Starting /dee2/code/volunteer_pipeline.sh SRR28623240 current disk space = 3089077035008 free memory = 1442101368 SRR28623240 SRAfilesize 4525989c22f4b04715ec3d3f5410fe50 SRR28623240.sra SRR28623240.sra file validated SRR28623240 is paired end SRR28623240 is conventional basespace SRR28623240 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623240_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.49 37.0 37.0 37.0 37.0 37.0 2 36.469 37.0 37.0 37.0 37.0 37.0 3 36.6485 37.0 37.0 37.0 37.0 37.0 4 36.6195 37.0 37.0 37.0 37.0 37.0 5 36.6605 37.0 37.0 37.0 37.0 37.0 6 36.6475 37.0 37.0 37.0 37.0 37.0 7 36.5595 37.0 37.0 37.0 37.0 37.0 8 36.4895 37.0 37.0 37.0 37.0 37.0 9 36.6285 37.0 37.0 37.0 37.0 37.0 10-14 36.5844 37.0 37.0 37.0 37.0 37.0 15-19 36.53000000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.4898 37.0 37.0 37.0 37.0 37.0 25-29 36.461200000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.4747 37.0 37.0 37.0 37.0 37.0 35-39 36.393100000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.3728 37.0 37.0 37.0 37.0 37.0 45-49 36.3196 37.0 37.0 37.0 37.0 37.0 50-54 36.2516 37.0 37.0 37.0 37.0 37.0 55-59 36.1573 37.0 37.0 37.0 37.0 37.0 60-64 36.181799999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.1843 37.0 37.0 37.0 37.0 37.0 70-74 36.1074 37.0 37.0 37.0 37.0 37.0 75-79 36.157 37.0 37.0 37.0 37.0 37.0 80-84 35.999700000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.0312 37.0 37.0 37.0 37.0 37.0 90-94 35.942099999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.894099999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.9443 37.0 37.0 37.0 37.0 37.0 105-109 35.889700000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.7741 37.0 37.0 37.0 37.0 37.0 115-119 35.8488 37.0 37.0 37.0 37.0 37.0 120-124 35.7127 37.0 37.0 37.0 37.0 37.0 125-129 35.6274 37.0 37.0 37.0 37.0 37.0 130-134 35.6524 37.0 37.0 37.0 37.0 37.0 135-139 35.5242 37.0 37.0 37.0 37.0 37.0 140-144 35.290000000000006 37.0 37.0 37.0 34.6 37.0 145-149 35.1844 37.0 37.0 37.0 32.2 37.0 150-151 35.0255 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 3.0 23 4.0 24 6.0 25 6.0 26 7.0 27 6.0 28 19.0 29 23.0 30 35.0 31 54.0 32 62.0 33 85.0 34 160.0 35 380.0 36 2853.0 37 295.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.63791374122367 14.493480441323973 10.080240722166499 37.78836509528586 2 17.724999999999998 14.799999999999999 35.875 31.6 3 16.7 18.075 29.4 35.825 4 20.525 25.374999999999996 25.7 28.4 5 23.35 31.3 25.224999999999998 20.125 6 22.400000000000002 33.575 22.675 21.349999999999998 7 15.9 28.000000000000004 39.975 16.125 8 18.05 28.425 31.874999999999996 21.65 9 18.224999999999998 24.75 33.75 23.275000000000002 10-14 18.925 29.9 28.38 22.795 15-19 19.39 28.754999999999995 27.97 23.885 20-24 19.81 29.275000000000002 27.77 23.145 25-29 20.14 29.099999999999998 27.644999999999996 23.115 30-34 19.81 29.659999999999997 27.534999999999997 22.994999999999997 35-39 19.81 28.599999999999998 27.845 23.745 40-44 20.345 29.349999999999998 27.455000000000002 22.85 45-49 20.06 28.57 27.97 23.400000000000002 50-54 19.985 28.67 27.439999999999998 23.905 55-59 19.915 29.26 27.315 23.51 60-64 20.315 28.575 27.71 23.400000000000002 65-69 19.845 29.025000000000002 27.544999999999998 23.585 70-74 20.605 29.054999999999996 26.840000000000003 23.5 75-79 20.68 28.03 28.060000000000002 23.23 80-84 20.3 29.330000000000002 27.205000000000002 23.165 85-89 20.169999999999998 28.835 27.200000000000003 23.794999999999998 90-94 20.419999999999998 28.615000000000002 27.355 23.61 95-99 21.215 28.98 26.529999999999998 23.275000000000002 100-104 21.48 28.375 26.55 23.595 105-109 21.18 28.53 26.435 23.855 110-114 20.294999999999998 28.965000000000003 27.015 23.724999999999998 115-119 21.345 28.125 26.47 24.060000000000002 120-124 21.18 28.57 26.51 23.74 125-129 20.905 28.485 26.474999999999998 24.135 130-134 21.085 28.425 26.44 24.05 135-139 21.43 28.925 25.985000000000003 23.66 140-144 22.225 27.88 26.064999999999998 23.830000000000002 145-149 21.495 27.485 26.77 24.25 150-151 21.462500000000002 28.050000000000004 25.775 24.712500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 1.0 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.0 21 0.0 22 1.5 23 1.5 24 3.0 25 6.0 26 6.5 27 7.0 28 10.5 29 22.5 30 30.5 31 38.5 32 45.5 33 56.5 34 72.5 35 93.5 36 103.0 37 113.5 38 147.5 39 167.0 40 200.0 41 224.5 42 218.0 43 220.0 44 229.5 45 243.0 46 225.0 47 213.5 48 221.0 49 199.5 50 171.5 51 144.0 52 105.5 53 76.5 54 68.5 55 58.0 56 53.5 57 48.0 58 39.5 59 32.0 60 18.5 61 14.0 62 11.5 63 6.0 64 3.5 65 1.0 66 0.5 67 3.5 68 4.5 69 2.5 70 1.5 71 0.5 72 1.0 73 2.5 74 1.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.65 #Duplication Level Percentage of deduplicated Percentage of total 1 86.13543490951547 73.775 2 11.3543490951547 19.45 3 2.1599532983070637 5.55 4 0.3210741389375365 1.0999999999999999 5 0.02918855808523059 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGTGGATAAAGACAAGCTCTTTTCATTTAATTTGTGGGGTGGCTACGGA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0125 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2125 0.0 0.0 0.0 0.0 80-81 0.325 0.0 0.0 0.0 0.0 82-83 0.4125 0.0 0.0 0.0 0.0 84-85 0.575 0.0 0.0 0.0 0.0 86-87 0.75 0.0 0.0 0.0 0.0 88-89 0.8 0.0 0.0 0.0 0.0 90-91 0.925 0.0 0.0 0.0 0.0 92-93 1.075 0.0 0.0 0.0 0.0 94-95 1.2375 0.0 0.0 0.0 0.0 96-97 1.4125 0.0 0.0 0.0 0.0 98-99 1.5875 0.0 0.0 0.0 0.0 100-101 1.8125 0.0 0.0 0.0 0.0 102-103 2.225 0.0 0.0 0.0 0.0 104-105 2.7249999999999996 0.0 0.0 0.0 0.0 106-107 3.175 0.0 0.0 0.0 0.0 108-109 3.5625 0.0 0.0 0.0 0.0 110-111 4.0125 0.0 0.0 0.0 0.0 112-113 4.637499999999999 0.0 0.0 0.0 0.0 114-115 5.3875 0.0 0.0 0.0 0.0 116-117 5.887499999999999 0.0 0.0 0.0 0.0 118-119 6.3875 0.0 0.0 0.0 0.0 120-121 6.9 0.0 0.0 0.0 0.0 122-123 7.7 0.0 0.0 0.0 0.0 124-125 8.275 0.0 0.0 0.0 0.0 126-127 8.825 0.0 0.0 0.0 0.0 128-129 9.425 0.0 0.0 0.0 0.0 130-131 10.2 0.0 0.0 0.0 0.0 132-133 11.087499999999999 0.0 0.0 0.0 0.0 134-135 11.8625 0.0 0.0 0.0 0.0 136-137 12.725000000000001 0.0 0.0 0.0 0.0 138-139 13.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTCAAC 10 0.006830828 145.0 1 >>END_MODULE SRR28623240 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623240_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.688 37.0 37.0 37.0 37.0 37.0 2 36.2495 37.0 37.0 37.0 37.0 37.0 3 36.1525 37.0 37.0 37.0 37.0 37.0 4 36.033 37.0 37.0 37.0 37.0 37.0 5 36.1815 37.0 37.0 37.0 37.0 37.0 6 36.1885 37.0 37.0 37.0 37.0 37.0 7 36.134 37.0 37.0 37.0 37.0 37.0 8 36.212 37.0 37.0 37.0 37.0 37.0 9 36.109 37.0 37.0 37.0 37.0 37.0 10-14 36.049 37.0 37.0 37.0 37.0 37.0 15-19 35.9779 37.0 37.0 37.0 37.0 37.0 20-24 36.00439999999999 37.0 37.0 37.0 37.0 37.0 25-29 35.9451 37.0 37.0 37.0 37.0 37.0 30-34 35.8172 37.0 37.0 37.0 37.0 37.0 35-39 35.8328 37.0 37.0 37.0 37.0 37.0 40-44 35.783500000000004 37.0 37.0 37.0 37.0 37.0 45-49 35.7888 37.0 37.0 37.0 37.0 37.0 50-54 35.7102 37.0 37.0 37.0 37.0 37.0 55-59 35.6576 37.0 37.0 37.0 37.0 37.0 60-64 35.5743 37.0 37.0 37.0 37.0 37.0 65-69 35.5687 37.0 37.0 37.0 37.0 37.0 70-74 35.58710000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.591499999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.497 37.0 37.0 37.0 37.0 37.0 85-89 35.549099999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.5022 37.0 37.0 37.0 37.0 37.0 95-99 35.534499999999994 37.0 37.0 37.0 34.6 37.0 100-104 35.3952 37.0 37.0 37.0 37.0 37.0 105-109 35.365899999999996 37.0 37.0 37.0 34.6 37.0 110-114 35.4302 37.0 37.0 37.0 37.0 37.0 115-119 35.3625 37.0 37.0 37.0 37.0 37.0 120-124 35.3052 37.0 37.0 37.0 34.6 37.0 125-129 34.947500000000005 37.0 37.0 37.0 27.4 37.0 130-134 35.1884 37.0 37.0 37.0 32.2 37.0 135-139 34.9242 37.0 37.0 37.0 27.4 37.0 140-144 34.9413 37.0 37.0 37.0 27.4 37.0 145-149 34.866 37.0 37.0 37.0 25.0 37.0 150-151 34.426 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 4.0 14 9.0 15 7.0 16 4.0 17 5.0 18 5.0 19 6.0 20 8.0 21 9.0 22 11.0 23 6.0 24 12.0 25 7.0 26 11.0 27 9.0 28 14.0 29 20.0 30 33.0 31 40.0 32 70.0 33 134.0 34 211.0 35 634.0 36 2482.0 37 246.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.300000000000004 22.425 12.525 24.75 2 28.825 25.5 27.775 17.9 3 22.8 27.6 30.85 18.75 4 26.125 32.225 22.325 19.325 5 27.900000000000002 35.199999999999996 20.8 16.1 6 22.2 37.8 21.8 18.2 7 22.475 22.475 36.225 18.825 8 22.900000000000002 25.974999999999998 27.425 23.7 9 22.625 26.5 28.249999999999996 22.625 10-14 25.124999999999996 28.199999999999996 26.395000000000003 20.28 15-19 24.305 28.08 27.175 20.44 20-24 23.86 28.134999999999998 27.595 20.41 25-29 24.27 28.044999999999998 27.305 20.380000000000003 30-34 24.19 27.589999999999996 27.61 20.61 35-39 23.945 27.16 28.09 20.805 40-44 23.73 27.639999999999997 27.955000000000002 20.674999999999997 45-49 23.595 28.68 26.985 20.74 50-54 23.724999999999998 28.335 27.400000000000002 20.54 55-59 23.585 28.46 27.744999999999997 20.21 60-64 23.200000000000003 28.305000000000003 27.884999999999998 20.61 65-69 23.44 28.34 27.57 20.65 70-74 23.815 27.915 27.43 20.84 75-79 23.455000000000002 27.655 28.12 20.77 80-84 23.755000000000003 27.965 27.725 20.555 85-89 24.315 28.015 27.089999999999996 20.580000000000002 90-94 23.96 28.199999999999996 27.13 20.71 95-99 23.73 28.050000000000004 27.975 20.244999999999997 100-104 23.91 27.99 27.215 20.885 105-109 24.645 28.485 27.52 19.35 110-114 25.105 28.349999999999998 26.640000000000004 19.905 115-119 25.635 27.189999999999998 27.255000000000003 19.919999999999998 120-124 25.19 28.63 26.974999999999998 19.205 125-129 25.82 28.595 25.97 19.615 130-134 25.965 29.060000000000002 26.83 18.145 135-139 26.85 27.98 27.200000000000003 17.97 140-144 26.340000000000003 28.17 26.91 18.58 145-149 27.165 27.955000000000002 26.51 18.37 150-151 26.9125 28.462500000000002 26.650000000000002 17.974999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 1.0 6 1.0 7 0.5 8 0.5 9 1.0 10 1.5 11 1.0 12 1.0 13 1.0 14 0.5 15 1.5 16 2.5 17 3.0 18 3.0 19 3.0 20 3.0 21 2.0 22 1.0 23 1.0 24 2.5 25 3.0 26 3.5 27 5.0 28 7.5 29 9.5 30 15.0 31 23.0 32 30.0 33 38.5 34 48.0 35 63.0 36 82.5 37 103.0 38 140.5 39 170.5 40 203.5 41 215.5 42 221.5 43 245.0 44 254.5 45 256.5 46 243.5 47 225.5 48 219.0 49 206.0 50 163.0 51 133.5 52 114.5 53 99.5 54 98.5 55 78.0 56 49.0 57 45.5 58 37.5 59 23.5 60 18.5 61 14.0 62 9.5 63 5.5 64 3.0 65 1.5 66 1.5 67 1.5 68 2.0 69 2.0 70 2.0 71 1.5 72 1.0 73 1.0 74 1.0 75 0.5 76 0.0 77 0.0 78 0.5 79 0.5 80 1.5 81 2.0 82 1.0 83 0.5 84 2.0 85 3.0 86 1.0 87 0.0 88 1.5 89 2.0 90 0.5 91 0.0 92 0.5 93 1.0 94 0.5 95 0.0 96 0.0 97 0.5 98 2.0 99 2.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 87.10610002891009 75.325 2 10.75455333911535 18.6 3 1.792425556519225 4.65 4 0.26019080659150046 0.8999999999999999 5 0.028910089621277828 0.125 6 0.0 0.0 7 0.0 0.0 8 0.057820179242555655 0.4 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 8 0.2 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit CACAGGCACAGCTGTGGGTGCTGAGATCATTGGCACTTTTGTGCTTGTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0125 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2125 0.0 0.0 0.0 0.0 80-81 0.325 0.0 0.0 0.0 0.0 82-83 0.4125 0.0 0.0 0.0 0.0 84-85 0.575 0.0 0.0 0.0 0.0 86-87 0.75 0.0 0.0 0.0 0.0 88-89 0.8 0.0 0.0 0.0 0.0 90-91 0.925 0.0 0.0 0.0 0.0 92-93 1.075 0.0 0.0 0.0 0.0 94-95 1.2375 0.0 0.0 0.0 0.0 96-97 1.4375 0.0 0.0 0.0 0.0 98-99 1.6124999999999998 0.0 0.0 0.0 0.0 100-101 1.8125 0.0 0.0 0.0 0.0 102-103 2.25 0.0 0.0 0.0 0.0 104-105 2.75 0.0 0.0 0.0 0.0 106-107 3.2 0.0 0.0 0.0 0.0 108-109 3.6125 0.0 0.0 0.0 0.0 110-111 4.0625 0.0 0.0 0.0 0.0 112-113 4.6875 0.0 0.0 0.0 0.0 114-115 5.4875 0.0 0.0 0.0 0.0 116-117 5.975 0.0 0.0 0.0 0.0 118-119 6.4625 0.0 0.0 0.0 0.0 120-121 6.975 0.0 0.0 0.0 0.0 122-123 7.775 0.0 0.0 0.0 0.0 124-125 8.35 0.0 0.0 0.0 0.0 126-127 8.9125 0.0 0.0 0.0 0.0 128-129 9.55 0.0 0.0 0.0 0.0 130-131 10.3 0.0 0.0 0.0 0.0 132-133 11.162500000000001 0.0 0.0 0.0 0.0 134-135 11.975000000000001 0.0 0.0 0.0 0.0 136-137 12.8125 0.0 0.0 0.0 0.0 138-139 13.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1281828 spots for SRR28623240.sra Written 1281828 spots for SRR28623240.sra Read 1281828 spots for SRR28623240.sra Written 1281828 spots for SRR28623240.sra Read 1281828 spots for SRR28623240.sra Written 1281828 spots for SRR28623240.sra Read 1281828 spots for SRR28623240.sra Written 1281828 spots for SRR28623240.sra Read 1281828 spots for SRR28623240.sra Written 1281828 spots for SRR28623240.sra Read 1281828 spots for SRR28623240.sra Written 1281828 spots for SRR28623240.sra Read 1281828 spots for SRR28623240.sra Written 1281828 spots for SRR28623240.sra Read 1281828 spots for SRR28623240.sra Written 1281828 spots for SRR28623240.sra Read 1281828 spots for SRR28623240.sra Written 1281828 spots for SRR28623240.sra Read 1281828 spots for SRR28623240.sra Written 1281828 spots for SRR28623240.sra Read 1281828 spots for SRR28623240.sra Written 1281828 spots for SRR28623240.sra Read 1281828 spots for SRR28623240.sra Written 1281828 spots for SRR28623240.sra Read 1281828 spots for SRR28623240.sra Written 1281828 spots for SRR28623240.sra Read 1281828 spots for SRR28623240.sra Written 1281828 spots for SRR28623240.sra Read 1281828 spots for SRR28623240.sra Written 1281828 spots for SRR28623240.sra Read 1281828 spots for SRR28623240.sra Written 1281828 spots for SRR28623240.sra Read 1281846 spots for SRR28623240.sra Written 1281846 spots for SRR28623240.sra Read 1281828 spots for SRR28623240.sra Written 1281828 spots for SRR28623240.sra Read 1281828 spots for SRR28623240.sra Written 1281828 spots for SRR28623240.sra Read 1281828 spots for SRR28623240.sra Written 1281828 spots for SRR28623240.sra SRR ids: ['SRR28623240.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3u1tnj2j SRR28623240.sra spots: 25636578 blocks: [[1, 1281828], [1281829, 2563656], [2563657, 3845484], [3845485, 5127312], [5127313, 6409140], [6409141, 7690968], [7690969, 8972796], [8972797, 10254624], [10254625, 11536452], [11536453, 12818280], [12818281, 14100108], [14100109, 15381936], [15381937, 16663764], [16663765, 17945592], [17945593, 19227420], [19227421, 20509248], [20509249, 21791076], [21791077, 23072904], [23072905, 24354732], [24354733, 25636578]] SRR28623240 file size 9464290 SRR28623240 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623240 SRR28623240_1.fastq SRR28623240_2.fastq Input file: SRR28623240_1.fastq Paired file: SRR28623240_2.fastq trimmed: SRR28623240-trimmed-pair1.fastq, SRR28623240-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 15:19:37 2025 >> started Thu Feb 13 15:20:05 2025 >> done (28.622s) 25636578 read pairs processed; of these: 36 ( 0.00%) short read pairs filtered out after trimming by size control 97077 ( 0.38%) empty read pairs filtered out after trimming by size control 25539465 (99.62%) read pairs available; of these: 4742242 (18.57%) trimmed read pairs available after processing 20797223 (81.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 2 0.00% 21 1 0.00% 22 6 0.00% 23 2 0.00% 24 5 0.00% 25 2 0.00% 26 4 0.00% 27 1 0.00% 28 1 0.00% 29 3 0.00% 30 8 0.00% 31 5 0.00% 32 12 0.00% 33 4 0.00% 34 12 0.00% 35 9 0.00% 36 12 0.00% 37 19 0.00% 38 15 0.00% 39 12 0.00% 40 20 0.00% 41 19 0.00% 42 31 0.00% 43 39 0.00% 44 39 0.00% 45 40 0.00% 46 62 0.00% 47 61 0.00% 48 67 0.00% 49 90 0.00% 50 128 0.00% 51 129 0.00% 52 178 0.00% 53 175 0.00% 54 209 0.00% 55 248 0.00% 56 258 0.00% 57 296 0.00% 58 384 0.00% 59 469 0.00% 60 550 0.00% 61 666 0.00% 62 815 0.00% 63 915 0.00% 64 1008 0.00% 65 1184 0.00% 66 1280 0.01% 67 1534 0.01% 68 1741 0.01% 69 2044 0.01% 70 2542 0.01% 71 2852 0.01% 72 3333 0.01% 73 3766 0.01% 74 4324 0.02% 75 4814 0.02% 76 5395 0.02% 77 6240 0.02% 78 6914 0.03% 79 7853 0.03% 80 8664 0.03% 81 9973 0.04% 82 11073 0.04% 83 12350 0.05% 84 13851 0.05% 85 15557 0.06% 86 16987 0.07% 87 17979 0.07% 88 20118 0.08% 89 21242 0.08% 90 22921 0.09% 91 24935 0.10% 92 26703 0.10% 93 29080 0.11% 94 31296 0.12% 95 33714 0.13% 96 35425 0.14% 97 37241 0.15% 98 38835 0.15% 99 40914 0.16% 100 43165 0.17% 101 43985 0.17% 102 46825 0.18% 103 48870 0.19% 104 51228 0.20% 105 53784 0.21% 106 55789 0.22% 107 57551 0.23% 108 58752 0.23% 109 60312 0.24% 110 61600 0.24% 111 63984 0.25% 112 66655 0.26% 113 66509 0.26% 114 69979 0.27% 115 72216 0.28% 116 73609 0.29% 117 75751 0.30% 118 77112 0.30% 119 78686 0.31% 120 80119 0.31% 121 81127 0.32% 122 81679 0.32% 123 83587 0.33% 124 86073 0.34% 125 86458 0.34% 126 89015 0.35% 127 89846 0.35% 128 89502 0.35% 129 91432 0.36% 130 93118 0.36% 131 92556 0.36% 132 94914 0.37% 133 95877 0.38% 134 96002 0.38% 135 97325 0.38% 136 98865 0.39% 137 98241 0.38% 138 100774 0.39% 139 101631 0.40% 140 100356 0.39% 141 101811 0.40% 142 103180 0.40% 143 102610 0.40% 144 104776 0.41% 145 105070 0.41% 146 106375 0.42% 147 107312 0.42% 148 107584 0.42% 149 108061 0.42% 150 108892 0.43% 151 20797223 81.43% 25539465 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=43 prefix-density=0.27 prefix-fanout=2.0 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.04 sequence-density-rank=38 fanout-score=21.95 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=6.5 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=39 prefix-density=0.25 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=49 fanout-score=90.16 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=1.7 sequence=GGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCGTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG SRR28623240 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 15:20:51 Started mapping on | Feb 13 15:20:52 Finished on | Feb 13 15:24:10 Mapping speed, Million of reads per hour | 464.35 Number of input reads | 25539465 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 23451212 Uniquely mapped reads % | 91.82% Average mapped length | 290.33 Number of splices: Total | 20707092 Number of splices: Annotated (sjdb) | 20191182 Number of splices: GT/AG | 20232241 Number of splices: GC/AG | 392811 Number of splices: AT/AC | 16277 Number of splices: Non-canonical | 65763 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.03% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 684252 % of reads mapped to multiple loci | 2.68% Number of reads mapped to too many loci | 170697 % of reads mapped to too many loci | 0.67% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.51% % of reads unmapped: other | 0.32% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1404001 1404001 1404001 N_multimapping 684252 684252 684252 N_noFeature 880449 22991589 1046791 N_ambiguous 448988 1928 154557 UnstrandedReadsAssigned:22121775 PositiveStrandReadsAssigned:457695 NegativeStrandReadsAssigned:22249864 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623240 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623240-trimmed-pair1.fastq SRR28623240-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,539,465 reads, 22,637,516 reads pseudoaligned [quant] estimated average fragment length: 219.951 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,099 rounds 52401 SRR28623240.ke.tsv 34699 SRR28623240.se.tsv 87100 total ==> SRR28623240.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1799.05 1121 24.0733 Potri.005G024800.1.v4.1 1035 816.049 355 16.8068 Potri.004G059700.1.v4.1 961 742.073 48 2.49901 Potri.007G009000.2.v4.1 1416 1197.05 0 0 Potri.003G141000.2.v4.1 2943 2724.05 1345.18 19.0783 Potri.016G087400.1.v4.1 270 96.7331 1267.46 506.21 Potri.015G069301.1.v4.1 564 349.59 0 0 Potri.010G195200.1.v4.1 1773 1554.05 20 0.497208 Potri.012G127500.1.v4.1 977 758.064 76 3.8733 ==> SRR28623240.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 512 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 325 Potri.001G212900.v4.1 62 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 22 SRR28623240 completed mapping pipeline successfully