Starting /dee2/code/volunteer_pipeline.sh SRR28623243 current disk space = 3088809021440 free memory = 1439678740 SRR28623243 SRAfilesize 47416a9bcce43357aafa36fc3aa30d6f SRR28623243.sra SRR28623243.sra file validated SRR28623243 is paired end SRR28623243 is conventional basespace SRR28623243 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623243_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.31025 37.0 37.0 37.0 37.0 37.0 2 36.461 37.0 37.0 37.0 37.0 37.0 3 36.6395 37.0 37.0 37.0 37.0 37.0 4 36.6625 37.0 37.0 37.0 37.0 37.0 5 36.6915 37.0 37.0 37.0 37.0 37.0 6 36.718 37.0 37.0 37.0 37.0 37.0 7 36.6435 37.0 37.0 37.0 37.0 37.0 8 36.442 37.0 37.0 37.0 37.0 37.0 9 36.6065 37.0 37.0 37.0 37.0 37.0 10-14 36.6057 37.0 37.0 37.0 37.0 37.0 15-19 36.5769 37.0 37.0 37.0 37.0 37.0 20-24 36.5077 37.0 37.0 37.0 37.0 37.0 25-29 36.4277 37.0 37.0 37.0 37.0 37.0 30-34 36.4641 37.0 37.0 37.0 37.0 37.0 35-39 36.4523 37.0 37.0 37.0 37.0 37.0 40-44 36.3856 37.0 37.0 37.0 37.0 37.0 45-49 36.2842 37.0 37.0 37.0 37.0 37.0 50-54 36.2392 37.0 37.0 37.0 37.0 37.0 55-59 36.199200000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.18429999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.1098 37.0 37.0 37.0 37.0 37.0 70-74 36.032399999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.087 37.0 37.0 37.0 37.0 37.0 80-84 36.036 37.0 37.0 37.0 37.0 37.0 85-89 36.087399999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.0044 37.0 37.0 37.0 37.0 37.0 95-99 35.8667 37.0 37.0 37.0 37.0 37.0 100-104 35.925599999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.9046 37.0 37.0 37.0 37.0 37.0 110-114 35.8369 37.0 37.0 37.0 37.0 37.0 115-119 35.773 37.0 37.0 37.0 37.0 37.0 120-124 35.6875 37.0 37.0 37.0 37.0 37.0 125-129 35.6057 37.0 37.0 37.0 37.0 37.0 130-134 35.6587 37.0 37.0 37.0 37.0 37.0 135-139 35.4295 37.0 37.0 37.0 37.0 37.0 140-144 35.10209999999999 37.0 37.0 37.0 27.4 37.0 145-149 35.0191 37.0 37.0 37.0 27.4 37.0 150-151 34.834 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 2.0 19 0.0 20 1.0 21 0.0 22 3.0 23 2.0 24 7.0 25 8.0 26 6.0 27 13.0 28 24.0 29 22.0 30 34.0 31 44.0 32 44.0 33 107.0 34 177.0 35 375.0 36 2840.0 37 291.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.73046973122331 14.368249183622206 9.670936950514946 43.23034413463954 2 18.224999999999998 16.425 36.25 29.099999999999998 3 17.375 19.05 26.674999999999997 36.9 4 22.075 25.174999999999997 23.674999999999997 29.075 5 24.325 31.85 23.75 20.075000000000003 6 22.075 34.675 22.125 21.125 7 14.75 30.0 38.475 16.775000000000002 8 17.525 27.900000000000002 32.125 22.45 9 18.3 25.874999999999996 33.525 22.3 10-14 18.84 31.05 27.72 22.39 15-19 19.42 29.65 27.525 23.405 20-24 19.470000000000002 29.909999999999997 27.450000000000003 23.169999999999998 25-29 18.795 29.470000000000002 27.339999999999996 24.395 30-34 19.29 29.585 27.67 23.455000000000002 35-39 19.38 29.87 27.275 23.474999999999998 40-44 19.095000000000002 29.630000000000003 27.445000000000004 23.830000000000002 45-49 19.2 29.345 27.21 24.245 50-54 19.505 29.09 27.52 23.885 55-59 19.645000000000003 28.395 27.37 24.59 60-64 20.46 29.154999999999998 27.145000000000003 23.24 65-69 18.91 29.580000000000002 28.360000000000003 23.150000000000002 70-74 19.830000000000002 29.56 26.47 24.14 75-79 20.349999999999998 28.845 27.045 23.76 80-84 20.724999999999998 28.84 26.63 23.805 85-89 20.215 29.23 26.93 23.625 90-94 20.275000000000002 29.175 26.179999999999996 24.37 95-99 20.79 28.935 26.46 23.815 100-104 21.69 28.794999999999998 26.145000000000003 23.369999999999997 105-109 20.495 29.28 26.185000000000002 24.04 110-114 20.8 28.82 25.869999999999997 24.51 115-119 21.595 29.205 25.775 23.425 120-124 21.654999999999998 28.884999999999998 25.705 23.755000000000003 125-129 21.565 28.57 25.55 24.315 130-134 21.485000000000003 29.595 25.380000000000003 23.54 135-139 21.87 28.22 24.955 24.955 140-144 21.5 28.000000000000004 25.779999999999998 24.72 145-149 22.165000000000003 28.375 25.205 24.255 150-151 22.650000000000002 27.6875 25.162499999999998 24.5 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.5 22 1.5 23 1.5 24 1.0 25 3.5 26 9.0 27 10.5 28 13.0 29 21.5 30 31.0 31 43.0 32 53.5 33 54.5 34 72.0 35 95.0 36 111.0 37 115.0 38 136.0 39 176.5 40 188.0 41 209.0 42 237.0 43 238.5 44 235.5 45 234.5 46 240.0 47 233.0 48 223.0 49 206.0 50 160.0 51 120.5 52 97.5 53 98.0 54 81.5 55 54.5 56 36.5 57 23.5 58 20.5 59 11.5 60 6.0 61 8.0 62 9.5 63 8.0 64 7.0 65 12.5 66 12.5 67 9.5 68 9.5 69 5.0 70 2.5 71 1.0 72 1.0 73 1.0 74 1.0 75 2.0 76 1.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.575 #Duplication Level Percentage of deduplicated Percentage of total 1 85.51581436594738 72.32499999999999 2 11.912503694945315 20.150000000000002 3 1.9213715637008573 4.875 4 0.532072125332545 1.7999999999999998 5 0.02955956251847473 0.125 6 0.02955956251847473 0.15 7 0.02955956251847473 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.02955956251847473 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGGACTTATCTCGTAT 16 0.4 TruSeq Adapter, Index 20 (97% over 37bp) AGCTGCATACCGGGGCAAGACCTCCGACCAGACCCGAAAGGAATAAATTC 7 0.17500000000000002 No Hit GGGCAGTGAGGTGTTGAAGTTGGTGGGGTACACTCTTCAGTTTATCCCAT 6 0.15 No Hit GCATACAGTACTTAGAAATTCCAACTGAGTCCATTAACAAGGATAAATTA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.2125 0.0 0.0 0.0 0.0 76-77 0.32499999999999996 0.0 0.0 0.0 0.0 78-79 0.4125 0.0 0.0 0.0 0.0 80-81 0.6125 0.0 0.0 0.0 0.0 82-83 0.85 0.0 0.0 0.0 0.0 84-85 1.125 0.0 0.0 0.0 0.0 86-87 1.45 0.0 0.0 0.0 0.0 88-89 1.7374999999999998 0.0 0.0 0.0 0.0 90-91 2.1625 0.0 0.0 0.0 0.0 92-93 2.85 0.0 0.0 0.0 0.0 94-95 3.275 0.0 0.0 0.0 0.0 96-97 3.6875 0.0 0.0 0.0 0.0 98-99 4.237500000000001 0.0 0.0 0.0 0.0 100-101 4.6875 0.0 0.0 0.0 0.0 102-103 5.112500000000001 0.0 0.0 0.0 0.0 104-105 5.5625 0.0 0.0 0.0 0.0 106-107 5.9375 0.0 0.0 0.0 0.0 108-109 6.675 0.0 0.0 0.0 0.0 110-111 7.325 0.0 0.0 0.0 0.0 112-113 7.9375 0.0 0.0 0.0 0.0 114-115 8.7 0.0 0.0 0.0 0.0 116-117 9.6375 0.0 0.0 0.0 0.0 118-119 10.2125 0.0 0.0 0.0 0.0 120-121 11.225 0.0 0.0 0.0 0.0 122-123 11.975 0.0 0.0 0.0 0.0 124-125 12.875 0.0 0.0 0.0 0.0 126-127 13.875 0.0 0.0 0.0 0.0 128-129 14.7 0.0 0.0 0.0 0.0 130-131 15.837499999999999 0.0 0.0 0.0 0.0 132-133 16.7625 0.0 0.0 0.0 0.0 134-135 17.9 0.0 0.0 0.0 0.0 136-137 18.75 0.0 0.0 0.0 0.0 138-139 19.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCATAG 10 0.006830828 145.0 6 TGTCATA 10 0.006830828 145.0 5 CCTCAAT 10 0.006830828 145.0 1 TCATAGT 10 0.006830828 145.0 7 >>END_MODULE SRR28623243 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623243_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9645 37.0 37.0 37.0 37.0 37.0 2 36.397 37.0 37.0 37.0 37.0 37.0 3 36.361 37.0 37.0 37.0 37.0 37.0 4 36.326 37.0 37.0 37.0 37.0 37.0 5 36.4425 37.0 37.0 37.0 37.0 37.0 6 36.3485 37.0 37.0 37.0 37.0 37.0 7 36.3435 37.0 37.0 37.0 37.0 37.0 8 36.338 37.0 37.0 37.0 37.0 37.0 9 36.246 37.0 37.0 37.0 37.0 37.0 10-14 36.18429999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.1715 37.0 37.0 37.0 37.0 37.0 20-24 36.1409 37.0 37.0 37.0 37.0 37.0 25-29 36.0603 37.0 37.0 37.0 37.0 37.0 30-34 35.9774 37.0 37.0 37.0 37.0 37.0 35-39 36.058 37.0 37.0 37.0 37.0 37.0 40-44 35.9941 37.0 37.0 37.0 37.0 37.0 45-49 35.9809 37.0 37.0 37.0 37.0 37.0 50-54 35.9101 37.0 37.0 37.0 37.0 37.0 55-59 35.80309999999999 37.0 37.0 37.0 37.0 37.0 60-64 35.7869 37.0 37.0 37.0 37.0 37.0 65-69 35.866699999999994 37.0 37.0 37.0 37.0 37.0 70-74 35.8447 37.0 37.0 37.0 37.0 37.0 75-79 35.885299999999994 37.0 37.0 37.0 37.0 37.0 80-84 35.754000000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.7506 37.0 37.0 37.0 37.0 37.0 90-94 35.7027 37.0 37.0 37.0 37.0 37.0 95-99 35.7512 37.0 37.0 37.0 37.0 37.0 100-104 35.687400000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.646100000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.7108 37.0 37.0 37.0 37.0 37.0 115-119 35.63 37.0 37.0 37.0 37.0 37.0 120-124 35.5647 37.0 37.0 37.0 37.0 37.0 125-129 35.1098 37.0 37.0 37.0 32.2 37.0 130-134 35.502700000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.3181 37.0 37.0 37.0 34.6 37.0 140-144 35.30050000000001 37.0 37.0 37.0 34.6 37.0 145-149 35.2844 37.0 37.0 37.0 32.2 37.0 150-151 34.769999999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 6.0 14 7.0 15 3.0 16 4.0 17 3.0 18 6.0 19 0.0 20 3.0 21 7.0 22 7.0 23 11.0 24 12.0 25 8.0 26 10.0 27 11.0 28 19.0 29 18.0 30 22.0 31 33.0 32 50.0 33 86.0 34 177.0 35 514.0 36 2675.0 37 308.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.15 16.675 14.825 27.35 2 30.175 24.5 29.099999999999998 16.225 3 23.849999999999998 26.900000000000002 31.05 18.2 4 26.8 31.674999999999997 23.275000000000002 18.25 5 28.025 34.300000000000004 21.725 15.950000000000001 6 23.375 37.075 22.95 16.6 7 21.7 21.5 38.425 18.375 8 24.2 25.324999999999996 28.849999999999998 21.625 9 24.0 23.425 30.375000000000004 22.2 10-14 25.380000000000003 28.410000000000004 26.51 19.7 15-19 25.369999999999997 27.325 26.875 20.43 20-24 24.085 28.46 27.534999999999997 19.919999999999998 25-29 24.4 27.794999999999998 27.700000000000003 20.105 30-34 24.365000000000002 28.485 27.015 20.135 35-39 23.53 28.860000000000003 27.384999999999998 20.225 40-44 24.415 27.839999999999996 28.115000000000002 19.63 45-49 24.575 27.79 28.51 19.125 50-54 23.625 27.794999999999998 28.625 19.955000000000002 55-59 24.01 27.810000000000002 28.33 19.85 60-64 24.310000000000002 27.339999999999996 28.725 19.625 65-69 23.815 27.939999999999998 28.615000000000002 19.63 70-74 24.425 27.36 28.53 19.685 75-79 23.455000000000002 27.595 29.13 19.82 80-84 24.205 27.245 28.139999999999997 20.41 85-89 23.94 27.925 28.535 19.6 90-94 24.435000000000002 27.83 28.134999999999998 19.6 95-99 25.145 28.185 27.57 19.1 100-104 25.014999999999997 27.785 27.58 19.62 105-109 25.235000000000003 27.675 27.775 19.314999999999998 110-114 25.814999999999998 28.28 26.979999999999997 18.925 115-119 26.02 27.655 27.76 18.565 120-124 26.72 28.24 26.674999999999997 18.365000000000002 125-129 26.810000000000002 28.38 26.700000000000003 18.11 130-134 27.46 27.694999999999997 26.229999999999997 18.615000000000002 135-139 27.27 27.3 27.02 18.41 140-144 27.82 27.74 26.224999999999998 18.215 145-149 28.16 27.425 26.345000000000002 18.07 150-151 28.0875 28.5875 26.200000000000003 17.125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 1.0 7 1.5 8 1.0 9 1.0 10 1.0 11 1.5 12 2.0 13 1.0 14 0.5 15 1.0 16 1.0 17 1.0 18 0.5 19 0.5 20 1.0 21 1.0 22 1.5 23 1.5 24 2.0 25 2.5 26 4.0 27 6.0 28 6.0 29 7.0 30 20.0 31 29.5 32 27.0 33 41.5 34 64.5 35 77.5 36 99.0 37 114.5 38 141.5 39 180.0 40 201.0 41 215.0 42 240.5 43 252.0 44 243.0 45 250.5 46 253.5 47 239.5 48 215.0 49 182.5 50 153.0 51 133.0 52 118.5 53 102.0 54 69.0 55 51.0 56 45.0 57 31.0 58 20.5 59 16.0 60 14.5 61 11.5 62 13.5 63 14.0 64 8.5 65 7.0 66 6.0 67 3.5 68 5.0 69 4.5 70 2.0 71 1.5 72 2.0 73 3.0 74 2.5 75 1.5 76 2.0 77 1.0 78 2.0 79 3.0 80 2.5 81 2.5 82 2.0 83 1.5 84 1.0 85 1.0 86 0.5 87 0.0 88 0.5 89 1.0 90 0.5 91 0.5 92 1.0 93 1.0 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 85.65114908662346 72.675 2 11.726576311137302 19.900000000000002 3 1.9446081319976427 4.95 4 0.5598114319387153 1.9 5 0.05892751915144372 0.25 6 0.02946375957572186 0.15 7 0.02946375957572186 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAGAGTCCAGCAAGAGCTCGCAGACGTGGTGGGTTTAGAGCGGCGCGT 7 0.17500000000000002 No Hit GGTTGTGATAAGCTCATCAGTATTGACTGGCATGGTTTACGACAATTGCA 6 0.15 No Hit CAGCCCATGTCTGGATGCACTGAGCTTCTCAGGTCATACCAGGAGTTCGA 5 0.125 No Hit GGCGGGACTACCCGCTGAGTTTAAGCATATCAATAAGCGGAGGAAAAGAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.23750000000000002 0.0 0.0 0.0 0.0 76-77 0.35 0.0 0.0 0.0 0.0 78-79 0.4375 0.0 0.0 0.0 0.0 80-81 0.6375 0.0 0.0 0.0 0.0 82-83 0.875 0.0 0.0 0.0 0.0 84-85 1.15 0.0 0.0 0.0 0.0 86-87 1.475 0.0 0.0 0.0 0.0 88-89 1.7875 0.0 0.0 0.0 0.0 90-91 2.2125 0.0 0.0 0.0 0.0 92-93 2.9 0.0 0.0 0.0 0.0 94-95 3.325 0.0 0.0 0.0 0.0 96-97 3.7375 0.0 0.0 0.0 0.0 98-99 4.2875 0.0 0.0 0.0 0.0 100-101 4.725 0.0 0.0 0.0 0.0 102-103 5.137499999999999 0.0 0.0 0.0 0.0 104-105 5.625 0.0 0.0 0.0 0.0 106-107 6.0125 0.0 0.0 0.0 0.0 108-109 6.75 0.0 0.0 0.0 0.0 110-111 7.387499999999999 0.0 0.0 0.0 0.0 112-113 8.0 0.0 0.0 0.0 0.0 114-115 8.775 0.0 0.0 0.0 0.0 116-117 9.7125 0.0 0.0 0.0 0.0 118-119 10.2875 0.0 0.0 0.0 0.0 120-121 11.2625 0.0 0.0 0.0 0.0 122-123 12.025 0.0 0.0 0.0 0.0 124-125 12.925 0.0 0.0 0.0 0.0 126-127 13.9375 0.0 0.0 0.0 0.0 128-129 14.75 0.0 0.0 0.0 0.0 130-131 15.925 0.0 0.0 0.0 0.0 132-133 16.8625 0.0 0.0 0.0 0.0 134-135 18.05 0.0 0.0 0.0 0.0 136-137 18.8875 0.0 0.0 0.0 0.0 138-139 19.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGTCAT 10 0.006830828 145.0 8 TTTGTCA 10 0.006830828 145.0 7 >>END_MODULE Read 2046008 spots for SRR28623243.sra Written 2046008 spots for SRR28623243.sra Read 2046008 spots for SRR28623243.sra Written 2046008 spots for SRR28623243.sra Read 2046008 spots for SRR28623243.sra Written 2046008 spots for SRR28623243.sra Read 2046008 spots for SRR28623243.sra Written 2046008 spots for SRR28623243.sra Read 2046008 spots for SRR28623243.sra Written 2046008 spots for SRR28623243.sra Read 2046008 spots for SRR28623243.sra Written 2046008 spots for SRR28623243.sra Read 2046008 spots for SRR28623243.sra Written 2046008 spots for SRR28623243.sra Read 2046008 spots for SRR28623243.sra Written 2046008 spots for SRR28623243.sra Read 2046008 spots for SRR28623243.sra Written 2046008 spots for SRR28623243.sra Read 2046014 spots for SRR28623243.sra Written 2046014 spots for SRR28623243.sra Read 2046008 spots for SRR28623243.sra Written 2046008 spots for SRR28623243.sra Read 2046008 spots for SRR28623243.sra Written 2046008 spots for SRR28623243.sra Read 2046008 spots for SRR28623243.sra Written 2046008 spots for SRR28623243.sra Read 2046008 spots for SRR28623243.sra Written 2046008 spots for SRR28623243.sra Read 2046008 spots for SRR28623243.sra Written 2046008 spots for SRR28623243.sra Read 2046008 spots for SRR28623243.sra Written 2046008 spots for SRR28623243.sra Read 2046008 spots for SRR28623243.sra Written 2046008 spots for SRR28623243.sra Read 2046008 spots for SRR28623243.sra Written 2046008 spots for SRR28623243.sra Read 2046008 spots for SRR28623243.sra Written 2046008 spots for SRR28623243.sra Read 2046008 spots for SRR28623243.sra Written 2046008 spots for SRR28623243.sra SRR ids: ['SRR28623243.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d41witi0 SRR28623243.sra spots: 40920166 blocks: [[1, 2046008], [2046009, 4092016], [4092017, 6138024], [6138025, 8184032], [8184033, 10230040], [10230041, 12276048], [12276049, 14322056], [14322057, 16368064], [16368065, 18414072], [18414073, 20460080], [20460081, 22506088], [22506089, 24552096], [24552097, 26598104], [26598105, 28644112], [28644113, 30690120], [30690121, 32736128], [32736129, 34782136], [34782137, 36828144], [36828145, 38874152], [38874153, 40920166]] SRR28623243 file size 15113061 SRR28623243 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623243 SRR28623243_1.fastq SRR28623243_2.fastq Input file: SRR28623243_1.fastq Paired file: SRR28623243_2.fastq trimmed: SRR28623243-trimmed-pair1.fastq, SRR28623243-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 15:43:30 2025 >> started Thu Feb 13 15:44:23 2025 >> done (53.108s) 40920166 read pairs processed; of these: 53 ( 0.00%) short read pairs filtered out after trimming by size control 195024 ( 0.48%) empty read pairs filtered out after trimming by size control 40725089 (99.52%) read pairs available; of these: 10509465 (25.81%) trimmed read pairs available after processing 30215624 (74.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 3 0.00% 20 8 0.00% 21 6 0.00% 22 7 0.00% 23 4 0.00% 24 9 0.00% 25 8 0.00% 26 6 0.00% 27 12 0.00% 28 12 0.00% 29 14 0.00% 30 23 0.00% 31 19 0.00% 32 16 0.00% 33 31 0.00% 34 22 0.00% 35 47 0.00% 36 43 0.00% 37 56 0.00% 38 67 0.00% 39 72 0.00% 40 88 0.00% 41 121 0.00% 42 135 0.00% 43 161 0.00% 44 173 0.00% 45 211 0.00% 46 250 0.00% 47 283 0.00% 48 350 0.00% 49 472 0.00% 50 529 0.00% 51 682 0.00% 52 803 0.00% 53 890 0.00% 54 1012 0.00% 55 1213 0.00% 56 1351 0.00% 57 1560 0.00% 58 1970 0.00% 59 2241 0.01% 60 2562 0.01% 61 3217 0.01% 62 3541 0.01% 63 4414 0.01% 64 5149 0.01% 65 5689 0.01% 66 6435 0.02% 67 7297 0.02% 68 8345 0.02% 69 9107 0.02% 70 10888 0.03% 71 12459 0.03% 72 14627 0.04% 73 16607 0.04% 74 19120 0.05% 75 21360 0.05% 76 23568 0.06% 77 25936 0.06% 78 28072 0.07% 79 31293 0.08% 80 34453 0.08% 81 38133 0.09% 82 41785 0.10% 83 46566 0.11% 84 51223 0.13% 85 56538 0.14% 86 60327 0.15% 87 63864 0.16% 88 67344 0.17% 89 70338 0.17% 90 74220 0.18% 91 77655 0.19% 92 82655 0.20% 93 88806 0.22% 94 93758 0.23% 95 99153 0.24% 96 104787 0.26% 97 106971 0.26% 98 110670 0.27% 99 114506 0.28% 100 116551 0.29% 101 118719 0.29% 102 122375 0.30% 103 126144 0.31% 104 131504 0.32% 105 136228 0.33% 106 138662 0.34% 107 142087 0.35% 108 144139 0.35% 109 146805 0.36% 110 146823 0.36% 111 149156 0.37% 112 152724 0.38% 113 153233 0.38% 114 157754 0.39% 115 162092 0.40% 116 163046 0.40% 117 167727 0.41% 118 170479 0.42% 119 169540 0.42% 120 170689 0.42% 121 172627 0.42% 122 173753 0.43% 123 175085 0.43% 124 177821 0.44% 125 177681 0.44% 126 181881 0.45% 127 185045 0.45% 128 186025 0.46% 129 187085 0.46% 130 188196 0.46% 131 186989 0.46% 132 187087 0.46% 133 189156 0.46% 134 188881 0.46% 135 188141 0.46% 136 190924 0.47% 137 191653 0.47% 138 193328 0.47% 139 195191 0.48% 140 192988 0.47% 141 194800 0.48% 142 196399 0.48% 143 195377 0.48% 144 194966 0.48% 145 197812 0.49% 146 193747 0.48% 147 195049 0.48% 148 196437 0.48% 149 195482 0.48% 150 194958 0.48% 151 30215624 74.19% 40725089 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=14.90 fanout-score-rank=8 prefix-density=0.19 prefix-fanout=14.9 sequence=GGATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGGACTTATCTCGTATGCCGTCTTCTGCTTGAAAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=33 fanout-score=290.00 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=23.1 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTG criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=30 prefix-density=0.22 prefix-fanout=2.1 sequence=AATAGGTTCTTGAAGACAGC criterion=fanout-score sequence-density=0.10 sequence-density-rank=13 fanout-score=24.00 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=8.3 sequence=GAGAAGGCAATGAGAGATGCGATTGATGGAATGAACGGCCAAGACCTTGATGGGCGTAACATCACCGTGAATGAAGCACAATCCCGCGGAAGCGGCGG SRR28623243 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 15:45:02 Started mapping on | Feb 13 15:45:02 Finished on | Feb 13 15:48:34 Mapping speed, Million of reads per hour | 691.56 Number of input reads | 40725089 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 37124819 Uniquely mapped reads % | 91.16% Average mapped length | 284.63 Number of splices: Total | 25311020 Number of splices: Annotated (sjdb) | 24677248 Number of splices: GT/AG | 24884067 Number of splices: GC/AG | 306593 Number of splices: AT/AC | 27578 Number of splices: Non-canonical | 92782 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.04% Deletion average length | 2.89 Insertion rate per base | 0.03% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 843321 % of reads mapped to multiple loci | 2.07% Number of reads mapped to too many loci | 1389173 % of reads mapped to too many loci | 3.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.72% % of reads unmapped: other | 0.63% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2756949 2756949 2756949 N_multimapping 843321 843321 843321 N_noFeature 1565706 36418553 1874838 N_ambiguous 555712 5068 154463 UnstrandedReadsAssigned:35003401 PositiveStrandReadsAssigned:701198 NegativeStrandReadsAssigned:35095518 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=137 echo kmer=133 SRR28623243 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623243-trimmed-pair1.fastq SRR28623243-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 40,725,089 reads, 36,736,267 reads pseudoaligned [quant] estimated average fragment length: 198.366 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,164 rounds 52401 SRR28623243.ke.tsv 34699 SRR28623243.se.tsv 87100 total ==> SRR28623243.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1820.63 1084 17.8996 Potri.005G024800.1.v4.1 1035 837.634 216 7.75238 Potri.004G059700.1.v4.1 961 763.64 108 4.25178 Potri.007G009000.2.v4.1 1416 1218.63 0 0 Potri.003G141000.2.v4.1 2943 2745.63 351.276 3.84629 Potri.016G087400.1.v4.1 270 106.331 2815.15 795.933 Potri.015G069301.1.v4.1 564 369.46 0 0 Potri.010G195200.1.v4.1 1773 1575.63 66 1.25929 Potri.012G127500.1.v4.1 977 779.634 4715 181.814 ==> SRR28623243.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4121 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 821 Potri.001G212900.v4.1 17 Potri.001G182400.v4.1 66 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR28623243 completed mapping pipeline successfully