0 37.0 37.0 37.0 30-34 35.4668 37.0 37.0 37.0 37.0 37.0 35-39 35.4109 37.0 37.0 37.0 37.0 37.0 40-44 35.4446 37.0 37.0 37.0 37.0 37.0 45-49 35.388400000000004 37.0 37.0 37.0 37.0 37.0 50-54 35.3608 37.0 37.0 37.0 37.0 37.0 55-59 35.2103 37.0 37.0 37.0 34.6 37.0 60-64 35.244600000000005 37.0 37.0 37.0 37.0 37.0 65-69 35.196299999999994 37.0 37.0 37.0 37.0 37.0 70-74 35.1991 37.0 37.0 37.0 37.0 37.0 75-79 35.19799999999999 37.0 37.0 37.0 37.0 37.0 80-84 35.1267 37.0 37.0 37.0 34.6 37.0 85-89 35.199200000000005 37.0 37.0 37.0 34.6 37.0 90-94 35.2856 37.0 37.0 37.0 37.0 37.0 95-99 35.3517 37.0 37.0 37.0 34.6 37.0 100-104 35.38080000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.3335 37.0 37.0 37.0 37.0 37.0 110-114 35.4746 37.0 37.0 37.0 37.0 37.0 115-119 35.479699999999994 37.0 37.0 37.0 37.0 37.0 120-124 35.4554 37.0 37.0 37.0 37.0 37.0 125-129 34.964999999999996 37.0 37.0 37.0 29.8 37.0 130-134 35.2453 37.0 37.0 37.0 29.8 37.0 135-139 35.0674 37.0 37.0 37.0 25.0 37.0 140-144 35.11319999999999 37.0 37.0 37.0 29.8 37.0 145-149 35.0326 37.0 37.0 37.0 27.4 37.0 150-151 34.70525 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 5.0 14 9.0 15 2.0 16 11.0 17 2.0 18 5.0 19 5.0 20 2.0 21 8.0 22 18.0 23 21.0 24 28.0 25 24.0 26 30.0 27 10.0 28 17.0 29 25.0 30 28.0 31 40.0 32 70.0 33 94.0 34 201.0 35 669.0 36 2444.0 37 231.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.425 19.225 19.85 26.5 2 33.1 22.2 27.700000000000003 17.0 3 25.424999999999997 26.775 28.625 19.175 4 27.85 30.349999999999998 22.95 18.85 5 29.4 31.75 22.475 16.375 6 23.400000000000002 37.075 22.55 16.975 7 23.625 19.6 38.85 17.925 8 25.775 24.275 27.250000000000004 22.7 9 25.5 24.349999999999998 29.599999999999998 20.549999999999997 10-14 26.245 27.875 26.25 19.63 15-19 26.14 27.125 27.694999999999997 19.040000000000003 20-24 25.525 27.639999999999997 27.365000000000002 19.470000000000002 25-29 26.634999999999998 27.01 27.52 18.834999999999997 30-34 25.27 27.29 28.12 19.32 35-39 25.224999999999998 27.779999999999998 28.33 18.665000000000003 40-44 25.629999999999995 27.455000000000002 28.08 18.834999999999997 45-49 24.735 27.415 27.85 20.0 50-54 24.415 27.534999999999997 28.444999999999997 19.605 55-59 24.8 27.500000000000004 28.285 19.415 60-64 24.985 27.175 28.74 19.1 65-69 24.945 26.965 28.565 19.525000000000002 70-74 24.64 27.685 28.715000000000003 18.96 75-79 24.43 29.075 27.96 18.535 80-84 25.395 27.685 28.585 18.335 85-89 25.94 27.33 28.23 18.5 90-94 25.81 27.33 28.065 18.795 95-99 26.08 27.395000000000003 27.515 19.009999999999998 100-104 26.619999999999997 27.279999999999998 27.415 18.685 105-109 26.38 27.685 27.565 18.37 110-114 26.450000000000003 27.91 27.67 17.97 115-119 26.715 27.605 27.27 18.41 120-124 26.650000000000002 27.725 27.779999999999998 17.845 125-129 27.175 27.584999999999997 26.724999999999998 18.515 130-134 26.950000000000003 28.285 27.089999999999996 17.675 135-139 27.794999999999998 26.840000000000003 27.99 17.375 140-144 28.139999999999997 27.474999999999998 26.584999999999997 17.8 145-149 28.544999999999998 26.58 27.169999999999998 17.705000000000002 150-151 27.85 26.5125 28.000000000000004 17.6375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 1.0 7 0.5 8 0.0 9 0.5 10 1.5 11 3.0 12 2.0 13 1.0 14 1.0 15 1.0 16 1.5 17 1.0 18 0.5 19 1.5 20 2.0 21 1.5 22 2.5 23 1.5 24 2.5 25 3.5 26 2.5 27 7.5 28 13.0 29 16.0 30 22.0 31 28.5 32 35.0 33 51.0 34 71.0 35 86.5 36 94.0 37 113.5 38 148.0 39 167.5 40 191.5 41 217.0 42 249.0 43 260.0 44 248.0 45 247.5 46 240.5 47 234.5 48 219.5 49 194.5 50 142.0 51 105.5 52 104.0 53 80.5 54 62.0 55 56.5 56 39.5 57 22.0 58 12.5 59 11.0 60 12.0 61 11.0 62 8.5 63 9.0 64 7.5 65 2.5 66 1.5 67 1.0 68 0.5 69 0.5 70 1.5 71 2.0 72 3.0 73 2.5 74 2.5 75 3.5 76 4.0 77 4.0 78 2.5 79 4.5 80 4.5 81 2.5 82 4.0 83 5.5 84 4.5 85 3.0 86 6.5 87 8.0 88 4.0 89 3.0 90 6.0 91 5.0 92 3.0 93 4.5 94 6.0 95 4.0 96 1.0 97 1.5 98 1.0 99 1.0 100 7.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 85.76889150249927 72.925 2 11.967068509261981 20.349999999999998 3 1.7347838870920316 4.425 4 0.3234342840341076 1.0999999999999999 5 0.17641870038224053 0.75 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.029403116730373418 0.44999999999999996 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 18 0.44999999999999996 No Hit AAGACTCTGCAAACCTCTACAACGAAGAAGAACGTCTGGGAGTGCACAAA 5 0.125 No Hit TTCATAGGTACATAGTGTTCAAGATTGATGAGAAGTCGAGATTGGTAACT 5 0.125 No Hit TATACAGGGGACGGCTGCTGTTGTTCTTGCAGGGCTTATTTCAGCACTGA 5 0.125 No Hit CTCTGTGTTTTAATTAGCAAATCAAAACTTGAAGCTTTAAAAGTTCTCTT 5 0.125 No Hit GTTGTTGGTCAAGCTGGAAGACCCAAGACCATTACTGGTTTCCAGACCCA 5 0.125 No Hit TTTCAAACAGGATTGGCAGGCGCAGCTATCCAAGCAGAAAAAAATGGCTG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.5125 0.0 0.0 0.0 0.0 86-87 0.6125 0.0 0.0 0.0 0.0 88-89 0.6875 0.0 0.0 0.0 0.0 90-91 0.75 0.0 0.0 0.0 0.0 92-93 0.9625 0.0 0.0 0.0 0.0 94-95 1.2125 0.0 0.0 0.0 0.0 96-97 1.4874999999999998 0.0 0.0 0.0 0.0 98-99 1.725 0.0 0.0 0.0 0.0 100-101 2.05 0.0 0.0 0.0 0.0 102-103 2.3625 0.0 0.0 0.0 0.0 104-105 2.875 0.0 0.0 0.0 0.0 106-107 3.3 0.0 0.0 0.0 0.0 108-109 3.6375 0.0 0.0 0.0 0.0 110-111 4.137499999999999 0.0 0.0 0.0 0.0 112-113 4.525 0.0 0.0 0.0 0.0 114-115 5.074999999999999 0.0 0.0 0.0 0.0 116-117 5.525 0.0 0.0 0.0 0.0 118-119 5.85 0.0 0.0 0.0 0.0 120-121 6.362500000000001 0.0 0.0 0.0 0.0 122-123 6.8625 0.0 0.0 0.0 0.0 124-125 7.3125 0.0 0.0 0.0 0.0 126-127 7.8625 0.0 0.0 0.0 0.0 128-129 8.3375 0.0 0.0 0.0 0.0 130-131 9.0 0.0 0.0 0.0 0.0 132-133 9.7375 0.0 0.0 0.0 0.0 134-135 10.45 0.0 0.0 0.0 0.0 136-137 11.0375 0.0 0.0 0.0 0.0 138-139 12.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1548457 spots for SRR28623236.sra Written 1548457 spots for SRR28623236.sra Read 1548457 spots for SRR28623236.sra Written 1548457 spots for SRR28623236.sra Read 1548457 spots for SRR28623236.sra Written 1548457 spots for SRR28623236.sra Read 1548457 spots for SRR28623236.sra Written 1548457 spots for SRR28623236.sra Read 1548457 spots for SRR28623236.sra Written 1548457 spots for SRR28623236.sra Read 1548457 spots for SRR28623236.sra Written 1548457 spots for SRR28623236.sra Read 1548457 spots for SRR28623236.sra Written 1548457 spots for SRR28623236.sra Read 1548457 spots for SRR28623236.sra Written 1548457 spots for SRR28623236.sra Read 1548465 spots for SRR28623236.sra Written 1548465 spots for SRR28623236.sra Read 1548457 spots for SRR28623236.sra Written 1548457 spots for SRR28623236.sra Read 1548457 spots for SRR28623236.sra Written 1548457 spots for SRR28623236.sra Read 1548457 spots for SRR28623236.sra Written 1548457 spots for SRR28623236.sra Read 1548457 spots for SRR28623236.sra Written 1548457 spots for SRR28623236.sra Read 1548457 spots for SRR28623236.sra Written 1548457 spots for SRR28623236.sra Read 1548457 spots for SRR28623236.sra Written 1548457 spots for SRR28623236.sra Read 1548457 spots for SRR28623236.sra Written 1548457 spots for SRR28623236.sra Read 1548457 spots for SRR28623236.sra Written 1548457 spots for SRR28623236.sra Read 1548457 spots for SRR28623236.sra Written 1548457 spots for SRR28623236.sra Read 1548457 spots for SRR28623236.sra Written 1548457 spots for SRR28623236.sra Read 1548457 spots for SRR28623236.sra Written 1548457 spots for SRR28623236.sra SRR ids: ['SRR28623236.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x0sg8d5v SRR28623236.sra spots: 30969148 blocks: [[1, 1548457], [1548458, 3096914], [3096915, 4645371], [4645372, 6193828], [6193829, 7742285], [7742286, 9290742], [9290743, 10839199], [10839200, 12387656], [12387657, 13936113], [13936114, 15484570], [15484571, 17033027], [17033028, 18581484], [18581485, 20129941], [20129942, 21678398], [21678399, 23226855], [23226856, 24775312], [24775313, 26323769], [26323770, 27872226], [27872227, 29420683], [29420684, 30969148]] SRR28623236 file size 11435197 SRR28623236 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623236 SRR28623236_1.fastq SRR28623236_2.fastq Input file: SRR28623236_1.fastq Paired file: SRR28623236_2.fastq trimmed: SRR28623236-trimmed-pair1.fastq, SRR28623236-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 15:16:07 2025 >> started Thu Feb 13 15:17:03 2025 >> done (56.464s) 30969148 read pairs processed; of these: 57 ( 0.00%) short read pairs filtered out after trimming by size control 784710 ( 2.53%) empty read pairs filtered out after trimming by size control 30184381 (97.47%) read pairs available; of these: 5127907 (16.99%) trimmed read pairs available after processing 25056474 (83.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 7 0.00% 20 4 0.00% 21 5 0.00% 22 3 0.00% 23 4 0.00% 24 4 0.00% 25 3 0.00% 26 8 0.00% 27 7 0.00% 28 12 0.00% 29 9 0.00% 30 18 0.00% 31 20 0.00% 32 25 0.00% 33 27 0.00% 34 25 0.00% 35 26 0.00% 36 37 0.00% 37 31 0.00% 38 162 0.00% 39 63 0.00% 40 100 0.00% 41 56 0.00% 42 68 0.00% 43 69 0.00% 44 66 0.00% 45 95 0.00% 46 108 0.00% 47 124 0.00% 48 156 0.00% 49 188 0.00% 50 204 0.00% 51 229 0.00% 52 299 0.00% 53 288 0.00% 54 341 0.00% 55 367 0.00% 56 388 0.00% 57 461 0.00% 58 519 0.00% 59 637 0.00% 60 687 0.00% 61 878 0.00% 62 1003 0.00% 63 1201 0.00% 64 2000 0.01% 65 1416 0.00% 66 1471 0.00% 67 1728 0.01% 68 1864 0.01% 69 2202 0.01% 70 2612 0.01% 71 2951 0.01% 72 3467 0.01% 73 3945 0.01% 74 4664 0.02% 75 5052 0.02% 76 5740 0.02% 77 6230 0.02% 78 6900 0.02% 79 7804 0.03% 80 8732 0.03% 81 9803 0.03% 82 11477 0.04% 83 12681 0.04% 84 14081 0.05% 85 15635 0.05% 86 16723 0.06% 87 17948 0.06% 88 19348 0.06% 89 20393 0.07% 90 22343 0.07% 91 24331 0.08% 92 26374 0.09% 93 28852 0.10% 94 31356 0.10% 95 33036 0.11% 96 35393 0.12% 97 36790 0.12% 98 38029 0.13% 99 39670 0.13% 100 41824 0.14% 101 43694 0.14% 102 46570 0.15% 103 48685 0.16% 104 51802 0.17% 105 53912 0.18% 106 57265 0.19% 107 58561 0.19% 108 60104 0.20% 109 61153 0.20% 110 62880 0.21% 111 64755 0.21% 112 66808 0.22% 113 68945 0.23% 114 72440 0.24% 115 75340 0.25% 116 76859 0.25% 117 79241 0.26% 118 80646 0.27% 119 82464 0.27% 120 84075 0.28% 121 85427 0.28% 122 87316 0.29% 123 88528 0.29% 124 91640 0.30% 125 93210 0.31% 126 95770 0.32% 127 99088 0.33% 128 99549 0.33% 129 100634 0.33% 130 101727 0.34% 131 102303 0.34% 132 103190 0.34% 133 105451 0.35% 134 106608 0.35% 135 109314 0.36% 136 111642 0.37% 137 112771 0.37% 138 113497 0.38% 139 115952 0.38% 140 115794 0.38% 141 117493 0.39% 142 117900 0.39% 143 118051 0.39% 144 120470 0.40% 145 120045 0.40% 146 121592 0.40% 147 123887 0.41% 148 125540 0.42% 149 126477 0.42% 150 126944 0.42% 151 25056474 83.01% 30184381 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=10.68 fanout-score-rank=13 prefix-density=0.09 prefix-fanout=10.7 sequence=GGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGTACCGTATCTCGTATGCCGTCTTCTGCTTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=36 fanout-score=571.20 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=29.6 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGG criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=6.20 fanout-score-rank=21 prefix-density=0.21 prefix-fanout=3.9 sequence=ATCCAGAAGGAGTCCAC criterion=fanout-score sequence-density=0.08 sequence-density-rank=13 fanout-score=315.85 fanout-score-rank=1 prefix-density=0.90 prefix-fanout=27.1 sequence=AAGAAGAAGAAA SRR28623236 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 15:17:52 Started mapping on | Feb 13 15:17:52 Finished on | Feb 13 15:21:51 Mapping speed, Million of reads per hour | 454.66 Number of input reads | 30184381 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 27804992 Uniquely mapped reads % | 92.12% Average mapped length | 291.45 Number of splices: Total | 22141734 Number of splices: Annotated (sjdb) | 21561418 Number of splices: GT/AG | 21755015 Number of splices: GC/AG | 290050 Number of splices: AT/AC | 23685 Number of splices: Non-canonical | 72984 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.04% Deletion average length | 2.84 Insertion rate per base | 0.03% Insertion average length | 2.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 653339 % of reads mapped to multiple loci | 2.16% Number of reads mapped to too many loci | 233056 % of reads mapped to too many loci | 0.77% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.52% % of reads unmapped: other | 0.42% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1726050 1726050 1726050 N_multimapping 653339 653339 653339 N_noFeature 1186924 27397031 1357591 N_ambiguous 380775 2583 141673 UnstrandedReadsAssigned:26237293 PositiveStrandReadsAssigned:405378 NegativeStrandReadsAssigned:26305728 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623236 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623236-trimmed-pair1.fastq SRR28623236-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,184,381 reads, 26,799,114 reads pseudoaligned [quant] estimated average fragment length: 219.383 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,406 rounds 52401 SRR28623236.ke.tsv 34699 SRR28623236.se.tsv 87100 total ==> SRR28623236.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1799.62 1693 35.7323 Potri.005G024800.1.v4.1 1035 816.617 981 45.6283 Potri.004G059700.1.v4.1 961 742.651 87 4.44957 Potri.007G009000.2.v4.1 1416 1197.62 0 0 Potri.003G141000.2.v4.1 2943 2724.62 578.224 8.06073 Potri.016G087400.1.v4.1 270 94.5083 2862.62 1150.48 Potri.015G069301.1.v4.1 564 349.824 0 0 Potri.010G195200.1.v4.1 1773 1554.62 201 4.91085 Potri.012G127500.1.v4.1 977 758.632 3933 196.914 ==> SRR28623236.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3827 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 627 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 16 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR28623236 completed mapping pipeline successfully