Starting /dee2/code/volunteer_pipeline.sh SRR28623237 current disk space = 3089084780544 free memory = 1465648036 SRR28623237 SRAfilesize 36145eb51d3033890cf24dd289e76b9f SRR28623237.sra SRR28623237.sra file validated SRR28623237 is paired end SRR28623237 is conventional basespace SRR28623237 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623237_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.31475 37.0 37.0 37.0 37.0 37.0 2 36.3395 37.0 37.0 37.0 37.0 37.0 3 36.55 37.0 37.0 37.0 37.0 37.0 4 36.544 37.0 37.0 37.0 37.0 37.0 5 36.566 37.0 37.0 37.0 37.0 37.0 6 36.57 37.0 37.0 37.0 37.0 37.0 7 36.5985 37.0 37.0 37.0 37.0 37.0 8 36.419 37.0 37.0 37.0 37.0 37.0 9 36.6095 37.0 37.0 37.0 37.0 37.0 10-14 36.5509 37.0 37.0 37.0 37.0 37.0 15-19 36.4894 37.0 37.0 37.0 37.0 37.0 20-24 36.4799 37.0 37.0 37.0 37.0 37.0 25-29 36.432500000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.3908 37.0 37.0 37.0 37.0 37.0 35-39 36.3438 37.0 37.0 37.0 37.0 37.0 40-44 36.308 37.0 37.0 37.0 37.0 37.0 45-49 36.2877 37.0 37.0 37.0 37.0 37.0 50-54 36.2033 37.0 37.0 37.0 37.0 37.0 55-59 36.229800000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.217999999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.151300000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.1323 37.0 37.0 37.0 37.0 37.0 75-79 36.1238 37.0 37.0 37.0 37.0 37.0 80-84 36.056400000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.1154 37.0 37.0 37.0 37.0 37.0 90-94 36.0137 37.0 37.0 37.0 37.0 37.0 95-99 35.8732 37.0 37.0 37.0 37.0 37.0 100-104 35.9316 37.0 37.0 37.0 37.0 37.0 105-109 35.936099999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.7777 37.0 37.0 37.0 37.0 37.0 115-119 35.8517 37.0 37.0 37.0 37.0 37.0 120-124 35.77569999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.6342 37.0 37.0 37.0 37.0 37.0 130-134 35.7602 37.0 37.0 37.0 37.0 37.0 135-139 35.611599999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.2523 37.0 37.0 37.0 32.2 37.0 145-149 35.1812 37.0 37.0 37.0 29.8 37.0 150-151 35.0465 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 1.0 23 3.0 24 6.0 25 7.0 26 7.0 27 10.0 28 15.0 29 26.0 30 33.0 31 36.0 32 59.0 33 108.0 34 156.0 35 406.0 36 2894.0 37 232.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.5222194325885 13.984433843836305 9.063519959829275 36.42982676374592 2 18.725 14.85 37.6 28.825 3 17.974999999999998 18.975 29.25 33.800000000000004 4 21.525 27.700000000000003 26.450000000000003 24.325 5 23.799999999999997 33.425 24.025 18.75 6 19.775000000000002 37.325 23.200000000000003 19.7 7 14.6 27.025 41.175 17.2 8 16.7 27.025 33.15 23.125 9 18.9 23.549999999999997 34.75 22.8 10-14 19.695 30.165 27.779999999999998 22.36 15-19 20.335 28.549999999999997 27.474999999999998 23.64 20-24 19.525000000000002 28.455000000000002 28.28 23.74 25-29 19.79 28.87 27.334999999999997 24.005000000000003 30-34 19.585 28.749999999999996 28.1 23.565 35-39 19.435 29.099999999999998 27.915 23.549999999999997 40-44 19.45 28.93 28.115000000000002 23.505000000000003 45-49 19.744999999999997 27.900000000000002 28.299999999999997 24.055 50-54 19.91 28.685 27.92 23.485 55-59 19.945 29.03 27.439999999999998 23.585 60-64 19.470000000000002 28.505000000000003 27.97 24.055 65-69 19.39 28.865000000000002 28.694999999999997 23.05 70-74 19.935 28.494999999999997 28.46 23.11 75-79 19.655 28.645 27.834999999999997 23.865 80-84 19.755 28.175 27.839999999999996 24.23 85-89 20.095 28.754999999999995 27.860000000000003 23.29 90-94 20.28 29.044999999999998 27.095000000000002 23.580000000000002 95-99 19.71 28.865000000000002 27.744999999999997 23.68 100-104 20.560000000000002 28.625 27.325 23.49 105-109 20.275000000000002 28.634999999999998 28.105000000000004 22.985 110-114 20.45 28.265 27.750000000000004 23.535 115-119 20.810000000000002 29.18 26.5 23.51 120-124 20.830000000000002 28.915000000000003 26.82 23.435 125-129 20.79 28.939999999999998 27.02 23.25 130-134 20.71 28.675 27.034999999999997 23.580000000000002 135-139 20.29 28.595 26.565 24.55 140-144 20.73 28.255000000000003 26.645000000000003 24.37 145-149 20.275000000000002 27.83 27.450000000000003 24.445 150-151 20.625 28.050000000000004 26.6 24.725 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 1.0 19 1.5 20 0.5 21 3.0 22 4.0 23 4.5 24 3.5 25 2.0 26 5.5 27 10.5 28 12.0 29 12.0 30 18.5 31 28.5 32 43.0 33 48.0 34 66.5 35 92.0 36 97.0 37 121.0 38 145.0 39 164.5 40 201.0 41 225.0 42 235.5 43 262.5 44 282.0 45 278.0 46 249.5 47 228.0 48 218.0 49 184.5 50 156.5 51 133.5 52 112.5 53 82.0 54 58.0 55 49.0 56 36.0 57 30.0 58 21.5 59 15.5 60 15.0 61 9.0 62 7.0 63 6.5 64 3.5 65 2.0 66 1.5 67 2.0 68 2.5 69 1.5 70 0.5 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.42500000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.775 #Duplication Level Percentage of deduplicated Percentage of total 1 88.1800056963828 77.4 2 10.111079464540017 17.75 3 1.3671318712617488 3.5999999999999996 4 0.28481913984619767 1.0 5 0.05696382796923954 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTACTTGTAGTAATCATCGCAGTATGTCTTGCTGGGACTCATTTCCTTGT 5 0.125 No Hit CTCAATAATTTATTGGACTTTTTTGACAGACACCTTCACCCACTTCTTCA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.5625 0.0 0.0 0.0 0.0 90-91 0.7125 0.0 0.0 0.0 0.0 92-93 0.8125 0.0 0.0 0.0 0.0 94-95 0.95 0.0 0.0 0.0 0.0 96-97 1.1375 0.0 0.0 0.0 0.0 98-99 1.4249999999999998 0.0 0.0 0.0 0.0 100-101 1.6875 0.0 0.0 0.0 0.0 102-103 1.9 0.0 0.0 0.0 0.0 104-105 2.2 0.0 0.0 0.0 0.0 106-107 2.725 0.0 0.0 0.0 0.0 108-109 3.0999999999999996 0.0 0.0 0.0 0.0 110-111 3.5 0.0 0.0 0.0 0.0 112-113 3.8125 0.0 0.0 0.0 0.0 114-115 4.199999999999999 0.0 0.0 0.0 0.0 116-117 4.737500000000001 0.0 0.0 0.0 0.0 118-119 5.2125 0.0 0.0 0.0 0.0 120-121 5.699999999999999 0.0 0.0 0.0 0.0 122-123 6.2625 0.0 0.0 0.0 0.0 124-125 6.824999999999999 0.0 0.0 0.0 0.0 126-127 7.65 0.0 0.0 0.0 0.0 128-129 8.2 0.0 0.0 0.0 0.0 130-131 8.75 0.0 0.0 0.0 0.0 132-133 9.4 0.0 0.0 0.0 0.0 134-135 10.0125 0.0 0.0 0.0 0.0 136-137 10.6875 0.0 0.0 0.0 0.0 138-139 11.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR28623237 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623237_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.924 37.0 37.0 37.0 37.0 37.0 2 36.0865 37.0 37.0 37.0 37.0 37.0 3 36.094 37.0 37.0 37.0 37.0 37.0 4 36.0395 37.0 37.0 37.0 37.0 37.0 5 36.213 37.0 37.0 37.0 37.0 37.0 6 36.1275 37.0 37.0 37.0 37.0 37.0 7 36.1455 37.0 37.0 37.0 37.0 37.0 8 36.1135 37.0 37.0 37.0 37.0 37.0 9 36.0505 37.0 37.0 37.0 37.0 37.0 10-14 35.984899999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.02909999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.0025 37.0 37.0 37.0 37.0 37.0 25-29 35.8966 37.0 37.0 37.0 37.0 37.0 30-34 35.8082 37.0 37.0 37.0 37.0 37.0 35-39 35.8664 37.0 37.0 37.0 37.0 37.0 40-44 35.71070000000001 37.0 37.0 37.0 37.0 37.0 45-49 35.7205 37.0 37.0 37.0 37.0 37.0 50-54 35.7401 37.0 37.0 37.0 37.0 37.0 55-59 35.546800000000005 37.0 37.0 37.0 37.0 37.0 60-64 35.5706 37.0 37.0 37.0 37.0 37.0 65-69 35.5647 37.0 37.0 37.0 37.0 37.0 70-74 35.586299999999994 37.0 37.0 37.0 37.0 37.0 75-79 35.5718 37.0 37.0 37.0 37.0 37.0 80-84 35.50359999999999 37.0 37.0 37.0 37.0 37.0 85-89 35.406600000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.439499999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.360299999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.353300000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.285700000000006 37.0 37.0 37.0 37.0 37.0 110-114 35.352 37.0 37.0 37.0 37.0 37.0 115-119 35.2259 37.0 37.0 37.0 34.6 37.0 120-124 35.29639999999999 37.0 37.0 37.0 34.6 37.0 125-129 34.8187 37.0 37.0 37.0 29.8 37.0 130-134 35.0824 37.0 37.0 37.0 25.0 37.0 135-139 34.8821 37.0 37.0 37.0 25.0 37.0 140-144 35.0196 37.0 37.0 37.0 25.0 37.0 145-149 34.7894 37.0 37.0 37.0 25.0 37.0 150-151 34.48825 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 6.0 14 9.0 15 8.0 16 3.0 17 2.0 18 2.0 19 6.0 20 4.0 21 6.0 22 10.0 23 9.0 24 16.0 25 16.0 26 16.0 27 21.0 28 23.0 29 17.0 30 28.0 31 50.0 32 65.0 33 126.0 34 208.0 35 675.0 36 2442.0 37 231.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.225 22.0 10.525 21.25 2 28.325 26.025 29.175 16.475 3 22.400000000000002 28.225 31.525 17.849999999999998 4 25.525 34.150000000000006 23.7 16.625 5 26.3 35.8 21.175 16.725 6 20.674999999999997 38.824999999999996 24.0 16.5 7 21.95 21.475 36.9 19.675 8 22.55 25.2 27.925 24.325 9 23.35 24.75 29.75 22.15 10-14 24.845 29.494999999999997 25.525 20.135 15-19 24.2 27.735 28.16 19.905 20-24 23.86 28.015 28.225 19.900000000000002 25-29 23.615 28.994999999999997 27.455000000000002 19.935 30-34 24.205 28.02 27.735 20.04 35-39 23.455000000000002 28.73 27.339999999999996 20.474999999999998 40-44 23.89 28.389999999999997 27.79 19.93 45-49 23.244999999999997 28.110000000000003 28.605000000000004 20.04 50-54 23.175 29.28 27.694999999999997 19.85 55-59 24.285 28.415000000000003 28.225 19.075 60-64 23.415 28.360000000000003 27.685 20.54 65-69 23.745 28.560000000000002 27.68 20.015 70-74 24.18 27.975 27.82 20.025000000000002 75-79 23.705000000000002 29.025000000000002 27.655 19.615 80-84 23.865 28.13 28.12 19.885 85-89 23.695 29.035 27.855 19.415 90-94 23.244999999999997 28.79 27.785 20.18 95-99 23.580000000000002 28.07 28.139999999999997 20.21 100-104 24.015 28.470000000000002 27.725 19.79 105-109 23.525 28.439999999999998 28.23 19.805 110-114 24.125 28.555000000000003 27.529999999999998 19.79 115-119 24.415 28.665000000000003 27.51 19.41 120-124 24.490000000000002 28.305000000000003 28.155 19.05 125-129 24.765 28.335 27.250000000000004 19.650000000000002 130-134 25.515 28.389999999999997 26.950000000000003 19.145 135-139 25.885 28.134999999999998 27.515 18.465 140-144 25.83 27.675 27.77 18.725 145-149 25.845000000000002 28.22 27.165 18.77 150-151 26.375 27.900000000000002 26.9125 18.8125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 1.0 5 1.0 6 0.0 7 1.0 8 3.0 9 3.0 10 1.0 11 1.0 12 2.0 13 1.0 14 0.5 15 1.0 16 1.5 17 1.0 18 1.5 19 2.5 20 2.5 21 3.0 22 3.5 23 3.5 24 3.0 25 3.0 26 5.5 27 8.5 28 12.0 29 11.0 30 11.5 31 18.5 32 26.5 33 31.5 34 49.5 35 71.0 36 93.0 37 109.5 38 134.5 39 176.5 40 203.0 41 236.0 42 256.0 43 266.0 44 292.5 45 287.0 46 258.5 47 252.0 48 221.5 49 179.5 50 163.0 51 132.0 52 98.0 53 83.5 54 63.5 55 50.0 56 38.0 57 24.5 58 19.5 59 11.0 60 7.0 61 8.5 62 7.0 63 5.0 64 3.0 65 0.5 66 1.0 67 0.5 68 1.5 69 1.5 70 1.0 71 2.0 72 1.5 73 1.0 74 0.5 75 0.0 76 0.5 77 2.0 78 3.0 79 1.5 80 0.5 81 1.5 82 1.0 83 1.0 84 1.0 85 0.5 86 1.0 87 1.0 88 2.0 89 1.5 90 0.0 91 0.5 92 0.5 93 0.5 94 1.0 95 0.5 96 0.5 97 0.5 98 0.5 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.55 #Duplication Level Percentage of deduplicated Percentage of total 1 89.10220214568041 78.9 2 9.345002823263693 16.55 3 1.2140033879164314 3.225 4 0.2258610954263128 0.8 5 0.08469791078486731 0.375 6 0.0282326369282891 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit AATTGCCAAGGCGCCATGTTATGGCATGAGGGAGAGGCTGAAGGCAGATG 5 0.125 No Hit CAGTAGTGAAGATAGTGAAGGGAAAGAAGGTTTGTGACAAGGGATGGGAA 5 0.125 No Hit ACCAGGTCCAGACATAGTAAGGATTGACAGACTGAGAGCTCTTTCTTGAT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.5874999999999999 0.0 0.0 0.0 0.0 90-91 0.7375 0.0 0.0 0.0 0.0 92-93 0.8375 0.0 0.0 0.0 0.0 94-95 0.975 0.0 0.0 0.0 0.0 96-97 1.1625 0.0 0.0 0.0 0.0 98-99 1.4500000000000002 0.0 0.0 0.0 0.0 100-101 1.6875 0.0 0.0 0.0 0.0 102-103 1.9125 0.0 0.0 0.0 0.0 104-105 2.2249999999999996 0.0 0.0 0.0 0.0 106-107 2.75 0.0 0.0 0.0 0.0 108-109 3.125 0.0 0.0 0.0 0.0 110-111 3.55 0.0 0.0 0.0 0.0 112-113 3.8375 0.0 0.0 0.0 0.0 114-115 4.225 0.0 0.0 0.0 0.0 116-117 4.75 0.0 0.0 0.0 0.0 118-119 5.2375 0.0 0.0 0.0 0.0 120-121 5.725 0.0 0.0 0.0 0.0 122-123 6.2875 0.0 0.0 0.0 0.0 124-125 6.862500000000001 0.0 0.0 0.0 0.0 126-127 7.637499999999999 0.0 0.0 0.0 0.0 128-129 8.1625 0.0 0.0 0.0 0.0 130-131 8.7 0.0 0.0 0.0 0.0 132-133 9.3125 0.0 0.0 0.0 0.0 134-135 9.8875 0.0 0.0 0.0 0.0 136-137 10.587499999999999 0.0 0.0 0.0 0.0 138-139 11.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACGAGTG 10 0.006830828 145.0 7 TACGAGT 10 0.006830828 145.0 6 CGAGTGT 10 0.006830828 145.0 8 >>END_MODULE Read 1640251 spots for SRR28623237.sra Written 1640251 spots for SRR28623237.sra Read 1640251 spots for SRR28623237.sra Written 1640251 spots for SRR28623237.sra Read 1640251 spots for SRR28623237.sra Written 1640251 spots for SRR28623237.sra Read 1640251 spots for SRR28623237.sra Written 1640251 spots for SRR28623237.sra Read 1640251 spots for SRR28623237.sra Written 1640251 spots for SRR28623237.sra Read 1640251 spots for SRR28623237.sra Written 1640251 spots for SRR28623237.sra Read 1640251 spots for SRR28623237.sra Written 1640251 spots for SRR28623237.sra Read 1640251 spots for SRR28623237.sra Written 1640251 spots for SRR28623237.sra Read 1640268 spots for SRR28623237.sra Written 1640268 spots for SRR28623237.sra Read 1640251 spots for SRR28623237.sra Written 1640251 spots for SRR28623237.sra Read 1640251 spots for SRR28623237.sra Written 1640251 spots for SRR28623237.sra Read 1640251 spots for SRR28623237.sra Written 1640251 spots for SRR28623237.sra Read 1640251 spots for SRR28623237.sra Written 1640251 spots for SRR28623237.sra Read 1640251 spots for SRR28623237.sra Written 1640251 spots for SRR28623237.sra Read 1640251 spots for SRR28623237.sra Written 1640251 spots for SRR28623237.sra Read 1640251 spots for SRR28623237.sra Written 1640251 spots for SRR28623237.sra Read 1640251 spots for SRR28623237.sra Written 1640251 spots for SRR28623237.sra Read 1640251 spots for SRR28623237.sra Written 1640251 spots for SRR28623237.sra Read 1640251 spots for SRR28623237.sra Written 1640251 spots for SRR28623237.sra Read 1640251 spots for SRR28623237.sra Written 1640251 spots for SRR28623237.sra SRR ids: ['SRR28623237.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_oi0t43fm SRR28623237.sra spots: 32805037 blocks: [[1, 1640251], [1640252, 3280502], [3280503, 4920753], [4920754, 6561004], [6561005, 8201255], [8201256, 9841506], [9841507, 11481757], [11481758, 13122008], [13122009, 14762259], [14762260, 16402510], [16402511, 18042761], [18042762, 19683012], [19683013, 21323263], [21323264, 22963514], [22963515, 24603765], [24603766, 26244016], [26244017, 27884267], [27884268, 29524518], [29524519, 31164769], [31164770, 32805037]] SRR28623237 file size 12113721 SRR28623237 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623237 SRR28623237_1.fastq SRR28623237_2.fastq Input file: SRR28623237_1.fastq Paired file: SRR28623237_2.fastq trimmed: SRR28623237-trimmed-pair1.fastq, SRR28623237-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 15:20:30 2025 >> started Thu Feb 13 15:21:09 2025 >> done (39.102s) 32805037 read pairs processed; of these: 36 ( 0.00%) short read pairs filtered out after trimming by size control 29236 ( 0.09%) empty read pairs filtered out after trimming by size control 32775765 (99.91%) read pairs available; of these: 4909423 (14.98%) trimmed read pairs available after processing 27866342 (85.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 5 0.00% 20 1 0.00% 21 3 0.00% 22 7 0.00% 23 7 0.00% 24 7 0.00% 25 8 0.00% 26 5 0.00% 27 10 0.00% 28 6 0.00% 29 11 0.00% 30 22 0.00% 31 14 0.00% 32 13 0.00% 33 11 0.00% 34 13 0.00% 35 22 0.00% 36 30 0.00% 37 39 0.00% 38 44 0.00% 39 40 0.00% 40 46 0.00% 41 53 0.00% 42 61 0.00% 43 66 0.00% 44 69 0.00% 45 74 0.00% 46 97 0.00% 47 133 0.00% 48 105 0.00% 49 168 0.00% 50 191 0.00% 51 200 0.00% 52 242 0.00% 53 276 0.00% 54 306 0.00% 55 360 0.00% 56 394 0.00% 57 465 0.00% 58 509 0.00% 59 623 0.00% 60 691 0.00% 61 862 0.00% 62 968 0.00% 63 1068 0.00% 64 1343 0.00% 65 1426 0.00% 66 1570 0.00% 67 1793 0.01% 68 2049 0.01% 69 2286 0.01% 70 2762 0.01% 71 3153 0.01% 72 3721 0.01% 73 4186 0.01% 74 4708 0.01% 75 5507 0.02% 76 5952 0.02% 77 6363 0.02% 78 7194 0.02% 79 8106 0.02% 80 8879 0.03% 81 10293 0.03% 82 11625 0.04% 83 12640 0.04% 84 14142 0.04% 85 15854 0.05% 86 16879 0.05% 87 18286 0.06% 88 19852 0.06% 89 21173 0.06% 90 22443 0.07% 91 24783 0.08% 92 26856 0.08% 93 29405 0.09% 94 31433 0.10% 95 32989 0.10% 96 35131 0.11% 97 37158 0.11% 98 38295 0.12% 99 40212 0.12% 100 42452 0.13% 101 44197 0.13% 102 46791 0.14% 103 48927 0.15% 104 50860 0.16% 105 53707 0.16% 106 55509 0.17% 107 57467 0.18% 108 58870 0.18% 109 61042 0.19% 110 61795 0.19% 111 63732 0.19% 112 67171 0.20% 113 67930 0.21% 114 70278 0.21% 115 72493 0.22% 116 74507 0.23% 117 76577 0.23% 118 78149 0.24% 119 78435 0.24% 120 80461 0.25% 121 82161 0.25% 122 83641 0.26% 123 85446 0.26% 124 87412 0.27% 125 88775 0.27% 126 91259 0.28% 127 93000 0.28% 128 93767 0.29% 129 95045 0.29% 130 96637 0.29% 131 97402 0.30% 132 99109 0.30% 133 100108 0.31% 134 100718 0.31% 135 102908 0.31% 136 104511 0.32% 137 104806 0.32% 138 105906 0.32% 139 107207 0.33% 140 107555 0.33% 141 109538 0.33% 142 110444 0.34% 143 110374 0.34% 144 112313 0.34% 145 112730 0.34% 146 113314 0.35% 147 114777 0.35% 148 115400 0.35% 149 115963 0.35% 150 117050 0.36% 151 27866342 85.02% 32775765 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=13.44 fanout-score-rank=15 prefix-density=0.11 prefix-fanout=13.4 sequence=GGATCGGAAGAGCACACGTCTGAACTCCAGTCACTATTCGCCATCTCGTATGCCGTCTTCTGCTTG criterion=fanout-score sequence-density=0.07 sequence-density-rank=16 fanout-score=554.80 fanout-score-rank=1 prefix-density=1.04 prefix-fanout=36.1 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=40 prefix-density=0.12 prefix-fanout=2.2 sequence=CCAGACCAGCAGAGG criterion=fanout-score sequence-density=0.06 sequence-density-rank=30 fanout-score=395.03 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=35.3 sequence=TGAAGAAGAAGGG SRR28623237 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 15:21:49 Started mapping on | Feb 13 15:21:49 Finished on | Feb 13 15:25:05 Mapping speed, Million of reads per hour | 602.00 Number of input reads | 32775765 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 30525740 Uniquely mapped reads % | 93.14% Average mapped length | 292.22 Number of splices: Total | 28678969 Number of splices: Annotated (sjdb) | 28033989 Number of splices: GT/AG | 28185696 Number of splices: GC/AG | 384472 Number of splices: AT/AC | 26238 Number of splices: Non-canonical | 82563 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.90 Insertion rate per base | 0.03% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 852550 % of reads mapped to multiple loci | 2.60% Number of reads mapped to too many loci | 100681 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.72% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1397475 1397475 1397475 N_multimapping 852550 852550 852550 N_noFeature 1183840 30172467 1367811 N_ambiguous 343809 2538 172674 UnstrandedReadsAssigned:28998091 PositiveStrandReadsAssigned:350735 NegativeStrandReadsAssigned:28985255 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623237 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623237-trimmed-pair1.fastq SRR28623237-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,775,765 reads, 29,347,894 reads pseudoaligned [quant] estimated average fragment length: 232.936 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,084 rounds 52401 SRR28623237.ke.tsv 34699 SRR28623237.se.tsv 87100 total ==> SRR28623237.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1786.06 3460 69.3804 Potri.005G024800.1.v4.1 1035 803.064 5739 255.943 Potri.004G059700.1.v4.1 961 729.092 62 3.04556 Potri.007G009000.2.v4.1 1416 1184.06 0 0 Potri.003G141000.2.v4.1 2943 2711.06 1219.78 16.1139 Potri.016G087400.1.v4.1 270 93.734 2581.67 986.418 Potri.015G069301.1.v4.1 564 338.849 0 0 Potri.010G195200.1.v4.1 1773 1541.06 381.941 8.87634 Potri.012G127500.1.v4.1 977 745.081 2688 129.206 ==> SRR28623237.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1141 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 406 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 79 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR28623237 completed mapping pipeline successfully