Starting /dee2/code/volunteer_pipeline.sh SRR28623239 current disk space = 3088984793088 free memory = 1447453152 SRR28623239 SRAfilesize eae45dc98b94f33d14dc3ae14bfcfc4c SRR28623239.sra SRR28623239.sra file validated SRR28623239 is paired end SRR28623239 is conventional basespace SRR28623239 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623239_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.43275 37.0 37.0 37.0 37.0 37.0 2 36.601 37.0 37.0 37.0 37.0 37.0 3 36.628 37.0 37.0 37.0 37.0 37.0 4 36.647 37.0 37.0 37.0 37.0 37.0 5 36.7265 37.0 37.0 37.0 37.0 37.0 6 36.613 37.0 37.0 37.0 37.0 37.0 7 36.5845 37.0 37.0 37.0 37.0 37.0 8 36.5805 37.0 37.0 37.0 37.0 37.0 9 36.637 37.0 37.0 37.0 37.0 37.0 10-14 36.605900000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.572500000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.5642 37.0 37.0 37.0 37.0 37.0 25-29 36.548899999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.494099999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.422599999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.373200000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.276599999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.332499999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.1603 37.0 37.0 37.0 37.0 37.0 60-64 36.148 37.0 37.0 37.0 37.0 37.0 65-69 36.102700000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.0803 37.0 37.0 37.0 37.0 37.0 75-79 36.1311 37.0 37.0 37.0 37.0 37.0 80-84 36.052 37.0 37.0 37.0 37.0 37.0 85-89 36.097300000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.0801 37.0 37.0 37.0 37.0 37.0 95-99 35.9173 37.0 37.0 37.0 37.0 37.0 100-104 35.932100000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.955200000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.8018 37.0 37.0 37.0 37.0 37.0 115-119 35.9035 37.0 37.0 37.0 37.0 37.0 120-124 35.7767 37.0 37.0 37.0 37.0 37.0 125-129 35.6981 37.0 37.0 37.0 37.0 37.0 130-134 35.8081 37.0 37.0 37.0 37.0 37.0 135-139 35.6601 37.0 37.0 37.0 37.0 37.0 140-144 35.4374 37.0 37.0 37.0 37.0 37.0 145-149 35.4653 37.0 37.0 37.0 37.0 37.0 150-151 35.23075 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 3.0 23 2.0 24 0.0 25 10.0 26 9.0 27 5.0 28 16.0 29 29.0 30 32.0 31 38.0 32 46.0 33 92.0 34 147.0 35 373.0 36 2906.0 37 290.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.13493855028844 12.766491096062202 14.823175319789314 46.27539503386004 2 18.45 16.400000000000002 35.525 29.625 3 18.7 18.65 26.450000000000003 36.199999999999996 4 21.15 25.75 24.25 28.849999999999998 5 23.200000000000003 31.7 24.075 21.025 6 21.175 37.625 22.35 18.85 7 14.05 30.225 38.975 16.75 8 18.825 29.049999999999997 29.599999999999998 22.525000000000002 9 18.425 25.6 33.75 22.225 10-14 18.435000000000002 31.46 27.595 22.509999999999998 15-19 19.42 29.020000000000003 27.425 24.135 20-24 19.28 30.380000000000003 27.66 22.68 25-29 18.63 29.705 27.889999999999997 23.775 30-34 18.795 29.725 27.474999999999998 24.005000000000003 35-39 19.725 29.57 27.6 23.105 40-44 18.925 29.635 27.54 23.9 45-49 19.545 29.01 27.834999999999997 23.61 50-54 19.705000000000002 28.994999999999997 27.38 23.919999999999998 55-59 18.77 30.064999999999998 27.474999999999998 23.69 60-64 19.66 28.92 27.785 23.635 65-69 19.814999999999998 28.849999999999998 28.08 23.255 70-74 20.044999999999998 28.935 27.779999999999998 23.24 75-79 20.585 28.365000000000002 27.305 23.745 80-84 20.43 28.89 27.04 23.64 85-89 19.965 29.310000000000002 27.255000000000003 23.47 90-94 20.515 29.160000000000004 27.41 22.915 95-99 20.919999999999998 28.634999999999998 27.139999999999997 23.305 100-104 20.79 28.854999999999997 27.155 23.200000000000003 105-109 21.43 29.505 26.36 22.705000000000002 110-114 21.05 28.735 27.175 23.04 115-119 20.705000000000002 28.849999999999998 26.77 23.674999999999997 120-124 21.445 28.444999999999997 26.85 23.26 125-129 21.22 28.17 26.805 23.805 130-134 21.05 29.189999999999998 26.245 23.515 135-139 21.145 28.48 26.41 23.965 140-144 21.615000000000002 28.189999999999998 27.029999999999998 23.165 145-149 22.31 27.565 26.590000000000003 23.535 150-151 21.762500000000003 28.962500000000002 26.1625 23.1125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 1.5 18 1.5 19 0.5 20 0.0 21 0.0 22 1.5 23 1.5 24 3.0 25 7.5 26 8.0 27 10.0 28 12.5 29 15.0 30 25.5 31 33.5 32 42.0 33 54.0 34 71.5 35 95.5 36 108.5 37 123.5 38 149.5 39 201.0 40 229.0 41 223.5 42 240.0 43 245.5 44 258.5 45 270.5 46 242.5 47 202.5 48 176.5 49 170.5 50 156.0 51 128.5 52 114.0 53 89.0 54 61.0 55 53.0 56 35.0 57 21.5 58 20.0 59 20.5 60 17.0 61 9.5 62 5.5 63 1.5 64 4.0 65 7.5 66 9.5 67 7.5 68 5.0 69 4.0 70 1.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 84.7735399284863 71.125 2 12.604290822407629 21.15 3 2.1454112038140645 5.4 4 0.29797377830750893 1.0 5 0.08939213349225268 0.375 6 0.02979737783075089 0.15 7 0.0 0.0 8 0.0 0.0 9 0.02979737783075089 0.22499999999999998 >10 0.02979737783075089 0.575 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTGGACGTATCTCGTAT 23 0.575 TruSeq Adapter, Index 3 (97% over 37bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTGGACGTATCGCGTAT 9 0.22499999999999998 TruSeq Adapter, Index 3 (97% over 37bp) CACAACAATAGATGAACATTGAATTCAATTTCTAAATTGCTCCATTCAGC 6 0.15 No Hit AGACAGTGGTGACAATACAAGATGTGCTAAAGAATTAGTCTCAAGTTGAG 5 0.125 No Hit GACAAAATCATGAATCATCTGACCTCCAAATGACTGCTTAAACTGACCAT 5 0.125 No Hit CAAGCTTTGCATGAGCTGCGATGAATATCATCTTCTGAGCCCTTTCAAGG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.11249999999999999 0.0 0.0 0.0 0.0 66-67 0.16249999999999998 0.0 0.0 0.0 0.0 68-69 0.1875 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.2375 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.425 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.725 0.0 0.0 0.0 0.0 94-95 0.9125 0.0 0.0 0.0 0.0 96-97 1.2125 0.0 0.0 0.0 0.0 98-99 1.4 0.0 0.0 0.0 0.0 100-101 1.775 0.0 0.0 0.0 0.0 102-103 2.375 0.0 0.0 0.0 0.0 104-105 2.7 0.0 0.0 0.0 0.0 106-107 3.1875 0.0 0.0 0.0 0.0 108-109 3.75 0.0 0.0 0.0 0.0 110-111 4.2125 0.0 0.0 0.0 0.0 112-113 4.6125 0.0 0.0 0.0 0.0 114-115 5.0125 0.0 0.0 0.0 0.0 116-117 5.550000000000001 0.0 0.0 0.0 0.0 118-119 6.225 0.0 0.0 0.0 0.0 120-121 6.9875 0.0 0.0 0.0 0.0 122-123 7.5875 0.0 0.0 0.0 0.0 124-125 8.225000000000001 0.0 0.0 0.0 0.0 126-127 8.7875 0.0 0.0 0.0 0.0 128-129 9.4 0.0 0.0 0.0 0.0 130-131 9.9875 0.0 0.0 0.0 0.0 132-133 10.6375 0.0 0.0 0.0 0.0 134-135 11.225 0.0 0.0 0.0 0.0 136-137 12.0125 0.0 0.0 0.0 0.0 138-139 12.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTAAAA 10 0.006830828 145.0 2 GGGGGGG 35 0.0035366106 20.714287 140-144 >>END_MODULE SRR28623239 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623239_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9745 37.0 37.0 37.0 37.0 37.0 2 36.44 37.0 37.0 37.0 37.0 37.0 3 36.298 37.0 37.0 37.0 37.0 37.0 4 36.2305 37.0 37.0 37.0 37.0 37.0 5 36.434 37.0 37.0 37.0 37.0 37.0 6 36.316 37.0 37.0 37.0 37.0 37.0 7 36.4095 37.0 37.0 37.0 37.0 37.0 8 36.4 37.0 37.0 37.0 37.0 37.0 9 36.2275 37.0 37.0 37.0 37.0 37.0 10-14 36.160799999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.175 37.0 37.0 37.0 37.0 37.0 20-24 36.187200000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.0831 37.0 37.0 37.0 37.0 37.0 30-34 35.9946 37.0 37.0 37.0 37.0 37.0 35-39 36.00450000000001 37.0 37.0 37.0 37.0 37.0 40-44 35.9211 37.0 37.0 37.0 37.0 37.0 45-49 35.9356 37.0 37.0 37.0 37.0 37.0 50-54 35.91940000000001 37.0 37.0 37.0 37.0 37.0 55-59 35.8531 37.0 37.0 37.0 37.0 37.0 60-64 35.8233 37.0 37.0 37.0 37.0 37.0 65-69 35.844800000000006 37.0 37.0 37.0 37.0 37.0 70-74 35.8867 37.0 37.0 37.0 37.0 37.0 75-79 35.8673 37.0 37.0 37.0 37.0 37.0 80-84 35.735200000000006 37.0 37.0 37.0 37.0 37.0 85-89 35.6666 37.0 37.0 37.0 37.0 37.0 90-94 35.703 37.0 37.0 37.0 37.0 37.0 95-99 35.7547 37.0 37.0 37.0 37.0 37.0 100-104 35.6704 37.0 37.0 37.0 37.0 37.0 105-109 35.6793 37.0 37.0 37.0 37.0 37.0 110-114 35.693200000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.6391 37.0 37.0 37.0 37.0 37.0 120-124 35.675 37.0 37.0 37.0 37.0 37.0 125-129 35.1596 37.0 37.0 37.0 29.8 37.0 130-134 35.448699999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.2442 37.0 37.0 37.0 32.2 37.0 140-144 35.3401 37.0 37.0 37.0 34.6 37.0 145-149 35.2368 37.0 37.0 37.0 32.2 37.0 150-151 34.87225 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 3.0 15 6.0 16 2.0 17 1.0 18 2.0 19 1.0 20 3.0 21 5.0 22 5.0 23 10.0 24 18.0 25 13.0 26 7.0 27 10.0 28 16.0 29 23.0 30 23.0 31 35.0 32 56.0 33 94.0 34 204.0 35 630.0 36 2573.0 37 260.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.025 19.375 20.150000000000002 32.45 2 29.849999999999998 23.0 29.849999999999998 17.299999999999997 3 21.525 28.749999999999996 29.775000000000002 19.950000000000003 4 24.099999999999998 32.675 23.825 19.400000000000002 5 25.525 34.150000000000006 23.025000000000002 17.299999999999997 6 21.525 40.050000000000004 22.15 16.275000000000002 7 21.349999999999998 20.625 40.025 18.0 8 23.65 24.3 27.474999999999998 24.575 9 22.325 25.424999999999997 29.325000000000003 22.925 10-14 23.73 29.665000000000003 26.405 20.200000000000003 15-19 23.74 28.235 27.744999999999997 20.28 20-24 23.93 28.07 27.87 20.13 25-29 23.91 28.444999999999997 27.355 20.29 30-34 23.794999999999998 27.595 28.735 19.875 35-39 24.38 28.044999999999998 27.815 19.759999999999998 40-44 24.22 28.34 27.775 19.665 45-49 23.715 27.43 28.904999999999998 19.950000000000003 50-54 24.23 27.72 28.485 19.564999999999998 55-59 23.44 27.725 28.96 19.875 60-64 23.78 27.779999999999998 28.08 20.36 65-69 23.724999999999998 27.839999999999996 28.375 20.06 70-74 23.015 28.310000000000002 28.54 20.135 75-79 23.02 28.515 28.425 20.04 80-84 23.93 27.944999999999997 28.660000000000004 19.465 85-89 23.64 28.694999999999997 28.249999999999996 19.415 90-94 24.27 27.67 28.970000000000002 19.09 95-99 24.865000000000002 28.444999999999997 27.334999999999997 19.355 100-104 24.03 28.32 28.199999999999996 19.45 105-109 25.275 27.47 27.565 19.689999999999998 110-114 24.92 28.59 26.665 19.825 115-119 25.345000000000002 27.779999999999998 27.389999999999997 19.485 120-124 25.205 28.21 27.85 18.735 125-129 25.395 28.810000000000002 27.37 18.425 130-134 26.185000000000002 27.284999999999997 28.29 18.240000000000002 135-139 26.584999999999997 27.855 27.245 18.315 140-144 26.575 27.955000000000002 27.12 18.35 145-149 26.55 27.525 27.765 18.16 150-151 27.9125 27.6875 26.3625 18.0375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.5 11 1.0 12 0.5 13 1.0 14 1.5 15 1.0 16 1.0 17 0.5 18 0.5 19 1.0 20 0.5 21 0.0 22 1.5 23 3.0 24 3.0 25 2.5 26 4.0 27 5.5 28 6.0 29 11.0 30 16.5 31 22.0 32 29.5 33 50.0 34 55.5 35 62.0 36 89.5 37 110.0 38 145.0 39 172.0 40 215.0 41 256.5 42 277.0 43 282.5 44 270.5 45 268.5 46 260.0 47 242.5 48 221.0 49 200.0 50 157.0 51 115.5 52 95.0 53 78.5 54 63.0 55 46.0 56 32.5 57 20.5 58 16.5 59 16.5 60 10.5 61 6.5 62 5.5 63 6.5 64 4.5 65 1.0 66 1.0 67 1.0 68 1.0 69 2.5 70 3.5 71 2.5 72 1.0 73 1.0 74 1.5 75 1.5 76 1.0 77 0.5 78 1.0 79 2.0 80 2.0 81 1.0 82 1.0 83 1.0 84 1.0 85 0.5 86 0.5 87 1.0 88 1.0 89 0.5 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.55 #Duplication Level Percentage of deduplicated Percentage of total 1 85.00887049083381 71.875 2 12.270845653459492 20.75 3 2.247191011235955 5.7 4 0.384387936132466 1.3 5 0.08870490833826139 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTTGACTGGAAAGATGAAAATTGCAAATCCTCAAGGCAGCAGACTAGTA 5 0.125 No Hit GCTAAGTTGCTACTCTCTCTGTCTCACTGCTTCTGTGTTTCCAAATCTAT 5 0.125 No Hit TTGGTGAACAAAGCTGGTAATGCTGTTCAAACTGCAAAGGAATCAGTCGT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.025 0.0 0.0 0.025 0.0 58-59 0.025 0.0 0.0 0.025 0.0 60-61 0.037500000000000006 0.0 0.0 0.025 0.0 62-63 0.075 0.0 0.0 0.025 0.0 64-65 0.075 0.0 0.0 0.025 0.0 66-67 0.0875 0.0 0.0 0.025 0.0 68-69 0.1125 0.0 0.0 0.025 0.0 70-71 0.15 0.0 0.0 0.025 0.0 72-73 0.16249999999999998 0.0 0.0 0.025 0.0 74-75 0.175 0.0 0.0 0.025 0.0 76-77 0.175 0.0 0.0 0.025 0.0 78-79 0.1875 0.0 0.0 0.025 0.0 80-81 0.225 0.0 0.0 0.025 0.0 82-83 0.2625 0.0 0.0 0.025 0.0 84-85 0.2875 0.0 0.0 0.025 0.0 86-87 0.35 0.0 0.0 0.025 0.0 88-89 0.4 0.0 0.0 0.025 0.0 90-91 0.48750000000000004 0.0 0.0 0.025 0.0 92-93 0.625 0.0 0.0 0.025 0.0 94-95 0.8125 0.0 0.0 0.025 0.0 96-97 1.1124999999999998 0.0 0.0 0.025 0.0 98-99 1.2999999999999998 0.0 0.0 0.025 0.0 100-101 1.6749999999999998 0.0 0.0 0.025 0.0 102-103 2.275 0.0 0.0 0.025 0.0 104-105 2.5999999999999996 0.0 0.0 0.025 0.0 106-107 3.0374999999999996 0.0 0.0 0.025 0.0 108-109 3.6125 0.0 0.0 0.025 0.0 110-111 4.0875 0.0 0.0 0.025 0.0 112-113 4.4875 0.0 0.0 0.025 0.0 114-115 4.9125 0.0 0.0 0.025 0.0 116-117 5.449999999999999 0.0 0.0 0.025 0.0 118-119 6.0625 0.0 0.0 0.025 0.0 120-121 6.7875 0.0 0.0 0.025 0.0 122-123 7.4 0.0 0.0 0.025 0.0 124-125 8.0625 0.0 0.0 0.025 0.0 126-127 8.6875 0.0 0.0 0.025 0.0 128-129 9.375 0.0 0.0 0.025 0.0 130-131 9.9375 0.0 0.0 0.025 0.0 132-133 10.6125 0.0 0.0 0.025 0.0 134-135 11.2 0.0 0.0 0.025 0.0 136-137 11.9875 0.0 0.0 0.025 0.0 138-139 12.8 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGATGT 10 0.006830828 145.0 3 >>END_MODULE Read 1465330 spots for SRR28623239.sra Written 1465330 spots for SRR28623239.sra Read 1465330 spots for SRR28623239.sra Written 1465330 spots for SRR28623239.sra Read 1465330 spots for SRR28623239.sra Written 1465330 spots for SRR28623239.sra Read 1465330 spots for SRR28623239.sra Written 1465330 spots for SRR28623239.sra Read 1465330 spots for SRR28623239.sra Written 1465330 spots for SRR28623239.sra Read 1465330 spots for SRR28623239.sra Written 1465330 spots for SRR28623239.sra Read 1465330 spots for SRR28623239.sra Written 1465330 spots for SRR28623239.sra Read 1465330 spots for SRR28623239.sra Written 1465330 spots for SRR28623239.sra Read 1465330 spots for SRR28623239.sra Written 1465330 spots for SRR28623239.sra Read 1465330 spots for SRR28623239.sra Written 1465330 spots for SRR28623239.sra Read 1465330 spots for SRR28623239.sra Written 1465330 spots for SRR28623239.sra Read 1465330 spots for SRR28623239.sra Written 1465330 spots for SRR28623239.sra Read 1465330 spots for SRR28623239.sra Written 1465330 spots for SRR28623239.sra Read 1465330 spots for SRR28623239.sra Written 1465330 spots for SRR28623239.sra Read 1465330 spots for SRR28623239.sra Written 1465330 spots for SRR28623239.sra Read 1465330 spots for SRR28623239.sra Written 1465330 spots for SRR28623239.sra Read 1465343 spots for SRR28623239.sra Written 1465343 spots for SRR28623239.sra Read 1465330 spots for SRR28623239.sra Written 1465330 spots for SRR28623239.sra Read 1465330 spots for SRR28623239.sra Written 1465330 spots for SRR28623239.sra Read 1465330 spots for SRR28623239.sra Written 1465330 spots for SRR28623239.sra SRR ids: ['SRR28623239.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6h68b39d SRR28623239.sra spots: 29306613 blocks: [[1, 1465330], [1465331, 2930660], [2930661, 4395990], [4395991, 5861320], [5861321, 7326650], [7326651, 8791980], [8791981, 10257310], [10257311, 11722640], [11722641, 13187970], [13187971, 14653300], [14653301, 16118630], [16118631, 17583960], [17583961, 19049290], [19049291, 20514620], [20514621, 21979950], [21979951, 23445280], [23445281, 24910610], [24910611, 26375940], [26375941, 27841270], [27841271, 29306613]] SRR28623239 file size 10820724 SRR28623239 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623239 SRR28623239_1.fastq SRR28623239_2.fastq Input file: SRR28623239_1.fastq Paired file: SRR28623239_2.fastq trimmed: SRR28623239-trimmed-pair1.fastq, SRR28623239-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 15:24:39 2025 >> started Thu Feb 13 15:25:11 2025 >> done (32.358s) 29306613 read pairs processed; of these: 20 ( 0.00%) short read pairs filtered out after trimming by size control 196401 ( 0.67%) empty read pairs filtered out after trimming by size control 29110192 (99.33%) read pairs available; of these: 5266741 (18.09%) trimmed read pairs available after processing 23843451 (81.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 3 0.00% 21 5 0.00% 22 3 0.00% 23 5 0.00% 24 6 0.00% 25 11 0.00% 26 8 0.00% 27 3 0.00% 28 19 0.00% 29 13 0.00% 30 19 0.00% 31 13 0.00% 32 20 0.00% 33 26 0.00% 34 31 0.00% 35 28 0.00% 36 27 0.00% 37 40 0.00% 38 43 0.00% 39 53 0.00% 40 50 0.00% 41 70 0.00% 42 83 0.00% 43 86 0.00% 44 85 0.00% 45 101 0.00% 46 97 0.00% 47 159 0.00% 48 147 0.00% 49 187 0.00% 50 208 0.00% 51 242 0.00% 52 281 0.00% 53 285 0.00% 54 277 0.00% 55 364 0.00% 56 418 0.00% 57 458 0.00% 58 473 0.00% 59 638 0.00% 60 718 0.00% 61 882 0.00% 62 978 0.00% 63 1151 0.00% 64 1300 0.00% 65 1375 0.00% 66 1590 0.01% 67 1872 0.01% 68 2038 0.01% 69 2309 0.01% 70 2690 0.01% 71 2965 0.01% 72 3609 0.01% 73 4261 0.01% 74 4624 0.02% 75 5335 0.02% 76 5975 0.02% 77 6487 0.02% 78 7060 0.02% 79 7872 0.03% 80 8845 0.03% 81 10122 0.03% 82 11480 0.04% 83 13071 0.04% 84 14466 0.05% 85 15964 0.05% 86 17525 0.06% 87 18607 0.06% 88 20075 0.07% 89 21232 0.07% 90 23142 0.08% 91 25169 0.09% 92 27038 0.09% 93 29444 0.10% 94 32542 0.11% 95 34778 0.12% 96 37063 0.13% 97 38680 0.13% 98 40618 0.14% 99 42081 0.14% 100 43669 0.15% 101 45911 0.16% 102 48445 0.17% 103 50768 0.17% 104 53555 0.18% 105 56910 0.20% 106 59016 0.20% 107 61842 0.21% 108 62745 0.22% 109 64721 0.22% 110 65611 0.23% 111 67385 0.23% 112 69082 0.24% 113 71693 0.25% 114 74264 0.26% 115 77966 0.27% 116 80444 0.28% 117 82370 0.28% 118 85176 0.29% 119 85580 0.29% 120 86101 0.30% 121 88475 0.30% 122 89025 0.31% 123 90333 0.31% 124 93482 0.32% 125 95743 0.33% 126 98493 0.34% 127 101071 0.35% 128 102409 0.35% 129 102786 0.35% 130 104632 0.36% 131 106075 0.36% 132 105732 0.36% 133 108443 0.37% 134 108563 0.37% 135 109369 0.38% 136 112960 0.39% 137 114610 0.39% 138 115998 0.40% 139 118175 0.41% 140 119311 0.41% 141 119056 0.41% 142 120076 0.41% 143 120531 0.41% 144 121032 0.42% 145 121928 0.42% 146 123977 0.43% 147 124568 0.43% 148 127441 0.44% 149 127959 0.44% 150 129111 0.44% 151 23843451 81.91% 29110192 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=31 prefix-density=0.23 prefix-fanout=2.1 sequence=TGCGACATGGTTGGCAAGAATCCTTCTGCGAATTTAGCAACAACCGAAGAATCAAGATACTCCTGCAAGCCCTCCAGATCATCAAAGGTAGTTTCAAAAGCATGAGTATATCCGAAATTGAGGTCGTGAATACCCAGATTAGTGCCCCAGTGTAAGCTCTTCAAGGGTTCAACTTGATTGACCAGATGAGTGAAGTCGTTTATGATTTTCTCAATTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=146.42 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=12.1 sequence=AAAACAACAACTCAACCCCAAGGGTTTTATTTTTAAGGAATAGCAGCACTCCCTTCACATAGCACAGCACAAACAAGAAATCAAGACACGAACATTCAGTGGTTCAAAACCAGCATTTATTGCACATTACATTACTTTATTCCCATGAAATAGCCCGGCCGAAGTCGTTACTCCTGAGCATTTAGTAGAGAAAGTAGTCTATCACAAGACGCTGTGACAAAGTAGGCAAAAATCCTTCTGCAAATGCAGCAAGAGCAGCAGAATCGAGGTACTCTTGCAAACCTGACTTGCTCTCAAATGTAGATTCAAAGGCATGAGTGTATCCTCGGTTTAGCTCCGCAGACTCCATGCCCAAATCCGTGCCCCAATTGAAACTCTTCATGGTTGGAATGAGATCGAGCAGATTGGTATAGTCATTAATGTAGTTGTCGATTTGTTCTCGTGTGATCTCATCCTTGAACCGAGTCAACAATGTGTGCTTCACAAGCTTTGGAGTTCTGGTTGCCATGTC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=12.96 fanout-score-rank=13 prefix-density=0.56 prefix-fanout=4.7 sequence=AGAGAGAAAGAGAAGACATGGCAACCAGAACTCCAAAGCTTGTGAAGCACACATTGTTGACTCGGTTCAAGGATGAGATCACACGAGAACAAATCGACAACTACATTAATGACTATACCAATCTGCTCGATCTCATTCCAACCATGAAGAGTTTCAATTGGGGCACGGATTTGGGCATGGAGTCTGCGGAGCTAAACCGAGGATACACTCATGCCTTTGAATCTACATTTGAGAGCAAGTCAGGTTTGCAAGAGTACCTCGATTCTGCTGCTCTTGCTGCATTTGCAGAAGGATTTTTGCCTACTTTGTCACAGCGTCTTGTGATAGACTACTTTCTCTACTAAATGCTCAGGAGTAACGACTTCGGCCGGGCTATTTCATGGGAATAAAGTAATGTAATGTGCAATAAATGCTGGTTTTGAACCACTGAATGTTCGTGTCTTGATTTCTTGTTTGTGCTGTGCTATGTGAAGGGAGT criterion=fanout-score sequence-density=0.09 sequence-density-rank=15 fanout-score=138.19 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=23.1 sequence=GAGAAGAAGGAT SRR28623239 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 15:25:52 Started mapping on | Feb 13 15:25:52 Finished on | Feb 13 15:28:39 Mapping speed, Million of reads per hour | 627.53 Number of input reads | 29110192 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 27372079 Uniquely mapped reads % | 94.03% Average mapped length | 291.05 Number of splices: Total | 23036518 Number of splices: Annotated (sjdb) | 22454274 Number of splices: GT/AG | 22628426 Number of splices: GC/AG | 304740 Number of splices: AT/AC | 22918 Number of splices: Non-canonical | 80434 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.04% Deletion average length | 2.91 Insertion rate per base | 0.03% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 818455 % of reads mapped to multiple loci | 2.81% Number of reads mapped to too many loci | 245956 % of reads mapped to too many loci | 0.84% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.10% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 919658 919658 919658 N_multimapping 818455 818455 818455 N_noFeature 1052189 27026412 1213633 N_ambiguous 334672 2339 148933 UnstrandedReadsAssigned:25985218 PositiveStrandReadsAssigned:343328 NegativeStrandReadsAssigned:26009513 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623239 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623239-trimmed-pair1.fastq SRR28623239-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,110,192 reads, 26,407,364 reads pseudoaligned [quant] estimated average fragment length: 215.115 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,158 rounds 52401 SRR28623239.ke.tsv 34699 SRR28623239.se.tsv 87100 total ==> SRR28623239.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1803.89 748 14.0188 Potri.005G024800.1.v4.1 1035 820.885 205 8.44289 Potri.004G059700.1.v4.1 961 746.89 111 5.02442 Potri.007G009000.2.v4.1 1416 1201.89 0 0 Potri.003G141000.2.v4.1 2943 2728.89 649.342 8.04466 Potri.016G087400.1.v4.1 270 94.1951 2385.09 856.045 Potri.015G069301.1.v4.1 564 352.431 0 0 Potri.010G195200.1.v4.1 1773 1558.89 164.717 3.57226 Potri.012G127500.1.v4.1 977 762.885 16340 724.123 ==> SRR28623239.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 462 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 551 Potri.001G212900.v4.1 104 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 1 SRR28623239 completed mapping pipeline successfully