Starting /dee2/code/volunteer_pipeline.sh SRR28623246 current disk space = 3088718163968 free memory = 1457142388 SRR28623246 SRAfilesize b5ce696ad062c0e7ec1fb18759462612 SRR28623246.sra SRR28623246.sra file validated SRR28623246 is paired end SRR28623246 is conventional basespace SRR28623246 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623246_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.35025 37.0 37.0 37.0 37.0 37.0 2 36.467 37.0 37.0 37.0 37.0 37.0 3 36.543 37.0 37.0 37.0 37.0 37.0 4 36.6055 37.0 37.0 37.0 37.0 37.0 5 36.656 37.0 37.0 37.0 37.0 37.0 6 36.6595 37.0 37.0 37.0 37.0 37.0 7 36.567 37.0 37.0 37.0 37.0 37.0 8 36.4995 37.0 37.0 37.0 37.0 37.0 9 36.558 37.0 37.0 37.0 37.0 37.0 10-14 36.5931 37.0 37.0 37.0 37.0 37.0 15-19 36.559000000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.5304 37.0 37.0 37.0 37.0 37.0 25-29 36.4999 37.0 37.0 37.0 37.0 37.0 30-34 36.518299999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.4555 37.0 37.0 37.0 37.0 37.0 40-44 36.417899999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.3914 37.0 37.0 37.0 37.0 37.0 50-54 36.3317 37.0 37.0 37.0 37.0 37.0 55-59 36.2881 37.0 37.0 37.0 37.0 37.0 60-64 36.3375 37.0 37.0 37.0 37.0 37.0 65-69 36.3029 37.0 37.0 37.0 37.0 37.0 70-74 36.2504 37.0 37.0 37.0 37.0 37.0 75-79 36.1858 37.0 37.0 37.0 37.0 37.0 80-84 36.075 37.0 37.0 37.0 37.0 37.0 85-89 36.079600000000006 37.0 37.0 37.0 37.0 37.0 90-94 36.0553 37.0 37.0 37.0 37.0 37.0 95-99 35.9353 37.0 37.0 37.0 37.0 37.0 100-104 35.976600000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.01899999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.90259999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.8809 37.0 37.0 37.0 37.0 37.0 120-124 35.7624 37.0 37.0 37.0 37.0 37.0 125-129 35.6063 37.0 37.0 37.0 37.0 37.0 130-134 35.8231 37.0 37.0 37.0 37.0 37.0 135-139 35.678999999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.3302 37.0 37.0 37.0 34.6 37.0 145-149 35.217 37.0 37.0 37.0 34.6 37.0 150-151 34.87775 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 4.0 25 4.0 26 6.0 27 12.0 28 16.0 29 20.0 30 27.0 31 40.0 32 49.0 33 82.0 34 150.0 35 405.0 36 2926.0 37 256.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.157498116051244 13.38859583019342 10.097965335342879 43.35594071841246 2 19.075 15.475 36.475 28.975 3 18.075 17.025000000000002 28.325 36.575 4 22.05 25.424999999999997 23.549999999999997 28.975 5 24.925 31.95 23.075000000000003 20.05 6 20.05 35.475 24.0 20.474999999999998 7 15.7 28.249999999999996 38.375 17.675 8 18.2 26.974999999999998 33.1 21.725 9 18.45 25.224999999999998 32.725 23.599999999999998 10-14 20.285 30.259999999999998 26.865 22.59 15-19 19.725 28.255000000000003 27.855 24.165 20-24 20.525 28.21 27.12 24.145 25-29 19.645000000000003 28.705000000000002 27.534999999999997 24.115000000000002 30-34 19.57 28.455000000000002 27.68 24.295 35-39 19.98 28.09 27.994999999999997 23.935000000000002 40-44 20.22 28.505000000000003 27.705000000000002 23.57 45-49 19.895 28.725 27.61 23.77 50-54 20.29 28.175 27.405 24.13 55-59 20.335 29.12 26.93 23.615 60-64 19.685 27.994999999999997 28.249999999999996 24.07 65-69 20.355 28.744999999999997 26.935 23.965 70-74 20.89 28.115000000000002 28.015 22.98 75-79 20.265 27.715 28.37 23.65 80-84 20.865000000000002 28.16 28.13 22.845 85-89 20.195 27.92 28.005000000000003 23.880000000000003 90-94 20.53 27.98 27.63 23.86 95-99 21.19 28.305000000000003 27.450000000000003 23.055 100-104 21.23 28.22 26.889999999999997 23.66 105-109 21.27 28.105000000000004 27.065 23.56 110-114 21.085 28.165000000000003 27.025 23.724999999999998 115-119 20.885 28.689999999999998 26.72 23.705000000000002 120-124 20.955 28.48 26.31 24.255 125-129 21.21 28.689999999999998 25.645 24.455 130-134 21.099999999999998 28.57 26.08 24.25 135-139 20.785 29.14 25.28 24.795 140-144 21.505 28.09 25.374999999999996 25.03 145-149 21.215 28.17 25.685000000000002 24.93 150-151 22.112499999999997 28.6875 24.1375 25.0625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 1.5 24 4.5 25 5.5 26 3.0 27 4.0 28 10.0 29 10.5 30 15.0 31 27.0 32 42.5 33 48.5 34 57.5 35 81.0 36 97.5 37 116.5 38 136.5 39 156.0 40 161.5 41 197.0 42 233.5 43 234.5 44 240.5 45 257.5 46 263.0 47 244.0 48 219.5 49 201.0 50 182.0 51 159.5 52 128.0 53 105.5 54 98.5 55 67.5 56 49.0 57 44.0 58 28.5 59 17.5 60 16.0 61 13.0 62 8.0 63 4.0 64 2.0 65 1.5 66 0.5 67 1.0 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.45 #Duplication Level Percentage of deduplicated Percentage of total 1 87.16020821283979 75.35 2 10.43956043956044 18.05 3 2.0242914979757085 5.25 4 0.31810294968189706 1.0999999999999999 5 0.057836899942163095 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTACTTCAAAAGTCCTCTCAATGCCATGCTCGCCATCAAGTAAGATTTC 5 0.125 No Hit CACCAAGTTGGTGCAACTGGAATCGCTCCCCTCATTCTTCCTCAACCACA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.44999999999999996 0.0 0.0 0.0 0.0 88-89 0.525 0.0 0.0 0.0 0.0 90-91 0.675 0.0 0.0 0.0 0.0 92-93 0.8625 0.0 0.0 0.0 0.0 94-95 1.1 0.0 0.0 0.0 0.0 96-97 1.4500000000000002 0.0 0.0 0.0 0.0 98-99 1.825 0.0 0.0 0.0 0.0 100-101 2.1125 0.0 0.0 0.0 0.0 102-103 2.5875000000000004 0.0 0.0 0.0 0.0 104-105 2.95 0.0 0.0 0.0 0.0 106-107 3.425 0.0 0.0 0.0 0.0 108-109 4.0 0.0 0.0 0.0 0.0 110-111 4.550000000000001 0.0 0.0 0.0 0.0 112-113 4.987500000000001 0.0 0.0 0.0 0.0 114-115 5.775 0.0 0.0 0.0 0.0 116-117 6.6125 0.0 0.0 0.0 0.0 118-119 7.275 0.0 0.0 0.0 0.0 120-121 7.9625 0.0 0.0 0.0 0.0 122-123 8.8 0.0 0.0 0.0 0.0 124-125 9.3625 0.0 0.0 0.0 0.0 126-127 10.3 0.0 0.0 0.0 0.0 128-129 11.175 0.0 0.0 0.0 0.0 130-131 11.8125 0.0 0.0 0.0 0.0 132-133 12.600000000000001 0.0 0.0 0.0 0.0 134-135 13.4375 0.0 0.0 0.0 0.0 136-137 14.274999999999999 0.0 0.0 0.0 0.0 138-139 14.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGTAGC 10 0.006830828 145.0 7 CTGGTAG 10 0.006830828 145.0 6 GGTAGCA 10 0.006830828 145.0 8 >>END_MODULE SRR28623246 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623246_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0665 37.0 37.0 37.0 37.0 37.0 2 36.339 37.0 37.0 37.0 37.0 37.0 3 36.387 37.0 37.0 37.0 37.0 37.0 4 36.2655 37.0 37.0 37.0 37.0 37.0 5 36.5145 37.0 37.0 37.0 37.0 37.0 6 36.2685 37.0 37.0 37.0 37.0 37.0 7 36.394 37.0 37.0 37.0 37.0 37.0 8 36.329 37.0 37.0 37.0 37.0 37.0 9 36.287 37.0 37.0 37.0 37.0 37.0 10-14 36.2163 37.0 37.0 37.0 37.0 37.0 15-19 36.2625 37.0 37.0 37.0 37.0 37.0 20-24 36.2333 37.0 37.0 37.0 37.0 37.0 25-29 36.212900000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.12500000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.159499999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.096799999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.1206 37.0 37.0 37.0 37.0 37.0 50-54 36.0853 37.0 37.0 37.0 37.0 37.0 55-59 35.9767 37.0 37.0 37.0 37.0 37.0 60-64 35.93429999999999 37.0 37.0 37.0 37.0 37.0 65-69 35.9902 37.0 37.0 37.0 37.0 37.0 70-74 35.9841 37.0 37.0 37.0 37.0 37.0 75-79 35.943 37.0 37.0 37.0 37.0 37.0 80-84 35.916 37.0 37.0 37.0 37.0 37.0 85-89 35.890499999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.8164 37.0 37.0 37.0 37.0 37.0 95-99 35.8509 37.0 37.0 37.0 37.0 37.0 100-104 35.7678 37.0 37.0 37.0 37.0 37.0 105-109 35.6627 37.0 37.0 37.0 37.0 37.0 110-114 35.797999999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.700900000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.70819999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.28320000000001 37.0 37.0 37.0 32.2 37.0 130-134 35.4831 37.0 37.0 37.0 37.0 37.0 135-139 35.33390000000001 37.0 37.0 37.0 37.0 37.0 140-144 35.3488 37.0 37.0 37.0 34.6 37.0 145-149 35.256499999999996 37.0 37.0 37.0 32.2 37.0 150-151 35.05075 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 3.0 15 6.0 16 4.0 17 4.0 18 3.0 19 2.0 20 4.0 21 1.0 22 6.0 23 4.0 24 3.0 25 7.0 26 13.0 27 7.0 28 14.0 29 27.0 30 16.0 31 35.0 32 51.0 33 108.0 34 160.0 35 582.0 36 2626.0 37 313.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.3 18.625 13.725000000000001 30.349999999999998 2 27.150000000000002 27.075 28.299999999999997 17.474999999999998 3 22.375 27.825 30.125 19.675 4 25.825 32.775 23.325000000000003 18.075 5 26.724999999999998 33.975 22.25 17.05 6 20.9 38.35 22.8 17.95 7 22.525000000000002 20.724999999999998 37.2 19.55 8 23.25 25.6 27.275 23.875 9 23.150000000000002 24.925 29.425 22.5 10-14 24.22 29.24 26.165 20.375 15-19 23.745 27.72 27.29 21.245 20-24 23.905 27.905 27.35 20.84 25-29 23.5 28.475 26.895000000000003 21.13 30-34 22.900000000000002 28.405 27.485 21.21 35-39 22.869999999999997 28.71 27.425 20.995 40-44 23.599999999999998 28.360000000000003 27.950000000000003 20.09 45-49 22.95 27.894999999999996 28.095 21.060000000000002 50-54 24.075 28.22 27.0 20.705000000000002 55-59 22.99 28.299999999999997 27.889999999999997 20.82 60-64 24.295 27.405 27.689999999999998 20.61 65-69 23.365 27.33 27.96 21.345 70-74 23.805 27.91 27.255000000000003 21.029999999999998 75-79 23.87 27.365000000000002 27.810000000000002 20.955 80-84 23.645 28.13 27.150000000000002 21.075 85-89 23.315 28.875 26.905 20.905 90-94 24.09 27.79 27.36 20.76 95-99 23.415 28.494999999999997 27.229999999999997 20.86 100-104 24.025 28.03 27.71 20.235 105-109 23.69 28.415000000000003 27.045 20.849999999999998 110-114 24.21 28.325 27.12 20.345 115-119 24.645 29.104999999999997 26.484999999999996 19.765 120-124 25.05 28.175 26.640000000000004 20.135 125-129 25.1 28.310000000000002 26.71 19.88 130-134 25.72 27.810000000000002 26.534999999999997 19.935 135-139 25.39 28.275 26.56 19.775000000000002 140-144 26.06 28.515 26.135 19.29 145-149 26.155 27.134999999999998 26.82 19.89 150-151 26.325 28.349999999999998 26.075 19.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 1.5 13 1.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.5 19 1.5 20 1.5 21 2.0 22 2.5 23 2.0 24 3.0 25 4.5 26 5.0 27 5.0 28 5.5 29 6.5 30 10.0 31 21.5 32 32.0 33 37.5 34 44.5 35 51.5 36 72.5 37 112.5 38 127.0 39 137.0 40 181.0 41 202.0 42 234.0 43 271.0 44 280.0 45 276.0 46 267.5 47 254.5 48 226.5 49 203.0 50 173.0 51 144.0 52 129.5 53 109.5 54 88.5 55 68.5 56 50.0 57 42.0 58 31.0 59 20.5 60 12.5 61 9.0 62 7.5 63 5.0 64 2.0 65 1.0 66 0.5 67 1.0 68 1.5 69 1.0 70 0.5 71 1.0 72 1.0 73 0.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.5 83 0.5 84 0.0 85 0.5 86 1.0 87 0.5 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.5 99 0.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.625 #Duplication Level Percentage of deduplicated Percentage of total 1 87.61904761904762 75.9 2 9.8989898989899 17.150000000000002 3 2.0779220779220777 5.4 4 0.2886002886002886 1.0 5 0.08658008658008658 0.375 6 0.0 0.0 7 0.02886002886002886 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit GGAAGGCCCAAGAGGCAAGCTGAGCAGGAACTTCAAGCATTTGAATCTTG 5 0.125 No Hit CATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTG 5 0.125 No Hit ACTCTCTACCAATCCACAACTGATGGCAGAAGATGGTTGATGTTCTTGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.44999999999999996 0.0 0.0 0.0 0.0 88-89 0.525 0.0 0.0 0.0 0.0 90-91 0.675 0.0 0.0 0.0 0.0 92-93 0.8625 0.0 0.0 0.0 0.0 94-95 1.1124999999999998 0.0 0.0 0.0 0.0 96-97 1.4500000000000002 0.0 0.0 0.0 0.0 98-99 1.8375 0.0 0.0 0.0 0.0 100-101 2.1375 0.0 0.0 0.0 0.0 102-103 2.625 0.0 0.0 0.0 0.0 104-105 3.0125 0.0 0.0 0.0 0.0 106-107 3.525 0.0 0.0 0.0 0.0 108-109 4.1 0.0 0.0 0.0 0.0 110-111 4.65 0.0 0.0 0.0 0.0 112-113 5.125 0.0 0.0 0.0 0.0 114-115 5.925000000000001 0.0 0.0 0.0 0.0 116-117 6.775 0.0 0.0 0.0 0.0 118-119 7.425 0.0 0.0 0.0 0.0 120-121 8.1125 0.0 0.0 0.0 0.0 122-123 8.9875 0.0 0.0 0.0 0.0 124-125 9.5625 0.0 0.0 0.0 0.0 126-127 10.475 0.0 0.0 0.0 0.0 128-129 11.35 0.0 0.0 0.0 0.0 130-131 12.025 0.0 0.0 0.0 0.0 132-133 12.8125 0.0 0.0 0.0 0.0 134-135 13.6625 0.0 0.0 0.0 0.0 136-137 14.5125 0.0 0.0 0.0 0.0 138-139 15.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATATCA 10 0.006830828 145.0 7 TTATTGT 10 0.006830828 145.0 145 GTATATC 10 0.006830828 145.0 6 CGGGCAG 10 0.006830828 145.0 1 TAGTATA 10 0.006830828 145.0 4 TATCAGT 10 0.006830828 145.0 9 ACTAGTA 10 0.006830828 145.0 2 ATATCAG 10 0.006830828 145.0 8 TACTAGT 10 0.006830828 145.0 1 >>END_MODULE Read 1526127 spots for SRR28623246.sra Written 1526127 spots for SRR28623246.sra Read 1526127 spots for SRR28623246.sra Written 1526127 spots for SRR28623246.sra Read 1526127 spots for SRR28623246.sra Written 1526127 spots for SRR28623246.sra Read 1526127 spots for SRR28623246.sra Written 1526127 spots for SRR28623246.sra Read 1526127 spots for SRR28623246.sra Written 1526127 spots for SRR28623246.sra Read 1526127 spots for SRR28623246.sra Written 1526127 spots for SRR28623246.sra Read 1526127 spots for SRR28623246.sra Written 1526127 spots for SRR28623246.sra Read 1526127 spots for SRR28623246.sra Written 1526127 spots for SRR28623246.sra Read 1526127 spots for SRR28623246.sra Written 1526127 spots for SRR28623246.sra Read 1526127 spots for SRR28623246.sra Written 1526127 spots for SRR28623246.sra Read 1526127 spots for SRR28623246.sra Written 1526127 spots for SRR28623246.sra Read 1526142 spots for SRR28623246.sra Written 1526142 spots for SRR28623246.sra Read 1526127 spots for SRR28623246.sra Written 1526127 spots for SRR28623246.sra Read 1526127 spots for SRR28623246.sra Written 1526127 spots for SRR28623246.sra Read 1526127 spots for SRR28623246.sra Written 1526127 spots for SRR28623246.sra Read 1526127 spots for SRR28623246.sra Written 1526127 spots for SRR28623246.sra Read 1526127 spots for SRR28623246.sra Written 1526127 spots for SRR28623246.sra Read 1526127 spots for SRR28623246.sra Written 1526127 spots for SRR28623246.sra Read 1526127 spots for SRR28623246.sra Written 1526127 spots for SRR28623246.sra Read 1526127 spots for SRR28623246.sra Written 1526127 spots for SRR28623246.sra SRR ids: ['SRR28623246.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5bjkkp2i SRR28623246.sra spots: 30522555 blocks: [[1, 1526127], [1526128, 3052254], [3052255, 4578381], [4578382, 6104508], [6104509, 7630635], [7630636, 9156762], [9156763, 10682889], [10682890, 12209016], [12209017, 13735143], [13735144, 15261270], [15261271, 16787397], [16787398, 18313524], [18313525, 19839651], [19839652, 21365778], [21365779, 22891905], [22891906, 24418032], [24418033, 25944159], [25944160, 27470286], [27470287, 28996413], [28996414, 30522555]] SRR28623246 file size 11270129 SRR28623246 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623246 SRR28623246_1.fastq SRR28623246_2.fastq Input file: SRR28623246_1.fastq Paired file: SRR28623246_2.fastq trimmed: SRR28623246-trimmed-pair1.fastq, SRR28623246-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 15:57:10 2025 >> started Thu Feb 13 15:58:06 2025 >> done (55.455s) 30522555 read pairs processed; of these: 23 ( 0.00%) short read pairs filtered out after trimming by size control 30098 ( 0.10%) empty read pairs filtered out after trimming by size control 30492434 (99.90%) read pairs available; of these: 5605015 (18.38%) trimmed read pairs available after processing 24887419 (81.62%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 4 0.00% 21 7 0.00% 22 3 0.00% 23 3 0.00% 24 8 0.00% 25 3 0.00% 26 4 0.00% 27 9 0.00% 28 13 0.00% 29 15 0.00% 30 12 0.00% 31 11 0.00% 32 16 0.00% 33 20 0.00% 34 21 0.00% 35 7 0.00% 36 33 0.00% 37 23 0.00% 38 44 0.00% 39 46 0.00% 40 47 0.00% 41 61 0.00% 42 61 0.00% 43 75 0.00% 44 70 0.00% 45 80 0.00% 46 136 0.00% 47 117 0.00% 48 141 0.00% 49 164 0.00% 50 216 0.00% 51 232 0.00% 52 261 0.00% 53 299 0.00% 54 317 0.00% 55 340 0.00% 56 423 0.00% 57 524 0.00% 58 537 0.00% 59 702 0.00% 60 729 0.00% 61 871 0.00% 62 1040 0.00% 63 1181 0.00% 64 1360 0.00% 65 1491 0.00% 66 1707 0.01% 67 1803 0.01% 68 2143 0.01% 69 2535 0.01% 70 2808 0.01% 71 3371 0.01% 72 3808 0.01% 73 4433 0.01% 74 4954 0.02% 75 5590 0.02% 76 6349 0.02% 77 7025 0.02% 78 7716 0.03% 79 9056 0.03% 80 9679 0.03% 81 10911 0.04% 82 12465 0.04% 83 13652 0.04% 84 15486 0.05% 85 17257 0.06% 86 18686 0.06% 87 20525 0.07% 88 22202 0.07% 89 23628 0.08% 90 25652 0.08% 91 28429 0.09% 92 29757 0.10% 93 32201 0.11% 94 34985 0.11% 95 37795 0.12% 96 39847 0.13% 97 42829 0.14% 98 45051 0.15% 99 46411 0.15% 100 48401 0.16% 101 50473 0.17% 102 53241 0.17% 103 55872 0.18% 104 57758 0.19% 105 61414 0.20% 106 63344 0.21% 107 65751 0.22% 108 68124 0.22% 109 69716 0.23% 110 71689 0.24% 111 74379 0.24% 112 76698 0.25% 113 77502 0.25% 114 80720 0.26% 115 83627 0.27% 116 85837 0.28% 117 88208 0.29% 118 91141 0.30% 119 92429 0.30% 120 93335 0.31% 121 96432 0.32% 122 96526 0.32% 123 98956 0.32% 124 100750 0.33% 125 101170 0.33% 126 103970 0.34% 127 106216 0.35% 128 108137 0.35% 129 108876 0.36% 130 110877 0.36% 131 110877 0.36% 132 112549 0.37% 133 114664 0.38% 134 114794 0.38% 135 115826 0.38% 136 118128 0.39% 137 119430 0.39% 138 120997 0.40% 139 123084 0.40% 140 123662 0.41% 141 124565 0.41% 142 125657 0.41% 143 125354 0.41% 144 127429 0.42% 145 127715 0.42% 146 128613 0.42% 147 129279 0.42% 148 132623 0.43% 149 131515 0.43% 150 134157 0.44% 151 24887419 81.62% 30492434 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=32 prefix-density=0.32 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=162.92 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=14.8 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTGT criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=34 prefix-density=0.33 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=58.18 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=1.9 sequence=GGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCGTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG SRR28623246 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 15:58:50 Started mapping on | Feb 13 15:58:51 Finished on | Feb 13 16:02:26 Mapping speed, Million of reads per hour | 510.57 Number of input reads | 30492434 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 28749975 Uniquely mapped reads % | 94.29% Average mapped length | 290.89 Number of splices: Total | 26799779 Number of splices: Annotated (sjdb) | 26226143 Number of splices: GT/AG | 26249261 Number of splices: GC/AG | 447330 Number of splices: AT/AC | 20408 Number of splices: Non-canonical | 82780 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.48 Insertion rate per base | 0.02% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 777807 % of reads mapped to multiple loci | 2.55% Number of reads mapped to too many loci | 154355 % of reads mapped to too many loci | 0.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.47% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 964652 964652 964652 N_multimapping 777807 777807 777807 N_noFeature 1086163 28239254 1267242 N_ambiguous 508700 2005 177696 UnstrandedReadsAssigned:27155112 PositiveStrandReadsAssigned:508716 NegativeStrandReadsAssigned:27305037 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623246 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623246-trimmed-pair1.fastq SRR28623246-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,492,434 reads, 27,551,079 reads pseudoaligned [quant] estimated average fragment length: 219.934 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,152 rounds 52401 SRR28623246.ke.tsv 34699 SRR28623246.se.tsv 87100 total ==> SRR28623246.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1799.07 5668 97.0682 Potri.005G024800.1.v4.1 1035 816.066 1126 42.5116 Potri.004G059700.1.v4.1 961 742.085 152 6.3108 Potri.007G009000.2.v4.1 1416 1197.07 0 0 Potri.003G141000.2.v4.1 2943 2724.07 1780 20.1324 Potri.016G087400.1.v4.1 270 96.035 1568.4 503.179 Potri.015G069301.1.v4.1 564 349.249 0 0 Potri.010G195200.1.v4.1 1773 1554.07 23 0.455987 Potri.012G127500.1.v4.1 977 758.085 42 1.70697 ==> SRR28623246.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 362 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 450 Potri.001G212900.v4.1 443 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 136 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 12 SRR28623246 completed mapping pipeline successfully