Starting /dee2/code/volunteer_pipeline.sh SRR28623245 current disk space = 3088797761536 free memory = 1502272884 SRR28623245 SRAfilesize ce86a587e28edfd5ca6060f5df9cbda1 SRR28623245.sra SRR28623245.sra file validated SRR28623245 is paired end SRR28623245 is conventional basespace SRR28623245 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623245_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.399 37.0 37.0 37.0 37.0 37.0 2 36.29 37.0 37.0 37.0 37.0 37.0 3 36.518 37.0 37.0 37.0 37.0 37.0 4 36.588 37.0 37.0 37.0 37.0 37.0 5 36.5815 37.0 37.0 37.0 37.0 37.0 6 36.586 37.0 37.0 37.0 37.0 37.0 7 36.5335 37.0 37.0 37.0 37.0 37.0 8 36.398 37.0 37.0 37.0 37.0 37.0 9 36.6205 37.0 37.0 37.0 37.0 37.0 10-14 36.549 37.0 37.0 37.0 37.0 37.0 15-19 36.5594 37.0 37.0 37.0 37.0 37.0 20-24 36.4692 37.0 37.0 37.0 37.0 37.0 25-29 36.425200000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.4737 37.0 37.0 37.0 37.0 37.0 35-39 36.4248 37.0 37.0 37.0 37.0 37.0 40-44 36.384100000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.328100000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.3001 37.0 37.0 37.0 37.0 37.0 55-59 36.2194 37.0 37.0 37.0 37.0 37.0 60-64 36.2427 37.0 37.0 37.0 37.0 37.0 65-69 36.2791 37.0 37.0 37.0 37.0 37.0 70-74 36.143 37.0 37.0 37.0 37.0 37.0 75-79 36.1897 37.0 37.0 37.0 37.0 37.0 80-84 36.085899999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.0937 37.0 37.0 37.0 37.0 37.0 90-94 36.042500000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.932599999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.938 37.0 37.0 37.0 37.0 37.0 105-109 35.9292 37.0 37.0 37.0 37.0 37.0 110-114 35.8251 37.0 37.0 37.0 37.0 37.0 115-119 35.838300000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.7043 37.0 37.0 37.0 37.0 37.0 125-129 35.5909 37.0 37.0 37.0 37.0 37.0 130-134 35.7396 37.0 37.0 37.0 37.0 37.0 135-139 35.596199999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.2735 37.0 37.0 37.0 34.6 37.0 145-149 35.1788 37.0 37.0 37.0 29.8 37.0 150-151 34.9485 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 2.0 24 2.0 25 5.0 26 4.0 27 13.0 28 15.0 29 17.0 30 38.0 31 53.0 32 73.0 33 85.0 34 133.0 35 423.0 36 2882.0 37 253.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.47088353413655 13.002008032128515 9.914658634538153 40.61244979919679 2 18.175 14.075 37.325 30.425 3 18.25 17.224999999999998 27.325 37.2 4 22.2 25.3 25.35 27.150000000000002 5 24.15 31.624999999999996 24.474999999999998 19.75 6 20.225 36.475 22.35 20.95 7 14.95 27.325 40.675 17.05 8 16.6 28.349999999999998 31.175000000000004 23.875 9 17.825 24.55 33.550000000000004 24.075 10-14 19.215 30.635 28.175 21.975 15-19 19.45 28.415000000000003 28.74 23.395 20-24 19.72 28.720000000000002 28.18 23.380000000000003 25-29 19.675 29.360000000000003 27.87 23.095 30-34 19.13 29.465000000000003 27.85 23.555 35-39 19.53 28.605000000000004 27.900000000000002 23.965 40-44 19.485 28.87 27.58 24.065 45-49 19.23 28.765 28.09 23.915 50-54 18.87 28.994999999999997 27.96 24.175 55-59 19.32 29.110000000000003 28.060000000000002 23.51 60-64 19.689999999999998 28.435 27.915 23.96 65-69 19.1 28.42 28.689999999999998 23.79 70-74 19.835 28.565 27.665 23.935000000000002 75-79 19.945 28.945 27.58 23.53 80-84 20.78 28.599999999999998 26.8 23.82 85-89 20.13 29.325000000000003 26.815 23.73 90-94 20.105 28.799999999999997 27.675 23.419999999999998 95-99 19.93 28.689999999999998 27.450000000000003 23.93 100-104 20.53 28.465 27.245 23.76 105-109 20.580000000000002 28.345 27.49 23.585 110-114 21.125 28.804999999999996 26.41 23.66 115-119 20.69 28.810000000000002 27.11 23.39 120-124 20.674999999999997 28.435 27.275 23.615 125-129 20.49 29.03 27.08 23.400000000000002 130-134 20.755000000000003 28.775000000000002 27.175 23.294999999999998 135-139 20.785 28.565 26.445 24.205 140-144 20.945 28.235 26.495 24.325 145-149 20.31 28.49 26.729999999999997 24.47 150-151 21.0125 27.750000000000004 26.7125 24.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 1.0 22 2.0 23 2.5 24 3.0 25 3.5 26 4.5 27 10.5 28 16.5 29 14.5 30 23.0 31 36.0 32 41.5 33 59.0 34 71.0 35 76.0 36 95.0 37 125.0 38 151.5 39 164.5 40 184.0 41 215.5 42 242.0 43 266.0 44 264.5 45 262.5 46 265.5 47 237.0 48 212.0 49 196.0 50 170.0 51 136.5 52 98.0 53 72.0 54 59.5 55 44.5 56 33.0 57 27.5 58 22.0 59 17.5 60 14.5 61 11.5 62 8.5 63 7.5 64 6.5 65 4.5 66 3.5 67 1.5 68 2.0 69 1.5 70 1.0 71 1.0 72 1.5 73 1.5 74 1.0 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 86.08367228355607 74.075 2 12.085996513654852 20.8 3 1.4816966879721092 3.8249999999999997 4 0.2905287623474724 1.0 5 0.029052876234747237 0.125 6 0.0 0.0 7 0.029052876234747237 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGTCGACGTAGTCCATGACCTGTTGGCAAGTTTGCTCGATTGTCTTGCA 7 0.17500000000000002 No Hit CCGCAACTTAAGCATGTGCTCGGTAAGCAATTTATCATCTCGTTCGCTCA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.38749999999999996 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.6625 0.0 0.0 0.0 0.0 92-93 0.7375 0.0 0.0 0.0 0.0 94-95 0.775 0.0 0.0 0.0 0.0 96-97 1.0375 0.0 0.0 0.0 0.0 98-99 1.275 0.0 0.0 0.0 0.0 100-101 1.475 0.0 0.0 0.0 0.0 102-103 1.8 0.0 0.0 0.0 0.0 104-105 2.1875 0.0 0.0 0.0 0.0 106-107 2.6 0.0 0.0 0.0 0.0 108-109 3.125 0.0 0.0 0.0 0.0 110-111 3.6500000000000004 0.0 0.0 0.0 0.0 112-113 4.075 0.0 0.0 0.0 0.0 114-115 4.574999999999999 0.0 0.0 0.0 0.0 116-117 5.275 0.0 0.0 0.0 0.0 118-119 5.9125 0.0 0.0 0.0 0.0 120-121 6.525 0.0 0.0 0.0 0.0 122-123 6.987500000000001 0.0 0.0 0.0 0.0 124-125 7.4625 0.0 0.0 0.0 0.0 126-127 8.0875 0.0 0.0 0.0 0.0 128-129 8.65 0.0 0.0 0.0 0.0 130-131 9.2875 0.0 0.0 0.0 0.0 132-133 9.9625 0.0 0.0 0.0 0.0 134-135 10.774999999999999 0.0 0.0 0.0 0.0 136-137 11.5125 0.0 0.0 0.0 0.0 138-139 12.462499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTATAG 10 0.006830828 145.0 5 TCCAGTC 30 0.0014437955 24.166668 140-144 ACTCCAG 40 0.0076550315 18.125 140-144 >>END_MODULE SRR28623245 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623245_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9585 37.0 37.0 37.0 37.0 37.0 2 36.221 37.0 37.0 37.0 37.0 37.0 3 36.2315 37.0 37.0 37.0 37.0 37.0 4 36.174 37.0 37.0 37.0 37.0 37.0 5 36.247 37.0 37.0 37.0 37.0 37.0 6 36.121 37.0 37.0 37.0 37.0 37.0 7 36.2665 37.0 37.0 37.0 37.0 37.0 8 36.0735 37.0 37.0 37.0 37.0 37.0 9 36.1405 37.0 37.0 37.0 37.0 37.0 10-14 36.0681 37.0 37.0 37.0 37.0 37.0 15-19 36.0629 37.0 37.0 37.0 37.0 37.0 20-24 35.9959 37.0 37.0 37.0 37.0 37.0 25-29 35.950599999999994 37.0 37.0 37.0 37.0 37.0 30-34 35.8993 37.0 37.0 37.0 37.0 37.0 35-39 35.8714 37.0 37.0 37.0 37.0 37.0 40-44 35.8552 37.0 37.0 37.0 37.0 37.0 45-49 35.8137 37.0 37.0 37.0 37.0 37.0 50-54 35.7849 37.0 37.0 37.0 37.0 37.0 55-59 35.629599999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.585699999999996 37.0 37.0 37.0 37.0 37.0 65-69 35.622499999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.7018 37.0 37.0 37.0 37.0 37.0 75-79 35.6941 37.0 37.0 37.0 37.0 37.0 80-84 35.500099999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.534 37.0 37.0 37.0 37.0 37.0 90-94 35.4894 37.0 37.0 37.0 37.0 37.0 95-99 35.483000000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.4272 37.0 37.0 37.0 37.0 37.0 105-109 35.3509 37.0 37.0 37.0 34.6 37.0 110-114 35.434400000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.36710000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.36559999999999 37.0 37.0 37.0 34.6 37.0 125-129 34.9207 37.0 37.0 37.0 25.0 37.0 130-134 35.1905 37.0 37.0 37.0 32.2 37.0 135-139 34.9831 37.0 37.0 37.0 25.0 37.0 140-144 35.011700000000005 37.0 37.0 37.0 25.0 37.0 145-149 34.936099999999996 37.0 37.0 37.0 25.0 37.0 150-151 34.50075 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 7.0 14 9.0 15 10.0 16 5.0 17 2.0 18 4.0 19 2.0 20 2.0 21 7.0 22 5.0 23 10.0 24 11.0 25 12.0 26 9.0 27 20.0 28 11.0 29 23.0 30 26.0 31 42.0 32 68.0 33 95.0 34 228.0 35 678.0 36 2462.0 37 249.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.375 20.349999999999998 13.450000000000001 23.825 2 27.85 26.825 28.9 16.425 3 22.05 28.675 31.075000000000003 18.2 4 24.775 33.15 23.5 18.575 5 25.074999999999996 36.1 22.2 16.625 6 21.224999999999998 39.375 22.675 16.725 7 21.425 21.0 37.95 19.625 8 20.8 26.1 28.525 24.575 9 22.025 25.05 30.975 21.95 10-14 24.51 29.304999999999996 26.005 20.18 15-19 24.385 28.025 27.6 19.99 20-24 24.34 28.18 27.305 20.175 25-29 24.54 28.79 26.715 19.955000000000002 30-34 24.169999999999998 27.894999999999996 27.839999999999996 20.095 35-39 23.84 28.305000000000003 27.92 19.935 40-44 24.154999999999998 28.110000000000003 27.375 20.36 45-49 23.52 29.160000000000004 27.21 20.11 50-54 24.195 27.994999999999997 28.08 19.73 55-59 24.055 28.335 27.639999999999997 19.97 60-64 23.794999999999998 27.77 28.32 20.115 65-69 24.015 28.38 27.565 20.04 70-74 24.195 27.955000000000002 27.785 20.064999999999998 75-79 24.065 28.134999999999998 27.665 20.135 80-84 24.51 28.42 27.334999999999997 19.735 85-89 24.305 28.110000000000003 27.200000000000003 20.385 90-94 23.71 28.775000000000002 27.095000000000002 20.419999999999998 95-99 24.125 28.255000000000003 27.334999999999997 20.285 100-104 24.255 27.589999999999996 27.915 20.24 105-109 24.41 28.84 27.46 19.29 110-114 24.485 27.99 27.48 20.044999999999998 115-119 24.79 28.544999999999998 26.905 19.759999999999998 120-124 24.68 28.1 28.03 19.189999999999998 125-129 25.61 28.42 26.915 19.055 130-134 26.115 28.28 26.405 19.2 135-139 25.974999999999998 28.315 26.855 18.855 140-144 25.66 28.449999999999996 26.674999999999997 19.215 145-149 26.13 27.875 26.884999999999998 19.11 150-151 26.7125 28.012500000000003 26.187500000000004 19.0875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 2.0 8 2.5 9 1.0 10 0.5 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.5 17 1.0 18 1.0 19 1.0 20 0.5 21 0.5 22 0.5 23 1.0 24 3.0 25 4.0 26 4.5 27 11.0 28 10.5 29 10.0 30 14.5 31 23.0 32 31.5 33 40.5 34 58.5 35 69.0 36 89.0 37 115.0 38 136.0 39 163.5 40 199.5 41 232.0 42 253.0 43 266.0 44 259.5 45 261.5 46 255.0 47 235.0 48 222.5 49 205.5 50 184.5 51 138.5 52 95.0 53 83.5 54 67.5 55 49.0 56 40.0 57 23.0 58 15.0 59 17.0 60 15.0 61 10.5 62 8.5 63 10.0 64 8.0 65 3.5 66 2.0 67 1.0 68 1.0 69 1.5 70 2.5 71 3.5 72 2.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.5 81 1.5 82 1.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.5 88 1.5 89 1.5 90 1.5 91 2.5 92 2.5 93 2.0 94 1.0 95 0.0 96 0.0 97 2.0 98 3.5 99 1.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.175 #Duplication Level Percentage of deduplicated Percentage of total 1 86.56803017116333 74.6 2 11.488250652741515 19.8 3 1.624601102407891 4.2 4 0.23208587177255585 0.8 5 0.02901073397156948 0.125 6 0.0 0.0 7 0.02901073397156948 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.02901073397156948 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 12 0.3 No Hit GTGGTATCAACATGGATACCAGTCTCAGAGAGTGCCAAAACAGACAAACC 7 0.17500000000000002 No Hit AAGCAATTGCTGCATGCACTGAAGCAATAGAGGCGCAGAAAGGGAAACTT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.38749999999999996 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.6625 0.0 0.0 0.0 0.0 92-93 0.7375 0.0 0.0 0.0 0.0 94-95 0.775 0.0 0.0 0.0 0.0 96-97 1.0375 0.0 0.0 0.0 0.0 98-99 1.275 0.0 0.0 0.0 0.0 100-101 1.475 0.0 0.0 0.0 0.0 102-103 1.775 0.0 0.0 0.0 0.0 104-105 2.1624999999999996 0.0 0.0 0.0 0.0 106-107 2.5625 0.0 0.0 0.0 0.0 108-109 3.1 0.0 0.0 0.0 0.0 110-111 3.625 0.0 0.0 0.0 0.0 112-113 4.05 0.0 0.0 0.0 0.0 114-115 4.550000000000001 0.0 0.0 0.0 0.0 116-117 5.275 0.0 0.0 0.0 0.0 118-119 5.9 0.0 0.0 0.0 0.0 120-121 6.5375 0.0 0.0 0.0 0.0 122-123 7.025 0.0 0.0 0.0 0.0 124-125 7.5375 0.0 0.0 0.0 0.0 126-127 8.2 0.0 0.0 0.0 0.0 128-129 8.775 0.0 0.0 0.0 0.0 130-131 9.399999999999999 0.0 0.0 0.0 0.0 132-133 10.1125 0.0 0.0 0.0 0.0 134-135 10.9375 0.0 0.0 0.0 0.0 136-137 11.675 0.0 0.0 0.0 0.0 138-139 12.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCGAAC 10 0.006830828 145.0 3 TCGAACA 10 0.006830828 145.0 4 GCTCGAA 10 0.006830828 145.0 2 CGAACAC 10 0.006830828 145.0 5 CACCACG 10 0.006830828 145.0 9 AAGAGTG 40 0.0076550315 18.125 5 >>END_MODULE Read 1506404 spots for SRR28623245.sra Written 1506404 spots for SRR28623245.sra Read 1506404 spots for SRR28623245.sra Written 1506404 spots for SRR28623245.sra Read 1506404 spots for SRR28623245.sra Written 1506404 spots for SRR28623245.sra Read 1506404 spots for SRR28623245.sra Written 1506404 spots for SRR28623245.sra Read 1506404 spots for SRR28623245.sra Written 1506404 spots for SRR28623245.sra Read 1506404 spots for SRR28623245.sra Written 1506404 spots for SRR28623245.sra Read 1506404 spots for SRR28623245.sra Written 1506404 spots for SRR28623245.sra Read 1506404 spots for SRR28623245.sra Written 1506404 spots for SRR28623245.sra Read 1506404 spots for SRR28623245.sra Written 1506404 spots for SRR28623245.sra Read 1506404 spots for SRR28623245.sra Written 1506404 spots for SRR28623245.sra Read 1506404 spots for SRR28623245.sra Written 1506404 spots for SRR28623245.sra Read 1506418 spots for SRR28623245.sra Written 1506418 spots for SRR28623245.sra Read 1506404 spots for SRR28623245.sra Written 1506404 spots for SRR28623245.sra Read 1506404 spots for SRR28623245.sra Written 1506404 spots for SRR28623245.sra Read 1506404 spots for SRR28623245.sra Written 1506404 spots for SRR28623245.sra Read 1506404 spots for SRR28623245.sra Written 1506404 spots for SRR28623245.sra Read 1506404 spots for SRR28623245.sra Written 1506404 spots for SRR28623245.sra Read 1506404 spots for SRR28623245.sra Written 1506404 spots for SRR28623245.sra Read 1506404 spots for SRR28623245.sra Written 1506404 spots for SRR28623245.sra Read 1506404 spots for SRR28623245.sra Written 1506404 spots for SRR28623245.sra SRR ids: ['SRR28623245.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7rljr1ec SRR28623245.sra spots: 30128094 blocks: [[1, 1506404], [1506405, 3012808], [3012809, 4519212], [4519213, 6025616], [6025617, 7532020], [7532021, 9038424], [9038425, 10544828], [10544829, 12051232], [12051233, 13557636], [13557637, 15064040], [15064041, 16570444], [16570445, 18076848], [18076849, 19583252], [19583253, 21089656], [21089657, 22596060], [22596061, 24102464], [24102465, 25608868], [25608869, 27115272], [27115273, 28621676], [28621677, 30128094]] SRR28623245 file size 11124325 SRR28623245 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623245 SRR28623245_1.fastq SRR28623245_2.fastq Input file: SRR28623245_1.fastq Paired file: SRR28623245_2.fastq trimmed: SRR28623245-trimmed-pair1.fastq, SRR28623245-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:03:30 2025 >> started Thu Feb 13 16:04:18 2025 >> done (47.972s) 30128094 read pairs processed; of these: 24 ( 0.00%) short read pairs filtered out after trimming by size control 23091 ( 0.08%) empty read pairs filtered out after trimming by size control 30104979 (99.92%) read pairs available; of these: 4844434 (16.09%) trimmed read pairs available after processing 25260545 (83.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 6 0.00% 20 6 0.00% 21 9 0.00% 22 6 0.00% 23 3 0.00% 24 8 0.00% 25 2 0.00% 26 10 0.00% 27 7 0.00% 28 17 0.00% 29 13 0.00% 30 12 0.00% 31 11 0.00% 32 18 0.00% 33 27 0.00% 34 27 0.00% 35 33 0.00% 36 24 0.00% 37 39 0.00% 38 31 0.00% 39 53 0.00% 40 54 0.00% 41 61 0.00% 42 68 0.00% 43 75 0.00% 44 90 0.00% 45 83 0.00% 46 81 0.00% 47 103 0.00% 48 135 0.00% 49 167 0.00% 50 176 0.00% 51 227 0.00% 52 257 0.00% 53 255 0.00% 54 290 0.00% 55 310 0.00% 56 386 0.00% 57 456 0.00% 58 457 0.00% 59 595 0.00% 60 682 0.00% 61 739 0.00% 62 878 0.00% 63 1031 0.00% 64 1140 0.00% 65 1213 0.00% 66 1436 0.00% 67 1637 0.01% 68 1816 0.01% 69 2113 0.01% 70 2492 0.01% 71 2836 0.01% 72 3246 0.01% 73 3676 0.01% 74 4086 0.01% 75 4854 0.02% 76 5353 0.02% 77 5628 0.02% 78 6551 0.02% 79 7404 0.02% 80 8164 0.03% 81 9091 0.03% 82 10692 0.04% 83 11616 0.04% 84 13116 0.04% 85 14569 0.05% 86 15873 0.05% 87 16879 0.06% 88 18644 0.06% 89 19579 0.07% 90 21241 0.07% 91 23376 0.08% 92 25188 0.08% 93 27311 0.09% 94 29658 0.10% 95 31462 0.10% 96 33363 0.11% 97 35269 0.12% 98 36881 0.12% 99 38928 0.13% 100 41069 0.14% 101 42053 0.14% 102 44692 0.15% 103 47486 0.16% 104 49364 0.16% 105 51764 0.17% 106 54714 0.18% 107 56143 0.19% 108 57704 0.19% 109 60154 0.20% 110 60069 0.20% 111 62990 0.21% 112 64849 0.22% 113 65911 0.22% 114 68814 0.23% 115 71876 0.24% 116 73619 0.24% 117 75676 0.25% 118 77979 0.26% 119 78711 0.26% 120 79928 0.27% 121 82131 0.27% 122 83065 0.28% 123 84947 0.28% 124 87107 0.29% 125 88241 0.29% 126 90388 0.30% 127 92284 0.31% 128 94090 0.31% 129 95102 0.32% 130 96990 0.32% 131 96668 0.32% 132 97784 0.32% 133 100226 0.33% 134 100261 0.33% 135 102314 0.34% 136 103981 0.35% 137 104159 0.35% 138 107050 0.36% 139 108394 0.36% 140 107114 0.36% 141 109460 0.36% 142 110246 0.37% 143 109857 0.36% 144 112547 0.37% 145 113336 0.38% 146 113449 0.38% 147 114684 0.38% 148 116158 0.39% 149 115680 0.38% 150 116755 0.39% 151 25260545 83.91% 30104979 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=40 prefix-density=0.15 prefix-fanout=2.0 sequence=TGCGACATGGTTGGCAAGAATCCTTCTGCGAATTTAGCAACAACCGAAGAATCAAGATACTCCTGCAAGCCCTCCAGATCATCAAAGGTAGTTTCAAAAGCATGAGTATATCCGAAATTGAGGTCGTGAATACCCAGATTAGTGCCCCAGTGTAAGCTCTTCAAGGGTTCAACTTGATTGACCAGATGAGTGAAGTCGTTTATGATTTTCTCAATTT criterion=fanout-score sequence-density=0.06 sequence-density-rank=27 fanout-score=448.77 fanout-score-rank=1 prefix-density=0.74 prefix-fanout=34.4 sequence=TCTTCTTCTTCCT criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=12.19 fanout-score-rank=18 prefix-density=0.13 prefix-fanout=12.2 sequence=GAGAGAGAGAGTTAAGACAATGGCCTCGAAGAAATCTGCAATCGTATTACCTGGTTCAAAGGTGTTGAAGCACATAGTTTTTGTACGGTTTAATGATGGGATCACTGATGAACAAATTGAGAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=38 fanout-score=561.32 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=26.0 sequence=ACAAGAAGATCAACTGTCTCTCTGCCTGGTTTGTATTCCAAGAAATGGAGAAAGTCCAAAAGCTCTTTTGTGTGGCTCTATTGCTTGCAGTACTAGCCATAGCAAGCAATATTGCGAATGCCCAGAGTACCATATGCAAAATGCCTGTTGCTGGCCTAATGTCATGCAAGCCTTCTGTAACTCCTCCTAACCCTACCGCACCCTCGGCAGACTGCTGCTCGGCACTTTCGCATGCTGACATAAACTGCCTTTGCTCCTACAAAAATTCCAACCTGCTCCCTTCCCTTGGAATCGACCCAAAACTTGCCATGCAGCTCCCTGGCAAGTGCA SRR28623245 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:05:44 Started mapping on | Feb 13 16:05:45 Finished on | Feb 13 16:08:40 Mapping speed, Million of reads per hour | 619.30 Number of input reads | 30104979 Average input read length | 285 UNIQUE READS: Uniquely mapped reads number | 24757946 Uniquely mapped reads % | 82.24% Average mapped length | 286.75 Number of splices: Total | 23073500 Number of splices: Annotated (sjdb) | 22485167 Number of splices: GT/AG | 22662110 Number of splices: GC/AG | 306157 Number of splices: AT/AC | 22049 Number of splices: Non-canonical | 83184 Mismatch rate per base, % | 0.47% Deletion rate per base | 0.03% Deletion average length | 2.95 Insertion rate per base | 0.03% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 709027 % of reads mapped to multiple loci | 2.36% Number of reads mapped to too many loci | 163227 % of reads mapped to too many loci | 0.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 14.62% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4638006 4638006 4638006 N_multimapping 709027 709027 709027 N_noFeature 1031366 24477051 1157026 N_ambiguous 455161 5471 295608 UnstrandedReadsAssigned:23271419 PositiveStrandReadsAssigned:275424 NegativeStrandReadsAssigned:23305312 Dataset is classified negative stranded MeadianReadLen=143 20thPercentileLength=143 echo kmer=139 SRR28623245 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623245-trimmed-pair1.fastq SRR28623245-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,104,979 reads, 27,002,547 reads pseudoaligned [quant] estimated average fragment length: 219.603 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,117 rounds 52401 SRR28623245.ke.tsv 34699 SRR28623245.se.tsv 87100 total ==> SRR28623245.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1799.4 1684 33.0666 Potri.005G024800.1.v4.1 1035 816.397 1332 57.647 Potri.004G059700.1.v4.1 961 742.416 433 20.607 Potri.007G009000.2.v4.1 1416 1197.4 1 0.0295077 Potri.003G141000.2.v4.1 2943 2724.4 777.219 10.0797 Potri.016G087400.1.v4.1 270 99.8797 2746.51 971.579 Potri.015G069301.1.v4.1 564 350.529 0 0 Potri.010G195200.1.v4.1 1773 1554.4 58 1.31838 Potri.012G127500.1.v4.1 977 758.407 18125 844.403 ==> SRR28623245.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3045 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 584 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 23 Potri.001G452600.v4.1 4 SRR28623245 completed mapping pipeline successfully