Starting /dee2/code/volunteer_pipeline.sh SRR28623241 current disk space = 3088787972096 free memory = 1477780468 SRR28623241 SRAfilesize 9a3c9547e1e1d3f556ad393ff62f63e6 SRR28623241.sra SRR28623241.sra file validated SRR28623241 is paired end SRR28623241 is conventional basespace SRR28623241 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623241_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.45225 37.0 37.0 37.0 37.0 37.0 2 36.4035 37.0 37.0 37.0 37.0 37.0 3 36.587 37.0 37.0 37.0 37.0 37.0 4 36.622 37.0 37.0 37.0 37.0 37.0 5 36.6575 37.0 37.0 37.0 37.0 37.0 6 36.6305 37.0 37.0 37.0 37.0 37.0 7 36.4975 37.0 37.0 37.0 37.0 37.0 8 36.408 37.0 37.0 37.0 37.0 37.0 9 36.565 37.0 37.0 37.0 37.0 37.0 10-14 36.5889 37.0 37.0 37.0 37.0 37.0 15-19 36.58390000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.5733 37.0 37.0 37.0 37.0 37.0 25-29 36.5256 37.0 37.0 37.0 37.0 37.0 30-34 36.5187 37.0 37.0 37.0 37.0 37.0 35-39 36.487700000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.412800000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.1663 37.0 37.0 37.0 37.0 37.0 50-54 36.2032 37.0 37.0 37.0 37.0 37.0 55-59 36.052099999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.0687 37.0 37.0 37.0 37.0 37.0 65-69 35.9781 37.0 37.0 37.0 37.0 37.0 70-74 36.0098 37.0 37.0 37.0 37.0 37.0 75-79 36.196000000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.1217 37.0 37.0 37.0 37.0 37.0 85-89 36.1678 37.0 37.0 37.0 37.0 37.0 90-94 36.091899999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.9932 37.0 37.0 37.0 37.0 37.0 100-104 36.0524 37.0 37.0 37.0 37.0 37.0 105-109 36.0532 37.0 37.0 37.0 37.0 37.0 110-114 35.947399999999995 37.0 37.0 37.0 37.0 37.0 115-119 36.007999999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.832499999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.7264 37.0 37.0 37.0 37.0 37.0 130-134 35.8895 37.0 37.0 37.0 37.0 37.0 135-139 35.7766 37.0 37.0 37.0 37.0 37.0 140-144 35.6168 37.0 37.0 37.0 37.0 37.0 145-149 35.5758 37.0 37.0 37.0 37.0 37.0 150-151 35.317 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 1.0 23 2.0 24 2.0 25 2.0 26 13.0 27 11.0 28 9.0 29 19.0 30 27.0 31 32.0 32 58.0 33 101.0 34 153.0 35 359.0 36 2949.0 37 261.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.593836131295415 12.327737409170634 13.004259584064146 44.07416687546981 2 19.925 17.299999999999997 33.875 28.9 3 19.875 19.275000000000002 26.525 34.325 4 21.0 27.05 22.75 29.2 5 25.900000000000002 32.05 22.275 19.775000000000002 6 22.8 35.825 22.425 18.95 7 14.625 29.775000000000002 39.900000000000006 15.7 8 19.35 27.224999999999998 28.95 24.474999999999998 9 20.075000000000003 24.2 34.325 21.4 10-14 19.575 29.275000000000002 27.11 24.04 15-19 19.85 27.965 28.044999999999998 24.14 20-24 20.775 27.915 28.115000000000002 23.195 25-29 19.33 28.82 27.625 24.224999999999998 30-34 19.919999999999998 28.17 27.72 24.19 35-39 20.225 29.465000000000003 26.655 23.655 40-44 19.925 28.799999999999997 27.245 24.03 45-49 20.14 28.57 27.860000000000003 23.43 50-54 20.455000000000002 28.794999999999998 26.745 24.005000000000003 55-59 19.865 28.23 27.634999999999998 24.27 60-64 20.66 28.310000000000002 27.91 23.119999999999997 65-69 19.935 28.705000000000002 27.41 23.95 70-74 21.740000000000002 27.49 27.33 23.44 75-79 21.98 27.345000000000002 26.705000000000002 23.97 80-84 22.03 27.785 27.42 22.765 85-89 22.814999999999998 27.665 27.115000000000002 22.405 90-94 22.825 27.060000000000002 26.935 23.18 95-99 22.295 27.43 26.834999999999997 23.44 100-104 22.259999999999998 28.515 26.625 22.6 105-109 21.98 27.76 26.555 23.705000000000002 110-114 22.36 28.185 25.915 23.54 115-119 23.375 27.439999999999998 26.150000000000002 23.035 120-124 21.73 28.34 26.545 23.385 125-129 22.395 27.08 26.58 23.945 130-134 22.255 27.675 26.365 23.705000000000002 135-139 22.395 27.625 26.93 23.05 140-144 22.869999999999997 27.79 25.205 24.135 145-149 23.175 27.11 25.740000000000002 23.974999999999998 150-151 22.375 27.125 25.637500000000003 24.8625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 2.0 23 1.0 24 1.5 25 2.0 26 1.5 27 3.5 28 7.0 29 13.0 30 16.5 31 22.5 32 40.0 33 51.5 34 52.5 35 63.0 36 85.5 37 102.0 38 119.0 39 144.0 40 176.5 41 196.0 42 215.5 43 235.0 44 258.5 45 284.0 46 280.5 47 262.0 48 228.0 49 204.5 50 178.0 51 142.0 52 114.5 53 88.5 54 86.5 55 69.0 56 43.5 57 42.0 58 32.5 59 22.0 60 13.0 61 8.0 62 7.0 63 4.5 64 3.5 65 11.0 66 18.0 67 17.5 68 11.5 69 5.0 70 4.0 71 3.0 72 1.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.65 #Duplication Level Percentage of deduplicated Percentage of total 1 85.415421398685 71.45 2 11.894799760908548 19.900000000000002 3 2.092050209205021 5.25 4 0.4482964734010759 1.5 5 0.059772863120143446 0.25 6 0.0 0.0 7 0.029886431560071723 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.059772863120143446 1.4749999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCATACGTATCTCGTAT 34 0.8500000000000001 TruSeq Adapter, Index 2 (97% over 37bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCATACGTATCGCGTAT 25 0.625 TruSeq Adapter, Index 2 (97% over 37bp) TAGTGATGTCGCGCAGTATTTCTCCTCTCCTTTAATTCCAGGGCTTTCAC 7 0.17500000000000002 No Hit GTCCAGCTACGGGCGGTGGCCTCATACTTTGCCCTGTCAGTCTTGTACAT 5 0.125 No Hit CTCAGCATACAAGATGTCCATATCAGATGGCTGGTAGTCTGGCCTTGCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.2125 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.6375 0.0 0.0 0.0 0.0 92-93 0.7875 0.0 0.0 0.0 0.0 94-95 1.125 0.0 0.0 0.0 0.0 96-97 1.2875 0.0 0.0 0.0 0.0 98-99 1.525 0.0 0.0 0.0 0.0 100-101 1.6875 0.0 0.0 0.0 0.0 102-103 1.9 0.0 0.0 0.0 0.0 104-105 2.225 0.0 0.0 0.0 0.0 106-107 2.575 0.0 0.0 0.0 0.0 108-109 2.9124999999999996 0.0 0.0 0.0 0.0 110-111 3.1875 0.0 0.0 0.0 0.0 112-113 3.5625 0.0 0.0 0.0 0.0 114-115 4.05 0.0 0.0 0.0 0.0 116-117 4.625 0.0 0.0 0.0 0.0 118-119 5.225 0.0 0.0 0.0 0.0 120-121 5.625 0.0 0.0 0.0 0.0 122-123 5.925 0.0 0.0 0.0 0.0 124-125 6.1875 0.0 0.0 0.0 0.0 126-127 6.65 0.0 0.0 0.0 0.0 128-129 7.3375 0.0 0.0 0.0 0.0 130-131 7.975 0.0 0.0 0.0 0.0 132-133 8.4375 0.0 0.0 0.0 0.0 134-135 9.1375 0.0 0.0 0.0 0.0 136-137 9.7125 0.0 0.0 0.0 0.0 138-139 10.350000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGTCTT 10 0.006830828 145.0 2 GGCTTGT 10 0.006830828 145.0 9 CTAGTCT 10 0.006830828 145.0 1 CTCACTG 10 0.006830828 145.0 4 TTTGCGT 10 0.006830828 145.0 7 TGGCTTG 10 0.006830828 145.0 8 TCCCTCT 10 0.006830828 145.0 9 >>END_MODULE SRR28623241 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623241_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.958 37.0 37.0 37.0 37.0 37.0 2 36.1715 37.0 37.0 37.0 37.0 37.0 3 36.1765 37.0 37.0 37.0 37.0 37.0 4 36.2375 37.0 37.0 37.0 37.0 37.0 5 36.2795 37.0 37.0 37.0 37.0 37.0 6 36.216 37.0 37.0 37.0 37.0 37.0 7 36.1605 37.0 37.0 37.0 37.0 37.0 8 36.1595 37.0 37.0 37.0 37.0 37.0 9 36.055 37.0 37.0 37.0 37.0 37.0 10-14 35.952299999999994 37.0 37.0 37.0 37.0 37.0 15-19 35.8793 37.0 37.0 37.0 37.0 37.0 20-24 35.828599999999994 37.0 37.0 37.0 37.0 37.0 25-29 35.7177 37.0 37.0 37.0 37.0 37.0 30-34 35.624900000000004 37.0 37.0 37.0 37.0 37.0 35-39 35.5895 37.0 37.0 37.0 37.0 37.0 40-44 35.543099999999995 37.0 37.0 37.0 37.0 37.0 45-49 35.524899999999995 37.0 37.0 37.0 37.0 37.0 50-54 35.478899999999996 37.0 37.0 37.0 37.0 37.0 55-59 35.319900000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.336 37.0 37.0 37.0 37.0 37.0 65-69 35.4045 37.0 37.0 37.0 37.0 37.0 70-74 35.3589 37.0 37.0 37.0 37.0 37.0 75-79 35.386900000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.2911 37.0 37.0 37.0 37.0 37.0 85-89 35.3042 37.0 37.0 37.0 34.6 37.0 90-94 35.38940000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.4622 37.0 37.0 37.0 37.0 37.0 100-104 35.390100000000004 37.0 37.0 37.0 34.6 37.0 105-109 35.4073 37.0 37.0 37.0 34.6 37.0 110-114 35.4825 37.0 37.0 37.0 37.0 37.0 115-119 35.4234 37.0 37.0 37.0 37.0 37.0 120-124 35.451 37.0 37.0 37.0 34.6 37.0 125-129 35.0022 37.0 37.0 37.0 29.8 37.0 130-134 35.31400000000001 37.0 37.0 37.0 34.6 37.0 135-139 35.1211 37.0 37.0 37.0 29.8 37.0 140-144 35.08689999999999 37.0 37.0 37.0 25.0 37.0 145-149 35.1225 37.0 37.0 37.0 29.8 37.0 150-151 34.8335 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 5.0 14 3.0 15 8.0 16 3.0 17 4.0 18 4.0 19 3.0 20 6.0 21 8.0 22 12.0 23 18.0 24 22.0 25 31.0 26 17.0 27 19.0 28 9.0 29 17.0 30 24.0 31 50.0 32 68.0 33 109.0 34 229.0 35 636.0 36 2441.0 37 254.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.25 17.599999999999998 19.475 29.675 2 31.525 22.900000000000002 29.075 16.5 3 23.125 26.775 29.425 20.674999999999997 4 24.775 32.2 24.025 19.0 5 27.075 33.800000000000004 21.325 17.8 6 22.775000000000002 36.75 22.725 17.75 7 21.55 20.65 38.65 19.15 8 23.7 24.55 26.474999999999998 25.275 9 23.775 24.825 29.375 22.025 10-14 24.675 28.389999999999997 26.169999999999998 20.765 15-19 24.825 27.950000000000003 26.924999999999997 20.3 20-24 23.61 27.465 27.255000000000003 21.67 25-29 24.535 28.265 26.810000000000002 20.39 30-34 24.5 27.450000000000003 27.08 20.97 35-39 24.33 27.74 27.560000000000002 20.369999999999997 40-44 23.555 27.21 28.199999999999996 21.035 45-49 24.22 27.735 27.43 20.615 50-54 23.355 28.04 27.875 20.73 55-59 23.835 27.38 27.644999999999996 21.14 60-64 24.27 27.634999999999998 26.810000000000002 21.285 65-69 24.685000000000002 27.52 27.169999999999998 20.625 70-74 23.28 28.24 27.425 21.055 75-79 23.125 27.685 27.82 21.37 80-84 23.73 28.015 27.250000000000004 21.005 85-89 24.565 28.225 26.955000000000002 20.255000000000003 90-94 25.055 27.089999999999996 27.01 20.845 95-99 24.82 27.22 26.650000000000002 21.310000000000002 100-104 24.915000000000003 27.389999999999997 27.165 20.53 105-109 25.245 27.860000000000003 27.060000000000002 19.835 110-114 25.035 27.42 26.790000000000003 20.755000000000003 115-119 25.965 27.794999999999998 25.919999999999998 20.32 120-124 25.555 26.845000000000002 27.389999999999997 20.21 125-129 26.27 27.33 26.43 19.97 130-134 26.200000000000003 27.47 26.775 19.555 135-139 25.82 27.215 27.24 19.725 140-144 26.705000000000002 27.52 26.064999999999998 19.71 145-149 26.5 27.500000000000004 26.55 19.45 150-151 27.0625 27.3125 25.7875 19.8375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 1.0 9 1.5 10 0.5 11 0.0 12 1.0 13 2.0 14 1.5 15 0.5 16 0.5 17 1.0 18 1.0 19 0.5 20 0.5 21 0.5 22 1.0 23 1.5 24 3.5 25 4.5 26 3.5 27 2.5 28 6.0 29 9.5 30 11.0 31 18.0 32 24.5 33 29.5 34 44.0 35 59.5 36 70.0 37 97.0 38 130.0 39 160.5 40 195.5 41 220.0 42 243.0 43 267.5 44 267.5 45 254.0 46 251.5 47 245.5 48 230.5 49 203.5 50 160.0 51 122.5 52 108.0 53 100.5 54 91.5 55 69.5 56 52.5 57 47.0 58 32.0 59 22.0 60 19.0 61 15.0 62 7.0 63 5.0 64 4.5 65 1.5 66 0.5 67 1.0 68 1.0 69 1.0 70 2.0 71 2.0 72 2.0 73 2.0 74 1.5 75 1.5 76 0.5 77 2.0 78 2.5 79 0.5 80 0.0 81 1.5 82 5.0 83 4.0 84 2.0 85 5.0 86 5.0 87 2.5 88 4.0 89 3.5 90 2.0 91 4.5 92 3.5 93 2.0 94 2.0 95 1.0 96 0.5 97 1.5 98 2.0 99 1.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.975 #Duplication Level Percentage of deduplicated Percentage of total 1 86.65309683047397 74.5 2 11.049723756906078 19.0 3 1.8028496656004651 4.65 4 0.37801686536783946 1.3 5 0.08723466123873219 0.375 6 0.0 0.0 7 0.02907822041291073 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTCATCTGACAAATTGCCAGAAATCTACAGTGAGTTTTCAGTGAAACC 7 0.17500000000000002 No Hit GGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCA 5 0.125 No Hit TTCATTTCCCTCCTGATTATCCTTTCAAGCCCCCCAAGGTTGCCTTCAGG 5 0.125 No Hit ATGCAGTTTGTATGGCTATATGGGTATGCTGCTTGAAGGGCGTGAAAGAT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.2125 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.6375 0.0 0.0 0.0 0.0 92-93 0.7875 0.0 0.0 0.0 0.0 94-95 1.15 0.0 0.0 0.0 0.0 96-97 1.2875 0.0 0.0 0.0 0.0 98-99 1.525 0.0 0.0 0.0 0.0 100-101 1.725 0.0 0.0 0.0 0.0 102-103 1.9500000000000002 0.0 0.0 0.0 0.0 104-105 2.275 0.0 0.0 0.0 0.0 106-107 2.6375 0.0 0.0 0.0 0.0 108-109 3.0 0.0 0.0 0.0 0.0 110-111 3.2750000000000004 0.0 0.0 0.0 0.0 112-113 3.6375 0.0 0.0 0.0 0.0 114-115 4.1125 0.0 0.0 0.0 0.0 116-117 4.675 0.0 0.0 0.0 0.0 118-119 5.275 0.0 0.0 0.0 0.0 120-121 5.675 0.0 0.0 0.0 0.0 122-123 5.975 0.0 0.0 0.0 0.0 124-125 6.225 0.0 0.0 0.0 0.0 126-127 6.65 0.0 0.0 0.0 0.0 128-129 7.3625 0.0 0.0 0.0 0.0 130-131 7.9875 0.0 0.0 0.0 0.0 132-133 8.4375 0.0 0.0 0.0 0.0 134-135 9.125 0.0 0.0 0.0 0.0 136-137 9.6375 0.0 0.0 0.0 0.0 138-139 10.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCAATA 10 0.006830828 145.0 6 GCAATAC 10 0.006830828 145.0 7 CAATACT 10 0.006830828 145.0 8 AGGCAAT 10 0.006830828 145.0 5 AATACTA 10 0.006830828 145.0 9 >>END_MODULE Read 1591793 spots for SRR28623241.sra Written 1591793 spots for SRR28623241.sra Read 1591793 spots for SRR28623241.sra Written 1591793 spots for SRR28623241.sra Read 1591793 spots for SRR28623241.sra Written 1591793 spots for SRR28623241.sra Read 1591793 spots for SRR28623241.sra Written 1591793 spots for SRR28623241.sra Read 1591793 spots for SRR28623241.sra Written 1591793 spots for SRR28623241.sra Read 1591793 spots for SRR28623241.sra Written 1591793 spots for SRR28623241.sra Read 1591793 spots for SRR28623241.sra Written 1591793 spots for SRR28623241.sra Read 1591793 spots for SRR28623241.sra Written 1591793 spots for SRR28623241.sra Read 1591793 spots for SRR28623241.sra Written 1591793 spots for SRR28623241.sra Read 1591793 spots for SRR28623241.sra Written 1591793 spots for SRR28623241.sra Read 1591793 spots for SRR28623241.sra Written 1591793 spots for SRR28623241.sra Read 1591793 spots for SRR28623241.sra Written 1591793 spots for SRR28623241.sra Read 1591793 spots for SRR28623241.sra Written 1591793 spots for SRR28623241.sra Read 1591793 spots for SRR28623241.sra Written 1591793 spots for SRR28623241.sra Read 1591802 spots for SRR28623241.sra Written 1591802 spots for SRR28623241.sra Read 1591793 spots for SRR28623241.sra Written 1591793 spots for SRR28623241.sra Read 1591793 spots for SRR28623241.sra Written 1591793 spots for SRR28623241.sra Read 1591793 spots for SRR28623241.sra Written 1591793 spots for SRR28623241.sra Read 1591793 spots for SRR28623241.sra Written 1591793 spots for SRR28623241.sra Read 1591793 spots for SRR28623241.sra Written 1591793 spots for SRR28623241.sra SRR ids: ['SRR28623241.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tqtjn2a1 SRR28623241.sra spots: 31835869 blocks: [[1, 1591793], [1591794, 3183586], [3183587, 4775379], [4775380, 6367172], [6367173, 7958965], [7958966, 9550758], [9550759, 11142551], [11142552, 12734344], [12734345, 14326137], [14326138, 15917930], [15917931, 17509723], [17509724, 19101516], [19101517, 20693309], [20693310, 22285102], [22285103, 23876895], [23876896, 25468688], [25468689, 27060481], [27060482, 28652274], [28652275, 30244067], [30244068, 31835869]] SRR28623241 file size 11755536 SRR28623241 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623241 SRR28623241_1.fastq SRR28623241_2.fastq Input file: SRR28623241_1.fastq Paired file: SRR28623241_2.fastq trimmed: SRR28623241-trimmed-pair1.fastq, SRR28623241-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 15:45:22 2025 >> started Thu Feb 13 15:46:09 2025 >> done (46.601s) 31835869 read pairs processed; of these: 32 ( 0.00%) short read pairs filtered out after trimming by size control 531752 ( 1.67%) empty read pairs filtered out after trimming by size control 31304085 (98.33%) read pairs available; of these: 4714990 (15.06%) trimmed read pairs available after processing 26589095 (84.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 5 0.00% 21 9 0.00% 22 6 0.00% 23 8 0.00% 24 7 0.00% 25 8 0.00% 26 7 0.00% 27 11 0.00% 28 14 0.00% 29 11 0.00% 30 11 0.00% 31 23 0.00% 32 20 0.00% 33 20 0.00% 34 23 0.00% 35 26 0.00% 36 40 0.00% 37 39 0.00% 38 41 0.00% 39 49 0.00% 40 56 0.00% 41 60 0.00% 42 73 0.00% 43 68 0.00% 44 97 0.00% 45 109 0.00% 46 104 0.00% 47 129 0.00% 48 138 0.00% 49 188 0.00% 50 226 0.00% 51 235 0.00% 52 292 0.00% 53 330 0.00% 54 339 0.00% 55 360 0.00% 56 447 0.00% 57 476 0.00% 58 583 0.00% 59 661 0.00% 60 780 0.00% 61 922 0.00% 62 1114 0.00% 63 1288 0.00% 64 1511 0.00% 65 1560 0.00% 66 1682 0.01% 67 1867 0.01% 68 2068 0.01% 69 2594 0.01% 70 2906 0.01% 71 3310 0.01% 72 3920 0.01% 73 4492 0.01% 74 5022 0.02% 75 5420 0.02% 76 6082 0.02% 77 6832 0.02% 78 7303 0.02% 79 8405 0.03% 80 9459 0.03% 81 10520 0.03% 82 11841 0.04% 83 13549 0.04% 84 14714 0.05% 85 16096 0.05% 86 17405 0.06% 87 18511 0.06% 88 20324 0.06% 89 21177 0.07% 90 22845 0.07% 91 25038 0.08% 92 27017 0.09% 93 29309 0.09% 94 31704 0.10% 95 33884 0.11% 96 35098 0.11% 97 36968 0.12% 98 38100 0.12% 99 39653 0.13% 100 42107 0.13% 101 43398 0.14% 102 45718 0.15% 103 48040 0.15% 104 50176 0.16% 105 52764 0.17% 106 54459 0.17% 107 55918 0.18% 108 56899 0.18% 109 58320 0.19% 110 59520 0.19% 111 60935 0.19% 112 63493 0.20% 113 64570 0.21% 114 67547 0.22% 115 70171 0.22% 116 72572 0.23% 117 73723 0.24% 118 74795 0.24% 119 75637 0.24% 120 76399 0.24% 121 78262 0.25% 122 79173 0.25% 123 81237 0.26% 124 83792 0.27% 125 85177 0.27% 126 87323 0.28% 127 88512 0.28% 128 89950 0.29% 129 90756 0.29% 130 91846 0.29% 131 91763 0.29% 132 92643 0.30% 133 94570 0.30% 134 95237 0.30% 135 96449 0.31% 136 98810 0.32% 137 100167 0.32% 138 100525 0.32% 139 103095 0.33% 140 102067 0.33% 141 102684 0.33% 142 104089 0.33% 143 103903 0.33% 144 105799 0.34% 145 106436 0.34% 146 107056 0.34% 147 107370 0.34% 148 109813 0.35% 149 110570 0.35% 150 111111 0.35% 151 26589095 84.94% 31304085 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=21 prefix-density=0.59 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=499.01 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=23.1 sequence=CAAAAACAAAGTAGAATGATATTCATCTCCAAAAACCCAATAAAAAAGGAAGAGGTAAAGCATTTTGCCAAGGTCTAAGTACAATTTAAACAAACCACCC criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=15 prefix-density=0.69 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=51.61 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=4.7 sequence=CAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACC SRR28623241 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 15:46:50 Started mapping on | Feb 13 15:46:50 Finished on | Feb 13 15:49:50 Mapping speed, Million of reads per hour | 626.08 Number of input reads | 31304085 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 29295587 Uniquely mapped reads % | 93.58% Average mapped length | 292.37 Number of splices: Total | 26820396 Number of splices: Annotated (sjdb) | 26215289 Number of splices: GT/AG | 26243612 Number of splices: GC/AG | 486544 Number of splices: AT/AC | 18515 Number of splices: Non-canonical | 71725 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 864340 % of reads mapped to multiple loci | 2.76% Number of reads mapped to too many loci | 206870 % of reads mapped to too many loci | 0.66% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.75% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1144158 1144158 1144158 N_multimapping 864340 864340 864340 N_noFeature 1095857 28923952 1260561 N_ambiguous 398280 1833 190168 UnstrandedReadsAssigned:27801450 PositiveStrandReadsAssigned:369802 NegativeStrandReadsAssigned:27844858 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623241 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623241-trimmed-pair1.fastq SRR28623241-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,304,085 reads, 28,368,907 reads pseudoaligned [quant] estimated average fragment length: 236.162 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,073 rounds 52401 SRR28623241.ke.tsv 34699 SRR28623241.se.tsv 87100 total ==> SRR28623241.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.84 801 16.8647 Potri.005G024800.1.v4.1 1035 799.838 123 5.77246 Potri.004G059700.1.v4.1 961 725.878 60 3.10274 Potri.007G009000.2.v4.1 1416 1180.84 0 0 Potri.003G141000.2.v4.1 2943 2707.84 1016 14.0841 Potri.016G087400.1.v4.1 270 92.9622 1252.97 505.934 Potri.015G069301.1.v4.1 564 335.787 0 0 Potri.010G195200.1.v4.1 1773 1537.84 1 0.0244088 Potri.012G127500.1.v4.1 977 741.868 1075 54.3926 ==> SRR28623241.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 64 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 364 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR28623241 completed mapping pipeline successfully