Starting /dee2/code/volunteer_pipeline.sh SRR28623244 current disk space = 3088698990592 free memory = 1503045272 SRR28623244 SRAfilesize 19b7c4ab51c91ad80e1580082cdbfcdf SRR28623244.sra SRR28623244.sra file validated SRR28623244 is paired end SRR28623244 is conventional basespace SRR28623244 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623244_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.406 37.0 37.0 37.0 37.0 37.0 2 36.44 37.0 37.0 37.0 37.0 37.0 3 36.637 37.0 37.0 37.0 37.0 37.0 4 36.6505 37.0 37.0 37.0 37.0 37.0 5 36.613 37.0 37.0 37.0 37.0 37.0 6 36.7225 37.0 37.0 37.0 37.0 37.0 7 36.552 37.0 37.0 37.0 37.0 37.0 8 36.454 37.0 37.0 37.0 37.0 37.0 9 36.5965 37.0 37.0 37.0 37.0 37.0 10-14 36.5854 37.0 37.0 37.0 37.0 37.0 15-19 36.5687 37.0 37.0 37.0 37.0 37.0 20-24 36.547000000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.485800000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.4703 37.0 37.0 37.0 37.0 37.0 35-39 36.4525 37.0 37.0 37.0 37.0 37.0 40-44 36.406600000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.374199999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.3425 37.0 37.0 37.0 37.0 37.0 55-59 36.277 37.0 37.0 37.0 37.0 37.0 60-64 36.2827 37.0 37.0 37.0 37.0 37.0 65-69 36.2875 37.0 37.0 37.0 37.0 37.0 70-74 36.2299 37.0 37.0 37.0 37.0 37.0 75-79 36.1874 37.0 37.0 37.0 37.0 37.0 80-84 36.1817 37.0 37.0 37.0 37.0 37.0 85-89 36.2024 37.0 37.0 37.0 37.0 37.0 90-94 36.1267 37.0 37.0 37.0 37.0 37.0 95-99 35.9731 37.0 37.0 37.0 37.0 37.0 100-104 36.0372 37.0 37.0 37.0 37.0 37.0 105-109 36.088499999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.943200000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.9041 37.0 37.0 37.0 37.0 37.0 120-124 35.8535 37.0 37.0 37.0 37.0 37.0 125-129 35.748000000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.8872 37.0 37.0 37.0 37.0 37.0 135-139 35.72859999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.4993 37.0 37.0 37.0 37.0 37.0 145-149 35.5738 37.0 37.0 37.0 37.0 37.0 150-151 35.28675 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 0.0 22 1.0 23 3.0 24 3.0 25 8.0 26 10.0 27 7.0 28 8.0 29 22.0 30 25.0 31 32.0 32 49.0 33 81.0 34 140.0 35 363.0 36 2960.0 37 287.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.530386740331494 14.465092918131592 10.647915620291311 40.3566047212456 2 18.8 16.900000000000002 35.15 29.15 3 18.775 18.85 27.625 34.75 4 22.15 26.174999999999997 22.425 29.25 5 26.85 31.674999999999997 22.625 18.85 6 20.75 35.15 23.9 20.200000000000003 7 16.125 27.775 39.0 17.1 8 18.725 26.375 32.35 22.55 9 18.725 22.95 35.325 23.0 10-14 19.34 31.130000000000003 27.894999999999996 21.634999999999998 15-19 19.580000000000002 28.915000000000003 27.700000000000003 23.805 20-24 19.865 29.110000000000003 27.845 23.18 25-29 19.905 29.160000000000004 27.22 23.715 30-34 20.255000000000003 29.185 27.49 23.07 35-39 20.605 28.395 27.474999999999998 23.525 40-44 20.02 29.39 27.005000000000003 23.585 45-49 19.975 28.67 27.365000000000002 23.990000000000002 50-54 20.26 28.134999999999998 28.22 23.385 55-59 20.375 28.744999999999997 27.794999999999998 23.085 60-64 20.51 28.560000000000002 27.205000000000002 23.724999999999998 65-69 20.25 29.37 26.700000000000003 23.68 70-74 20.755000000000003 27.72 28.055000000000003 23.47 75-79 20.66 27.815 27.805000000000003 23.72 80-84 20.465 28.435 27.72 23.380000000000003 85-89 20.655 28.76 27.195000000000004 23.39 90-94 21.015 28.744999999999997 26.43 23.810000000000002 95-99 20.715 28.32 27.715 23.25 100-104 20.91 28.299999999999997 26.83 23.96 105-109 20.979999999999997 28.16 27.965 22.895 110-114 20.93 28.1 27.415 23.555 115-119 20.935000000000002 28.455000000000002 26.240000000000002 24.37 120-124 21.055 27.595 27.73 23.62 125-129 21.175 28.49 26.39 23.945 130-134 21.38 28.244999999999997 26.985 23.39 135-139 21.65 27.839999999999996 27.084999999999997 23.425 140-144 21.445 28.125 26.605 23.825 145-149 21.240000000000002 27.455000000000002 27.894999999999996 23.41 150-151 22.537499999999998 27.187499999999996 26.2125 24.0625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 2.0 21 3.0 22 2.0 23 3.5 24 4.0 25 5.0 26 7.5 27 7.0 28 9.5 29 17.0 30 19.5 31 29.5 32 37.0 33 47.5 34 76.5 35 93.0 36 97.5 37 116.0 38 130.5 39 157.0 40 193.5 41 206.5 42 196.5 43 222.0 44 242.5 45 239.0 46 258.0 47 247.0 48 227.5 49 204.5 50 184.5 51 154.0 52 121.5 53 97.0 54 79.0 55 66.0 56 49.0 57 39.0 58 26.0 59 21.5 60 19.0 61 10.0 62 5.0 63 5.0 64 5.0 65 4.0 66 2.5 67 1.5 68 1.0 69 1.5 70 1.5 71 1.0 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.44999999999999996 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.075 #Duplication Level Percentage of deduplicated Percentage of total 1 83.50887752031298 69.375 2 13.150767378874512 21.85 3 2.8588624736683723 7.124999999999999 4 0.4213060487511285 1.4000000000000001 5 0.06018657839301836 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCCTTCCGGTCTCGCACCACTCTCTCCTCCTCTGTCTTGCATGGTAGGC 5 0.125 No Hit CAGGGCTGTAGATACTGCAATAACATGGGTGGAGGTTGTCCAAAACCACT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.7 0.0 0.0 0.0 0.0 94-95 0.7625 0.0 0.0 0.0 0.0 96-97 0.95 0.0 0.0 0.0 0.0 98-99 1.15 0.0 0.0 0.0 0.0 100-101 1.425 0.0 0.0 0.0 0.0 102-103 1.625 0.0 0.0 0.0 0.0 104-105 1.875 0.0 0.0 0.0 0.0 106-107 2.1500000000000004 0.0 0.0 0.0 0.0 108-109 2.3875 0.0 0.0 0.0 0.0 110-111 2.6375 0.0 0.0 0.0 0.0 112-113 2.8875 0.0 0.0 0.0 0.0 114-115 3.1375 0.0 0.0 0.0 0.0 116-117 3.3375 0.0 0.0 0.0 0.0 118-119 3.55 0.0 0.0 0.0 0.0 120-121 3.825 0.0 0.0 0.0 0.0 122-123 4.125 0.0 0.0 0.0 0.0 124-125 4.575 0.0 0.0 0.0 0.0 126-127 4.949999999999999 0.0 0.0 0.0 0.0 128-129 5.4375 0.0 0.0 0.0 0.0 130-131 5.9 0.0 0.0 0.0 0.0 132-133 6.3125 0.0 0.0 0.0 0.0 134-135 6.824999999999999 0.0 0.0 0.0 0.0 136-137 7.3125 0.0 0.0 0.0 0.0 138-139 7.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCTTAC 10 0.006830828 145.0 5 >>END_MODULE SRR28623244 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623244_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.748 37.0 37.0 37.0 37.0 37.0 2 36.1 37.0 37.0 37.0 37.0 37.0 3 35.9665 37.0 37.0 37.0 37.0 37.0 4 36.036 37.0 37.0 37.0 37.0 37.0 5 36.198 37.0 37.0 37.0 37.0 37.0 6 36.1995 37.0 37.0 37.0 37.0 37.0 7 36.146 37.0 37.0 37.0 37.0 37.0 8 36.1635 37.0 37.0 37.0 37.0 37.0 9 36.1735 37.0 37.0 37.0 37.0 37.0 10-14 36.0269 37.0 37.0 37.0 37.0 37.0 15-19 36.065400000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.0675 37.0 37.0 37.0 37.0 37.0 25-29 35.970000000000006 37.0 37.0 37.0 37.0 37.0 30-34 35.9225 37.0 37.0 37.0 37.0 37.0 35-39 35.9651 37.0 37.0 37.0 37.0 37.0 40-44 35.922200000000004 37.0 37.0 37.0 37.0 37.0 45-49 35.907 37.0 37.0 37.0 37.0 37.0 50-54 35.939299999999996 37.0 37.0 37.0 37.0 37.0 55-59 35.6688 37.0 37.0 37.0 37.0 37.0 60-64 35.664199999999994 37.0 37.0 37.0 37.0 37.0 65-69 35.744899999999994 37.0 37.0 37.0 37.0 37.0 70-74 35.74820000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.76220000000001 37.0 37.0 37.0 37.0 37.0 80-84 35.6924 37.0 37.0 37.0 37.0 37.0 85-89 35.6081 37.0 37.0 37.0 37.0 37.0 90-94 35.591300000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.57610000000001 37.0 37.0 37.0 37.0 37.0 100-104 35.470600000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.462900000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.5346 37.0 37.0 37.0 37.0 37.0 115-119 35.421099999999996 37.0 37.0 37.0 34.6 37.0 120-124 35.4465 37.0 37.0 37.0 37.0 37.0 125-129 34.938300000000005 37.0 37.0 37.0 27.4 37.0 130-134 35.3126 37.0 37.0 37.0 32.2 37.0 135-139 35.037099999999995 37.0 37.0 37.0 29.8 37.0 140-144 35.09599999999999 37.0 37.0 37.0 27.4 37.0 145-149 35.034 37.0 37.0 37.0 25.0 37.0 150-151 34.68725 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 6.0 15 4.0 16 1.0 17 2.0 18 2.0 19 6.0 20 5.0 21 7.0 22 12.0 23 7.0 24 8.0 25 10.0 26 9.0 27 21.0 28 16.0 29 19.0 30 29.0 31 40.0 32 60.0 33 109.0 34 208.0 35 697.0 36 2495.0 37 222.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.95 22.2 13.55 26.3 2 28.375 26.174999999999997 28.349999999999998 17.1 3 22.175 28.125 29.7 20.0 4 25.624999999999996 33.425 22.05 18.9 5 25.775 34.025 23.775 16.425 6 21.349999999999998 38.275 22.8 17.575 7 21.125 23.375 36.65 18.85 8 22.925 25.275 27.150000000000002 24.65 9 22.275 25.8 29.075 22.85 10-14 25.335 29.25 24.959999999999997 20.455000000000002 15-19 24.345 28.1 27.02 20.535 20-24 23.53 28.325 27.07 21.075 25-29 24.2 28.625 26.72 20.455000000000002 30-34 24.025 27.884999999999998 27.015 21.075 35-39 23.53 27.900000000000002 27.389999999999997 21.18 40-44 23.66 27.87 27.025 21.445 45-49 23.125 28.17 28.265 20.44 50-54 23.544999999999998 28.345 26.56 21.55 55-59 23.575 28.57 27.150000000000002 20.705000000000002 60-64 23.57 27.944999999999997 27.334999999999997 21.15 65-69 23.165 28.68 27.284999999999997 20.87 70-74 23.61 27.839999999999996 27.235 21.315 75-79 23.189999999999998 28.08 27.839999999999996 20.89 80-84 23.849999999999998 28.410000000000004 26.72 21.02 85-89 23.244999999999997 27.925 27.42 21.41 90-94 23.995 27.68 26.875 21.45 95-99 23.82 27.810000000000002 27.54 20.830000000000002 100-104 23.544999999999998 28.32 27.339999999999996 20.794999999999998 105-109 23.76 28.565 27.155 20.52 110-114 23.775 28.665000000000003 26.840000000000003 20.72 115-119 23.580000000000002 27.67 28.044999999999998 20.705000000000002 120-124 23.945 28.325 27.11 20.62 125-129 23.95 27.884999999999998 27.589999999999996 20.575 130-134 25.235000000000003 28.02 26.884999999999998 19.86 135-139 23.655 28.15 28.33 19.865 140-144 25.180000000000003 28.51 26.534999999999997 19.775000000000002 145-149 25.6 27.655 27.47 19.275000000000002 150-151 25.825 27.187499999999996 27.500000000000004 19.4875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 1.0 5 0.5 6 0.0 7 0.5 8 1.0 9 2.0 10 2.5 11 2.0 12 2.0 13 2.0 14 2.0 15 3.0 16 3.5 17 4.0 18 4.0 19 1.5 20 0.5 21 2.0 22 3.0 23 2.0 24 2.0 25 2.0 26 3.0 27 4.5 28 6.5 29 9.5 30 16.0 31 22.0 32 23.5 33 26.0 34 39.0 35 58.0 36 81.0 37 100.5 38 116.0 39 147.5 40 180.5 41 202.5 42 214.5 43 230.5 44 255.0 45 274.0 46 261.5 47 239.0 48 227.5 49 212.5 50 185.0 51 156.0 52 128.5 53 108.5 54 102.0 55 73.0 56 47.5 57 44.5 58 40.5 59 33.0 60 22.5 61 15.5 62 10.5 63 5.5 64 5.0 65 2.5 66 0.5 67 2.0 68 3.0 69 2.0 70 1.0 71 1.0 72 1.0 73 1.0 74 1.0 75 1.5 76 1.5 77 0.5 78 0.0 79 0.0 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.5 86 1.0 87 0.5 88 0.5 89 0.5 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.65 #Duplication Level Percentage of deduplicated Percentage of total 1 84.16019127316198 70.39999999999999 2 12.701733413030484 21.25 3 2.6598924088463836 6.675000000000001 4 0.41841004184100417 1.4000000000000001 5 0.029886431560071723 0.125 6 0.029886431560071723 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit GCATAAAGTGATGGAGCGATTGGCAAACCCTGGTGTTAGGCGTCTTGTCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.7250000000000001 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 1.0 0.0 0.0 0.0 0.0 98-99 1.2 0.0 0.0 0.0 0.0 100-101 1.475 0.0 0.0 0.0 0.0 102-103 1.6625 0.0 0.0 0.0 0.0 104-105 1.9 0.0 0.0 0.0 0.0 106-107 2.1625 0.0 0.0 0.0 0.0 108-109 2.3875 0.0 0.0 0.0 0.0 110-111 2.6375 0.0 0.0 0.0 0.0 112-113 2.8875 0.0 0.0 0.0 0.0 114-115 3.1375 0.0 0.0 0.0 0.0 116-117 3.3375 0.0 0.0 0.0 0.0 118-119 3.525 0.0 0.0 0.0 0.0 120-121 3.8 0.0 0.0 0.0 0.0 122-123 4.1 0.0 0.0 0.0 0.0 124-125 4.5125 0.0 0.0 0.0 0.0 126-127 4.875 0.0 0.0 0.0 0.0 128-129 5.375 0.0 0.0 0.0 0.0 130-131 5.825 0.0 0.0 0.0 0.0 132-133 6.25 0.0 0.0 0.0 0.0 134-135 6.775 0.0 0.0 0.0 0.0 136-137 7.2375 0.0 0.0 0.0 0.0 138-139 7.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 35 0.0035366106 20.714287 55-59 >>END_MODULE Read 1641582 spots for SRR28623244.sra Written 1641582 spots for SRR28623244.sra Read 1641582 spots for SRR28623244.sra Written 1641582 spots for SRR28623244.sra Read 1641582 spots for SRR28623244.sra Written 1641582 spots for SRR28623244.sra Read 1641582 spots for SRR28623244.sra Written 1641582 spots for SRR28623244.sra Read 1641582 spots for SRR28623244.sra Written 1641582 spots for SRR28623244.sra Read 1641582 spots for SRR28623244.sra Written 1641582 spots for SRR28623244.sra Read 1641582 spots for SRR28623244.sra Written 1641582 spots for SRR28623244.sra Read 1641582 spots for SRR28623244.sra Written 1641582 spots for SRR28623244.sra Read 1641582 spots for SRR28623244.sra Written 1641582 spots for SRR28623244.sra Read 1641582 spots for SRR28623244.sra Written 1641582 spots for SRR28623244.sra Read 1641582 spots for SRR28623244.sra Written 1641582 spots for SRR28623244.sra Read 1641582 spots for SRR28623244.sra Written 1641582 spots for SRR28623244.sra Read 1641582 spots for SRR28623244.sra Written 1641582 spots for SRR28623244.sra Read 1641582 spots for SRR28623244.sra Written 1641582 spots for SRR28623244.sra Read 1641582 spots for SRR28623244.sra Written 1641582 spots for SRR28623244.sra Read 1641582 spots for SRR28623244.sra Written 1641582 spots for SRR28623244.sra Read 1641582 spots for SRR28623244.sra Written 1641582 spots for SRR28623244.sra Read 1641582 spots for SRR28623244.sra Written 1641582 spots for SRR28623244.sra Read 1641582 spots for SRR28623244.sra Written 1641582 spots for SRR28623244.sra Read 1641600 spots for SRR28623244.sra Written 1641600 spots for SRR28623244.sra SRR ids: ['SRR28623244.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lwpdlie_ SRR28623244.sra spots: 32831658 blocks: [[1, 1641582], [1641583, 3283164], [3283165, 4924746], [4924747, 6566328], [6566329, 8207910], [8207911, 9849492], [9849493, 11491074], [11491075, 13132656], [13132657, 14774238], [14774239, 16415820], [16415821, 18057402], [18057403, 19698984], [19698985, 21340566], [21340567, 22982148], [22982149, 24623730], [24623731, 26265312], [26265313, 27906894], [27906895, 29548476], [29548477, 31190058], [31190059, 32831658]] SRR28623244 file size 12123571 SRR28623244 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623244 SRR28623244_1.fastq SRR28623244_2.fastq Input file: SRR28623244_1.fastq Paired file: SRR28623244_2.fastq trimmed: SRR28623244-trimmed-pair1.fastq, SRR28623244-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:00:53 2025 >> started Thu Feb 13 16:01:31 2025 >> done (37.402s) 32831658 read pairs processed; of these: 23 ( 0.00%) short read pairs filtered out after trimming by size control 42265 ( 0.13%) empty read pairs filtered out after trimming by size control 32789370 (99.87%) read pairs available; of these: 3647984 (11.13%) trimmed read pairs available after processing 29141386 (88.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 9 0.00% 21 6 0.00% 22 1 0.00% 23 3 0.00% 24 6 0.00% 25 3 0.00% 26 9 0.00% 27 12 0.00% 28 7 0.00% 29 11 0.00% 30 14 0.00% 31 19 0.00% 32 15 0.00% 33 16 0.00% 34 25 0.00% 35 25 0.00% 36 24 0.00% 37 19 0.00% 38 31 0.00% 39 36 0.00% 40 55 0.00% 41 43 0.00% 42 43 0.00% 43 64 0.00% 44 68 0.00% 45 55 0.00% 46 60 0.00% 47 79 0.00% 48 101 0.00% 49 114 0.00% 50 125 0.00% 51 138 0.00% 52 148 0.00% 53 185 0.00% 54 183 0.00% 55 229 0.00% 56 225 0.00% 57 259 0.00% 58 272 0.00% 59 411 0.00% 60 412 0.00% 61 470 0.00% 62 571 0.00% 63 660 0.00% 64 804 0.00% 65 802 0.00% 66 934 0.00% 67 1103 0.00% 68 1173 0.00% 69 1375 0.00% 70 1531 0.00% 71 1857 0.01% 72 2092 0.01% 73 2360 0.01% 74 2665 0.01% 75 3054 0.01% 76 3494 0.01% 77 3748 0.01% 78 4160 0.01% 79 4840 0.01% 80 5203 0.02% 81 5873 0.02% 82 6795 0.02% 83 7212 0.02% 84 8015 0.02% 85 9076 0.03% 86 9553 0.03% 87 10543 0.03% 88 11417 0.03% 89 12278 0.04% 90 13352 0.04% 91 14288 0.04% 92 15583 0.05% 93 16857 0.05% 94 18520 0.06% 95 19616 0.06% 96 20925 0.06% 97 21941 0.07% 98 23156 0.07% 99 24423 0.07% 100 25811 0.08% 101 26672 0.08% 102 27877 0.09% 103 29624 0.09% 104 31170 0.10% 105 32759 0.10% 106 34536 0.11% 107 35730 0.11% 108 37707 0.11% 109 38741 0.12% 110 39617 0.12% 111 41115 0.13% 112 43105 0.13% 113 44267 0.14% 114 45975 0.14% 115 48163 0.15% 116 49940 0.15% 117 51469 0.16% 118 52986 0.16% 119 54816 0.17% 120 56019 0.17% 121 57859 0.18% 122 58447 0.18% 123 60822 0.19% 124 62946 0.19% 125 63820 0.19% 126 65854 0.20% 127 68382 0.21% 128 69138 0.21% 129 71935 0.22% 130 73296 0.22% 131 75179 0.23% 132 76847 0.23% 133 79077 0.24% 134 79865 0.24% 135 81327 0.25% 136 82767 0.25% 137 85803 0.26% 138 87294 0.27% 139 90468 0.28% 140 91364 0.28% 141 92575 0.28% 142 94514 0.29% 143 95972 0.29% 144 98501 0.30% 145 99750 0.30% 146 99912 0.30% 147 101425 0.31% 148 104780 0.32% 149 105772 0.32% 150 108308 0.33% 151 29141386 88.87% 32789370 reads passed initial QC criterion=sequence-density sequence-density=0.84 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=28 prefix-density=0.82 prefix-fanout=1.9 sequence=GTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=43.06 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=2.1 sequence=TGAATGGTGCACATTACGGGTCCATGGCACAAAATCAGAGGATAACAATATCCATTCAAGACTATGCAACAATATAATTTGATTATCCTTAGAAAGTGCTTCTCCTTACACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.85 fanout-score-rank=13 prefix-density=1.01 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=15.22 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=2.9 sequence=TAGCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR28623244 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:02:14 Started mapping on | Feb 13 16:02:14 Finished on | Feb 13 16:06:07 Mapping speed, Million of reads per hour | 506.62 Number of input reads | 32789370 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 30258534 Uniquely mapped reads % | 92.28% Average mapped length | 295.23 Number of splices: Total | 26442446 Number of splices: Annotated (sjdb) | 25896419 Number of splices: GT/AG | 25864006 Number of splices: GC/AG | 482389 Number of splices: AT/AC | 21035 Number of splices: Non-canonical | 75016 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 846122 % of reads mapped to multiple loci | 2.58% Number of reads mapped to too many loci | 244760 % of reads mapped to too many loci | 0.75% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.15% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1684714 1684714 1684714 N_multimapping 846122 846122 846122 N_noFeature 999942 29839437 1144044 N_ambiguous 484813 1961 208595 UnstrandedReadsAssigned:28773779 PositiveStrandReadsAssigned:417136 NegativeStrandReadsAssigned:28905895 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623244 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623244-trimmed-pair1.fastq SRR28623244-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,789,370 reads, 29,572,727 reads pseudoaligned [quant] estimated average fragment length: 237.021 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,186 rounds 52401 SRR28623244.ke.tsv 34699 SRR28623244.se.tsv 87100 total ==> SRR28623244.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1781.98 1136 20.2429 Potri.005G024800.1.v4.1 1035 798.979 154 6.12043 Potri.004G059700.1.v4.1 961 724.998 84 3.67908 Potri.007G009000.2.v4.1 1416 1179.98 0 0 Potri.003G141000.2.v4.1 2943 2706.98 461.844 5.4176 Potri.016G087400.1.v4.1 270 83.7538 1064.22 403.48 Potri.015G069301.1.v4.1 564 332.617 0 0 Potri.010G195200.1.v4.1 1773 1536.98 2 0.0413199 Potri.012G127500.1.v4.1 977 740.984 4275 183.199 ==> SRR28623244.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 31 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 489 Potri.001G212900.v4.1 428 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR28623244 completed mapping pipeline successfully