Starting /dee2/code/volunteer_pipeline.sh SRR28623242 current disk space = 3088807276544 free memory = 1475161176 SRR28623242 SRAfilesize 55c4fc496297745ed3abb413978702a5 SRR28623242.sra SRR28623242.sra file validated SRR28623242 is paired end SRR28623242 is conventional basespace SRR28623242 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623242_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.30825 37.0 37.0 37.0 37.0 37.0 2 36.4375 37.0 37.0 37.0 37.0 37.0 3 36.574 37.0 37.0 37.0 37.0 37.0 4 36.643 37.0 37.0 37.0 37.0 37.0 5 36.667 37.0 37.0 37.0 37.0 37.0 6 36.643 37.0 37.0 37.0 37.0 37.0 7 36.6315 37.0 37.0 37.0 37.0 37.0 8 36.403 37.0 37.0 37.0 37.0 37.0 9 36.561 37.0 37.0 37.0 37.0 37.0 10-14 36.60850000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.57719999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.5849 37.0 37.0 37.0 37.0 37.0 25-29 36.5093 37.0 37.0 37.0 37.0 37.0 30-34 36.49679999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.4491 37.0 37.0 37.0 37.0 37.0 40-44 36.4519 37.0 37.0 37.0 37.0 37.0 45-49 36.3851 37.0 37.0 37.0 37.0 37.0 50-54 36.348400000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.3442 37.0 37.0 37.0 37.0 37.0 60-64 36.3223 37.0 37.0 37.0 37.0 37.0 65-69 36.312 37.0 37.0 37.0 37.0 37.0 70-74 36.212900000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.225 37.0 37.0 37.0 37.0 37.0 80-84 36.0592 37.0 37.0 37.0 37.0 37.0 85-89 36.1656 37.0 37.0 37.0 37.0 37.0 90-94 36.1161 37.0 37.0 37.0 37.0 37.0 95-99 35.9952 37.0 37.0 37.0 37.0 37.0 100-104 36.0315 37.0 37.0 37.0 37.0 37.0 105-109 36.029 37.0 37.0 37.0 37.0 37.0 110-114 35.906400000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.9238 37.0 37.0 37.0 37.0 37.0 120-124 35.836200000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.680499999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.890499999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.716100000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.4873 37.0 37.0 37.0 37.0 37.0 145-149 35.398 37.0 37.0 37.0 34.6 37.0 150-151 35.16575 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 4.0 24 4.0 25 4.0 26 4.0 27 2.0 28 16.0 29 14.0 30 26.0 31 39.0 32 53.0 33 82.0 34 149.0 35 383.0 36 2951.0 37 268.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.51671274189495 13.420457401357124 8.745916059311384 41.31691379743654 2 18.725 16.2 36.6 28.475 3 19.025 18.224999999999998 27.950000000000003 34.8 4 21.625 26.825 25.275 26.275 5 23.849999999999998 33.25 23.225 19.675 6 20.875 37.55 21.425 20.150000000000002 7 15.6 28.475 38.1 17.825 8 18.875 26.900000000000002 30.4 23.825 9 17.4 24.5 33.175 24.925 10-14 19.465 30.964999999999996 27.455000000000002 22.115000000000002 15-19 19.885 29.7 27.485 22.93 20-24 19.7 28.825 28.07 23.405 25-29 19.85 28.849999999999998 27.245 24.055 30-34 19.5 29.235 27.905 23.36 35-39 19.525000000000002 29.205 27.495000000000005 23.775 40-44 20.14 29.805 26.96 23.095 45-49 20.0 29.520000000000003 27.55 22.93 50-54 19.85 28.74 28.025 23.385 55-59 20.064999999999998 29.285 27.55 23.1 60-64 20.01 28.825 27.565 23.599999999999998 65-69 20.16 28.444999999999997 27.88 23.515 70-74 20.705000000000002 29.020000000000003 27.66 22.615 75-79 19.875 28.895 27.589999999999996 23.64 80-84 19.885 29.455 27.18 23.48 85-89 20.150000000000002 29.015 27.310000000000002 23.525 90-94 20.305 28.655 27.365000000000002 23.674999999999997 95-99 20.13 28.345 27.54 23.985 100-104 20.44 29.709999999999997 26.415 23.435 105-109 20.419999999999998 29.160000000000004 27.13 23.29 110-114 20.669999999999998 28.904999999999998 27.045 23.380000000000003 115-119 20.905 28.525 26.55 24.02 120-124 20.78 28.215 27.305 23.7 125-129 20.47 28.59 27.405 23.535 130-134 21.44 28.660000000000004 26.619999999999997 23.28 135-139 21.81 27.355 26.755000000000003 24.08 140-144 21.415 28.43 26.645000000000003 23.51 145-149 20.905 28.96 25.919999999999998 24.215 150-151 21.8875 27.6375 26.474999999999998 24.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.5 20 1.5 21 0.5 22 1.5 23 2.0 24 2.5 25 3.5 26 4.5 27 9.0 28 12.5 29 17.5 30 18.0 31 29.5 32 44.5 33 45.0 34 56.0 35 85.0 36 106.0 37 117.5 38 144.0 39 184.0 40 198.5 41 202.5 42 227.5 43 254.5 44 263.5 45 263.5 46 268.0 47 255.0 48 235.5 49 197.0 50 152.5 51 130.0 52 112.0 53 87.0 54 58.5 55 46.5 56 42.0 57 25.5 58 17.5 59 19.0 60 15.0 61 8.5 62 7.5 63 9.0 64 4.5 65 1.0 66 3.0 67 2.5 68 0.0 69 0.5 70 1.5 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.525 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.825 #Duplication Level Percentage of deduplicated Percentage of total 1 83.4591005131301 69.125 2 13.341382432840327 22.1 3 2.3543616057953516 5.8500000000000005 4 0.6942348324781165 2.3 5 0.1509206157561123 0.625 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCAAGGTGAAGAACTCACATAATGGCCCCGTGACAAGGAACTGTGATCGA 5 0.125 No Hit CTTCATTAATCACGCCTAGTACTGCTTATTGGACATTCATCTCCTACATT 5 0.125 No Hit CAGTTTTCATCCATAAGAATATTGGTTGATTTGACATCTCTGTGCAAAAT 5 0.125 No Hit GGGATGTGCACATGCTTCCAATGCTGTACAACGGAGACTTGGTGAGTATT 5 0.125 No Hit CCCAGTTCCTATTGCTGAAGAATTTAAGTGGGTGTTTGTGGTTTAGTGTG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.32499999999999996 0.0 0.0 0.0 0.0 82-83 0.44999999999999996 0.0 0.0 0.0 0.0 84-85 0.4875 0.0 0.0 0.0 0.0 86-87 0.5375000000000001 0.0 0.0 0.0 0.0 88-89 0.675 0.0 0.0 0.0 0.0 90-91 0.8125 0.0 0.0 0.0 0.0 92-93 0.925 0.0 0.0 0.0 0.0 94-95 1.15 0.0 0.0 0.0 0.0 96-97 1.3625 0.0 0.0 0.0 0.0 98-99 1.525 0.0 0.0 0.0 0.0 100-101 1.8375 0.0 0.0 0.0 0.0 102-103 2.2750000000000004 0.0 0.0 0.0 0.0 104-105 2.6624999999999996 0.0 0.0 0.0 0.0 106-107 2.9875 0.0 0.0 0.0 0.0 108-109 3.2750000000000004 0.0 0.0 0.0 0.0 110-111 3.7375 0.0 0.0 0.0 0.0 112-113 4.3375 0.0 0.0 0.0 0.0 114-115 4.75 0.0 0.0 0.0 0.0 116-117 5.075 0.0 0.0 0.0 0.0 118-119 5.449999999999999 0.0 0.0 0.0 0.0 120-121 6.0375 0.0 0.0 0.0 0.0 122-123 6.675000000000001 0.0 0.0 0.0 0.0 124-125 7.35 0.0 0.0 0.0 0.0 126-127 8.1125 0.0 0.0 0.0 0.0 128-129 8.7875 0.0 0.0 0.0 0.0 130-131 9.6875 0.0 0.0 0.0 0.0 132-133 10.6125 0.0 0.0 0.0 0.0 134-135 11.524999999999999 0.0 0.0 0.0 0.0 136-137 12.2125 0.0 0.0 0.0 0.0 138-139 13.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAGTGT 10 0.006830828 145.0 3 GTGTCGT 10 0.006830828 145.0 6 GTCGTTA 15 1.1411342E-4 145.0 8 CAACAGT 10 0.006830828 145.0 1 AGTGTCG 10 0.006830828 145.0 5 ATTAACA 10 0.006830828 145.0 6 TCGTTAA 10 0.006830828 145.0 9 GACCAGT 10 0.006830828 145.0 1 TGTCGTT 15 1.1411342E-4 145.0 7 >>END_MODULE SRR28623242 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623242_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.8085 37.0 37.0 37.0 37.0 37.0 2 36.398 37.0 37.0 37.0 37.0 37.0 3 36.327 37.0 37.0 37.0 37.0 37.0 4 36.3085 37.0 37.0 37.0 37.0 37.0 5 36.437 37.0 37.0 37.0 37.0 37.0 6 36.3155 37.0 37.0 37.0 37.0 37.0 7 36.2875 37.0 37.0 37.0 37.0 37.0 8 36.249 37.0 37.0 37.0 37.0 37.0 9 36.2475 37.0 37.0 37.0 37.0 37.0 10-14 36.248900000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.26520000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.2478 37.0 37.0 37.0 37.0 37.0 25-29 36.2664 37.0 37.0 37.0 37.0 37.0 30-34 36.1561 37.0 37.0 37.0 37.0 37.0 35-39 36.1672 37.0 37.0 37.0 37.0 37.0 40-44 36.1342 37.0 37.0 37.0 37.0 37.0 45-49 36.154799999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.0998 37.0 37.0 37.0 37.0 37.0 55-59 35.8986 37.0 37.0 37.0 37.0 37.0 60-64 35.9367 37.0 37.0 37.0 37.0 37.0 65-69 35.97279999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.0749 37.0 37.0 37.0 37.0 37.0 75-79 35.9691 37.0 37.0 37.0 37.0 37.0 80-84 35.8408 37.0 37.0 37.0 37.0 37.0 85-89 35.85530000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.7113 37.0 37.0 37.0 37.0 37.0 95-99 35.80309999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.6548 37.0 37.0 37.0 37.0 37.0 105-109 35.6948 37.0 37.0 37.0 37.0 37.0 110-114 35.674099999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.6238 37.0 37.0 37.0 37.0 37.0 120-124 35.6813 37.0 37.0 37.0 37.0 37.0 125-129 35.0931 37.0 37.0 37.0 32.2 37.0 130-134 35.4682 37.0 37.0 37.0 34.6 37.0 135-139 35.2036 37.0 37.0 37.0 29.8 37.0 140-144 35.2977 37.0 37.0 37.0 34.6 37.0 145-149 35.1326 37.0 37.0 37.0 29.8 37.0 150-151 34.8445 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 1.0 16 6.0 17 2.0 18 2.0 19 4.0 20 2.0 21 4.0 22 5.0 23 7.0 24 7.0 25 2.0 26 8.0 27 9.0 28 14.0 29 29.0 30 25.0 31 31.0 32 53.0 33 95.0 34 209.0 35 622.0 36 2596.0 37 265.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.925 21.349999999999998 13.3 25.424999999999997 2 26.25 27.025 30.575000000000003 16.150000000000002 3 22.525000000000002 27.224999999999998 30.9 19.35 4 24.2 33.725 23.775 18.3 5 25.074999999999996 35.875 22.625 16.425 6 21.625 38.25 23.175 16.950000000000003 7 20.125 21.0 40.1 18.775 8 21.975 25.45 28.975 23.599999999999998 9 23.025000000000002 25.174999999999997 30.025000000000002 21.775 10-14 23.955000000000002 30.214999999999996 25.7 20.13 15-19 23.189999999999998 28.645 27.615000000000002 20.549999999999997 20-24 23.555 28.615000000000002 27.389999999999997 20.44 25-29 23.805 29.160000000000004 27.07 19.965 30-34 23.215 29.38 26.875 20.53 35-39 23.52 28.88 26.83 20.77 40-44 23.91 28.375 27.815 19.900000000000002 45-49 23.45 28.37 27.284999999999997 20.895 50-54 23.724999999999998 28.095 27.935 20.244999999999997 55-59 22.795 28.139999999999997 28.249999999999996 20.815 60-64 23.105 27.77 28.634999999999998 20.49 65-69 23.34 28.43 28.299999999999997 19.93 70-74 23.244999999999997 28.08 28.355000000000004 20.32 75-79 23.3 27.315 28.435 20.95 80-84 23.055 27.834999999999997 28.294999999999998 20.815 85-89 23.835 28.95 27.02 20.195 90-94 22.625 28.93 28.09 20.355 95-99 23.94 28.03 27.765 20.265 100-104 24.11 28.165000000000003 28.225 19.5 105-109 23.799999999999997 28.244999999999997 27.58 20.375 110-114 24.38 27.884999999999998 28.18 19.555 115-119 25.130000000000003 27.905 27.474999999999998 19.49 120-124 24.87 27.705000000000002 27.52 19.905 125-129 25.25 28.51 27.04 19.2 130-134 25.369999999999997 27.615000000000002 27.425 19.59 135-139 26.540000000000003 27.93 26.625 18.905 140-144 25.874999999999996 27.700000000000003 27.589999999999996 18.834999999999997 145-149 26.479999999999997 28.225 26.450000000000003 18.845 150-151 27.8125 27.675 26.200000000000003 18.3125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 1.0 11 1.5 12 1.0 13 0.5 14 0.5 15 1.5 16 1.0 17 0.0 18 0.5 19 1.5 20 1.5 21 0.5 22 0.5 23 2.5 24 3.0 25 3.0 26 4.5 27 6.5 28 7.0 29 7.0 30 13.5 31 18.0 32 25.0 33 44.5 34 57.0 35 75.5 36 101.0 37 122.5 38 141.5 39 177.5 40 207.5 41 224.5 42 246.0 43 252.0 44 274.5 45 288.0 46 266.5 47 247.0 48 211.5 49 192.0 50 175.0 51 128.0 52 110.5 53 86.5 54 60.5 55 45.0 56 30.0 57 27.0 58 22.5 59 17.0 60 13.5 61 10.0 62 9.5 63 8.5 64 2.5 65 1.0 66 2.5 67 3.5 68 2.0 69 2.0 70 1.5 71 0.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 1.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.15 #Duplication Level Percentage of deduplicated Percentage of total 1 83.97474443776308 69.825 2 12.717979555021047 21.15 3 2.4954900781719784 6.225 4 0.6915213469633193 2.3 5 0.12026458208057728 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGAAATTTAAGAAGTGGAAGTGATCATCCTGCATGTCAACTGGATTTAG 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit GGAGAAAATGCTGTGGACCAACTTGTAGAAATTATCAAGGTTCTTGGCAC 5 0.125 No Hit TGGTAACCTGAGGGACTGTCTGGATGGGGTTTTAGGGGAAAAAATGAACT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.475 0.0 0.0 0.0 0.0 84-85 0.5125 0.0 0.0 0.0 0.0 86-87 0.5625 0.0 0.0 0.0 0.0 88-89 0.7 0.0 0.0 0.0 0.0 90-91 0.8375 0.0 0.0 0.0 0.0 92-93 0.95 0.0 0.0 0.0 0.0 94-95 1.2000000000000002 0.0 0.0 0.0 0.0 96-97 1.4125 0.0 0.0 0.0 0.0 98-99 1.5750000000000002 0.0 0.0 0.0 0.0 100-101 1.8624999999999998 0.0 0.0 0.0 0.0 102-103 2.3 0.0 0.0 0.0 0.0 104-105 2.6875 0.0 0.0 0.0 0.0 106-107 3.025 0.0 0.0 0.0 0.0 108-109 3.325 0.0 0.0 0.0 0.0 110-111 3.775 0.0 0.0 0.0 0.0 112-113 4.3875 0.0 0.0 0.0 0.0 114-115 4.800000000000001 0.0 0.0 0.0 0.0 116-117 5.1375 0.0 0.0 0.0 0.0 118-119 5.525 0.0 0.0 0.0 0.0 120-121 6.1125 0.0 0.0 0.0 0.0 122-123 6.7125 0.0 0.0 0.0 0.0 124-125 7.375 0.0 0.0 0.0 0.0 126-127 8.1375 0.0 0.0 0.0 0.0 128-129 8.8625 0.0 0.0 0.0 0.0 130-131 9.8 0.0 0.0 0.0 0.0 132-133 10.7 0.0 0.0 0.0 0.0 134-135 11.5875 0.0 0.0 0.0 0.0 136-137 12.274999999999999 0.0 0.0 0.0 0.0 138-139 13.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTCAG 10 0.006830828 145.0 1 GCAAAAG 10 0.006830828 145.0 8 TAGACCA 10 0.006830828 145.0 145 >>END_MODULE Read 2195809 spots for SRR28623242.sra Written 2195809 spots for SRR28623242.sra Read 2195809 spots for SRR28623242.sra Written 2195809 spots for SRR28623242.sra Read 2195809 spots for SRR28623242.sra Written 2195809 spots for SRR28623242.sra Read 2195809 spots for SRR28623242.sra Written 2195809 spots for SRR28623242.sra Read 2195809 spots for SRR28623242.sra Written 2195809 spots for SRR28623242.sra Read 2195809 spots for SRR28623242.sra Written 2195809 spots for SRR28623242.sra Read 2195809 spots for SRR28623242.sra Written 2195809 spots for SRR28623242.sra Read 2195809 spots for SRR28623242.sra Written 2195809 spots for SRR28623242.sra Read 2195809 spots for SRR28623242.sra Written 2195809 spots for SRR28623242.sra Read 2195809 spots for SRR28623242.sra Written 2195809 spots for SRR28623242.sra Read 2195809 spots for SRR28623242.sra Written 2195809 spots for SRR28623242.sra Read 2195809 spots for SRR28623242.sra Written 2195809 spots for SRR28623242.sra Read 2195809 spots for SRR28623242.sra Written 2195809 spots for SRR28623242.sra Read 2195809 spots for SRR28623242.sra Written 2195809 spots for SRR28623242.sra Read 2195809 spots for SRR28623242.sra Written 2195809 spots for SRR28623242.sra Read 2195820 spots for SRR28623242.sra Written 2195820 spots for SRR28623242.sra Read 2195809 spots for SRR28623242.sra Written 2195809 spots for SRR28623242.sra Read 2195809 spots for SRR28623242.sra Written 2195809 spots for SRR28623242.sra Read 2195809 spots for SRR28623242.sra Written 2195809 spots for SRR28623242.sra Read 2195809 spots for SRR28623242.sra Written 2195809 spots for SRR28623242.sra SRR ids: ['SRR28623242.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mmx9479j SRR28623242.sra spots: 43916191 blocks: [[1, 2195809], [2195810, 4391618], [4391619, 6587427], [6587428, 8783236], [8783237, 10979045], [10979046, 13174854], [13174855, 15370663], [15370664, 17566472], [17566473, 19762281], [19762282, 21958090], [21958091, 24153899], [24153900, 26349708], [26349709, 28545517], [28545518, 30741326], [30741327, 32937135], [32937136, 35132944], [35132945, 37328753], [37328754, 39524562], [39524563, 41720371], [41720372, 43916191]] SRR28623242 file size 16220378 SRR28623242 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623242 SRR28623242_1.fastq SRR28623242_2.fastq Input file: SRR28623242_1.fastq Paired file: SRR28623242_2.fastq trimmed: SRR28623242-trimmed-pair1.fastq, SRR28623242-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 15:48:26 2025 >> started Thu Feb 13 15:49:12 2025 >> done (46.747s) 43916191 read pairs processed; of these: 25 ( 0.00%) short read pairs filtered out after trimming by size control 11947 ( 0.03%) empty read pairs filtered out after trimming by size control 43904219 (99.97%) read pairs available; of these: 8301197 (18.91%) trimmed read pairs available after processing 35603022 (81.09%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 3 0.00% 20 6 0.00% 21 5 0.00% 22 4 0.00% 23 6 0.00% 24 8 0.00% 25 10 0.00% 26 14 0.00% 27 16 0.00% 28 8 0.00% 29 21 0.00% 30 22 0.00% 31 20 0.00% 32 23 0.00% 33 30 0.00% 34 39 0.00% 35 34 0.00% 36 39 0.00% 37 54 0.00% 38 58 0.00% 39 59 0.00% 40 64 0.00% 41 96 0.00% 42 99 0.00% 43 103 0.00% 44 114 0.00% 45 139 0.00% 46 142 0.00% 47 170 0.00% 48 188 0.00% 49 236 0.00% 50 281 0.00% 51 330 0.00% 52 410 0.00% 53 420 0.00% 54 457 0.00% 55 486 0.00% 56 572 0.00% 57 580 0.00% 58 724 0.00% 59 856 0.00% 60 1007 0.00% 61 1178 0.00% 62 1372 0.00% 63 1601 0.00% 64 1874 0.00% 65 2048 0.00% 66 2222 0.01% 67 2613 0.01% 68 2906 0.01% 69 3308 0.01% 70 3847 0.01% 71 4443 0.01% 72 5382 0.01% 73 6047 0.01% 74 6835 0.02% 75 7741 0.02% 76 8862 0.02% 77 9561 0.02% 78 11153 0.03% 79 12188 0.03% 80 13533 0.03% 81 15467 0.04% 82 17108 0.04% 83 19102 0.04% 84 21672 0.05% 85 24217 0.06% 86 25589 0.06% 87 28526 0.06% 88 30721 0.07% 89 33311 0.08% 90 36437 0.08% 91 39169 0.09% 92 42480 0.10% 93 45989 0.10% 94 50392 0.11% 95 53571 0.12% 96 56950 0.13% 97 60669 0.14% 98 63824 0.15% 99 67147 0.15% 100 69594 0.16% 101 72723 0.17% 102 76462 0.17% 103 81393 0.19% 104 85140 0.19% 105 89067 0.20% 106 93831 0.21% 107 97586 0.22% 108 100222 0.23% 109 103870 0.24% 110 105987 0.24% 111 109007 0.25% 112 112483 0.26% 113 115167 0.26% 114 119345 0.27% 115 124354 0.28% 116 126197 0.29% 117 131331 0.30% 118 134433 0.31% 119 135736 0.31% 120 139140 0.32% 121 141729 0.32% 122 143606 0.33% 123 146013 0.33% 124 149202 0.34% 125 152778 0.35% 126 155595 0.35% 127 159942 0.36% 128 161064 0.37% 129 163447 0.37% 130 167116 0.38% 131 167293 0.38% 132 169766 0.39% 133 172694 0.39% 134 171755 0.39% 135 174540 0.40% 136 176690 0.40% 137 179987 0.41% 138 180968 0.41% 139 185179 0.42% 140 184678 0.42% 141 186538 0.42% 142 189066 0.43% 143 188452 0.43% 144 190476 0.43% 145 192174 0.44% 146 192630 0.44% 147 193755 0.44% 148 196527 0.45% 149 196941 0.45% 150 198510 0.45% 151 35603022 81.09% 43904219 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=39 prefix-density=0.13 prefix-fanout=2.2 sequence=GTGGACTCCTTCTGGAT criterion=fanout-score sequence-density=0.07 sequence-density-rank=15 fanout-score=338.82 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=23.8 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=14.24 fanout-score-rank=14 prefix-density=0.16 prefix-fanout=14.2 sequence=GAGAGAGAGAGTTAAGACAATGGCCTCGAAGAAATCTGCAATCGTATTACCTGGTTCAAAGGTGTTGAAGCACATAGTTTTTGTACGGTTTAATGATGGGATCACTGATGAACAAATTGAGAA criterion=fanout-score sequence-density=0.08 sequence-density-rank=14 fanout-score=354.18 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=28.1 sequence=AAGAAGAAGAAA SRR28623242 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 15:49:55 Started mapping on | Feb 13 15:49:55 Finished on | Feb 13 15:54:40 Mapping speed, Million of reads per hour | 554.58 Number of input reads | 43904219 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 41011257 Uniquely mapped reads % | 93.41% Average mapped length | 290.64 Number of splices: Total | 37279832 Number of splices: Annotated (sjdb) | 36478509 Number of splices: GT/AG | 36646312 Number of splices: GC/AG | 488804 Number of splices: AT/AC | 35014 Number of splices: Non-canonical | 109702 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.93 Insertion rate per base | 0.03% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1291823 % of reads mapped to multiple loci | 2.94% Number of reads mapped to too many loci | 231821 % of reads mapped to too many loci | 0.53% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.95% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1601139 1601139 1601139 N_multimapping 1291823 1291823 1291823 N_noFeature 1485939 40522027 1716155 N_ambiguous 493005 3394 231572 UnstrandedReadsAssigned:39032313 PositiveStrandReadsAssigned:485836 NegativeStrandReadsAssigned:39063530 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623242 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623242-trimmed-pair1.fastq SRR28623242-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 43,904,219 reads, 39,719,048 reads pseudoaligned [quant] estimated average fragment length: 216.638 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,231 rounds 52401 SRR28623242.ke.tsv 34699 SRR28623242.se.tsv 87100 total ==> SRR28623242.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1802.36 1353 18.1074 Potri.005G024800.1.v4.1 1035 819.362 653 19.2237 Potri.004G059700.1.v4.1 961 745.362 178 5.7604 Potri.007G009000.2.v4.1 1416 1200.36 0 0 Potri.003G141000.2.v4.1 2943 2727.36 1142.76 10.1067 Potri.016G087400.1.v4.1 270 96.121 3057.99 767.394 Potri.015G069301.1.v4.1 564 352.162 0 0 Potri.010G195200.1.v4.1 1773 1557.36 94 1.45592 Potri.012G127500.1.v4.1 977 761.362 14513 459.797 ==> SRR28623242.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1768 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 697 Potri.001G212900.v4.1 10 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 2 SRR28623242 completed mapping pipeline successfully