Starting /dee2/code/volunteer_pipeline.sh SRR28623247 current disk space = 3088793403392 free memory = 1439223432 SRR28623247 SRAfilesize e0fe47dea1e065d43d3cf92a481d79b7 SRR28623247.sra SRR28623247.sra file validated SRR28623247 is paired end SRR28623247 is conventional basespace SRR28623247 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623247_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9155 37.0 37.0 37.0 37.0 37.0 2 36.481 37.0 37.0 37.0 37.0 37.0 3 36.5105 37.0 37.0 37.0 37.0 37.0 4 36.563 37.0 37.0 37.0 37.0 37.0 5 36.6225 37.0 37.0 37.0 37.0 37.0 6 36.653 37.0 37.0 37.0 37.0 37.0 7 36.6245 37.0 37.0 37.0 37.0 37.0 8 36.673 37.0 37.0 37.0 37.0 37.0 9 36.587 37.0 37.0 37.0 37.0 37.0 10-14 36.6388 37.0 37.0 37.0 37.0 37.0 15-19 36.563100000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.5817 37.0 37.0 37.0 37.0 37.0 25-29 36.5168 37.0 37.0 37.0 37.0 37.0 30-34 36.445 37.0 37.0 37.0 37.0 37.0 35-39 36.388 37.0 37.0 37.0 37.0 37.0 40-44 36.326100000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.264199999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.2457 37.0 37.0 37.0 37.0 37.0 55-59 36.1862 37.0 37.0 37.0 37.0 37.0 60-64 36.14829999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.021300000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.0532 37.0 37.0 37.0 37.0 37.0 75-79 36.0482 37.0 37.0 37.0 37.0 37.0 80-84 36.003 37.0 37.0 37.0 37.0 37.0 85-89 35.8952 37.0 37.0 37.0 37.0 37.0 90-94 35.91680000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.8513 37.0 37.0 37.0 37.0 37.0 100-104 35.796299999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.7154 37.0 37.0 37.0 37.0 37.0 110-114 35.7097 37.0 37.0 37.0 37.0 37.0 115-119 35.632600000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.5602 37.0 37.0 37.0 37.0 37.0 125-129 35.396300000000004 37.0 37.0 37.0 34.6 37.0 130-134 35.2077 37.0 37.0 37.0 27.4 37.0 135-139 35.014300000000006 37.0 37.0 37.0 25.0 37.0 140-144 34.797000000000004 37.0 37.0 37.0 25.0 37.0 145-149 34.5884 37.0 37.0 37.0 25.0 37.0 150-151 33.713499999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 3.0 22 2.0 23 3.0 24 6.0 25 7.0 26 10.0 27 7.0 28 21.0 29 25.0 30 39.0 31 36.0 32 81.0 33 102.0 34 220.0 35 485.0 36 2825.0 37 128.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.07310966449675 14.797195793690534 10.215322984476716 42.914371557336004 2 18.099999999999998 14.625 37.85 29.425 3 17.2 19.85 28.875 34.075 4 21.725 26.5 23.625 28.15 5 22.6 34.55 23.799999999999997 19.05 6 20.7 37.05 22.45 19.8 7 14.374999999999998 31.3 38.975 15.35 8 17.075000000000003 29.075 32.375 21.475 9 18.25 25.0 34.025 22.725 10-14 18.19 32.18 27.105 22.525000000000002 15-19 18.535 30.935000000000002 27.43 23.1 20-24 18.915000000000003 30.945 27.3 22.84 25-29 19.045 30.665 27.634999999999998 22.655 30-34 19.07 30.73 27.169999999999998 23.03 35-39 19.475 30.825000000000003 27.005000000000003 22.695 40-44 19.535 30.514999999999997 27.189999999999998 22.759999999999998 45-49 19.439999999999998 30.580000000000002 26.99 22.99 50-54 19.53 30.485 27.284999999999997 22.7 55-59 19.405 30.505 26.724999999999998 23.365 60-64 19.335 30.209999999999997 26.91 23.544999999999998 65-69 18.605 30.505 27.625 23.265 70-74 20.015 29.98 26.715 23.29 75-79 19.965 29.895 27.18 22.96 80-84 19.975 29.904999999999998 26.939999999999998 23.18 85-89 20.294999999999998 29.56 26.69 23.455000000000002 90-94 20.32 30.335 26.625 22.720000000000002 95-99 20.43 29.67 26.55 23.35 100-104 20.65 30.335 26.14 22.875 105-109 20.830000000000002 29.599999999999998 25.995 23.575 110-114 21.005 30.11 25.115 23.77 115-119 20.5 29.64 25.685000000000002 24.175 120-124 21.33 29.56 25.21 23.9 125-129 20.645 29.360000000000003 25.135 24.86 130-134 21.165 28.78 25.72 24.335 135-139 20.755000000000003 28.01 25.995 25.240000000000002 140-144 21.595 27.205000000000002 26.185000000000002 25.014999999999997 145-149 21.165 27.229999999999997 26.355 25.25 150-151 21.725 26.137500000000003 27.1625 24.975 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.5 16 1.5 17 1.5 18 2.0 19 1.0 20 1.0 21 3.0 22 3.5 23 3.5 24 5.5 25 5.5 26 10.5 27 18.0 28 20.0 29 31.5 30 46.0 31 46.5 32 65.0 33 93.0 34 106.0 35 113.5 36 135.0 37 154.0 38 171.5 39 186.0 40 201.5 41 211.0 42 213.0 43 219.5 44 209.5 45 205.0 46 213.5 47 191.5 48 172.5 49 175.0 50 141.0 51 117.5 52 105.5 53 81.5 54 62.0 55 43.0 56 30.5 57 29.5 58 24.0 59 16.0 60 14.0 61 15.0 62 13.5 63 9.0 64 9.0 65 9.0 66 10.0 67 10.0 68 5.5 69 2.0 70 1.0 71 2.0 72 2.5 73 2.5 74 2.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.95 #Duplication Level Percentage of deduplicated Percentage of total 1 97.39556472408458 94.425 2 2.320783909231563 4.5 3 0.18050541516245489 0.525 4 0.0257864878803507 0.1 5 0.0 0.0 6 0.07735946364105209 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCATGTCTATCTCGTAT 6 0.15 TruSeq Adapter, Index 5 (97% over 36bp) GCCTTATGTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGA 6 0.15 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCATGTCTATCGCGTAT 6 0.15 TruSeq Adapter, Index 5 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.0875 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.2 0.0 0.0 0.0 0.0 62-63 0.2 0.0 0.0 0.0 0.0 64-65 0.21250000000000002 0.0 0.0 0.0 0.0 66-67 0.225 0.0 0.0 0.0 0.0 68-69 0.2875 0.0 0.0 0.0 0.0 70-71 0.4 0.0 0.0 0.0 0.0 72-73 0.55 0.0 0.0 0.0 0.0 74-75 0.675 0.0 0.0 0.0 0.0 76-77 0.8999999999999999 0.0 0.0 0.0 0.0 78-79 1.25 0.0 0.0 0.0 0.0 80-81 1.4875 0.0 0.0 0.0 0.0 82-83 1.7625000000000002 0.0 0.0 0.0 0.0 84-85 2.15 0.0 0.0 0.0 0.0 86-87 2.6500000000000004 0.0 0.0 0.0 0.0 88-89 3.125 0.0 0.0 0.0 0.0 90-91 3.7750000000000004 0.0 0.0 0.0 0.0 92-93 4.4375 0.0 0.0 0.0 0.0 94-95 5.2375 0.0 0.0 0.0 0.0 96-97 6.025 0.0 0.0 0.0 0.0 98-99 6.75 0.0 0.0 0.0 0.0 100-101 7.5 0.0 0.0 0.0 0.0 102-103 8.6 0.0 0.0 0.0 0.0 104-105 9.525 0.0 0.0 0.0 0.0 106-107 10.625 0.0 0.0 0.0 0.0 108-109 11.6875 0.0 0.0 0.0 0.0 110-111 12.675 0.0 0.0 0.0 0.0 112-113 13.774999999999999 0.0 0.0 0.0 0.0 114-115 14.825 0.0 0.0 0.0 0.0 116-117 15.825 0.0 0.0 0.0 0.0 118-119 17.025 0.0 0.0 0.0 0.0 120-121 18.1125 0.0 0.0 0.0 0.0 122-123 19.1125 0.0 0.0 0.0 0.0 124-125 20.25 0.0 0.0 0.0 0.0 126-127 21.2875 0.0 0.0 0.0 0.0 128-129 22.5 0.0 0.0 0.0 0.0 130-131 23.737499999999997 0.0 0.0 0.0 0.0 132-133 24.887500000000003 0.0 0.0 0.0 0.0 134-135 26.137500000000003 0.0 0.0 0.0 0.0 136-137 27.175 0.0 0.0 0.0 0.0 138-139 28.362499999999997 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCTGTT 10 0.006830828 145.0 2 AACATAA 10 0.006830828 145.0 7 ATGTCTA 60 0.004491891 14.500001 135-139 CTGAACT 95 0.007278115 10.684211 115-119 >>END_MODULE SRR28623247 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623247_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.18475 37.0 37.0 37.0 37.0 37.0 2 36.52 37.0 37.0 37.0 37.0 37.0 3 36.6045 37.0 37.0 37.0 37.0 37.0 4 36.548 37.0 37.0 37.0 37.0 37.0 5 36.5135 37.0 37.0 37.0 37.0 37.0 6 36.601 37.0 37.0 37.0 37.0 37.0 7 36.4465 37.0 37.0 37.0 37.0 37.0 8 36.408 37.0 37.0 37.0 37.0 37.0 9 36.456 37.0 37.0 37.0 37.0 37.0 10-14 36.467 37.0 37.0 37.0 37.0 37.0 15-19 36.4329 37.0 37.0 37.0 37.0 37.0 20-24 36.3844 37.0 37.0 37.0 37.0 37.0 25-29 36.301300000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.3375 37.0 37.0 37.0 37.0 37.0 35-39 36.2063 37.0 37.0 37.0 37.0 37.0 40-44 36.2238 37.0 37.0 37.0 37.0 37.0 45-49 36.175200000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.14040000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.08219999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.04109999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.059599999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.9498 37.0 37.0 37.0 37.0 37.0 75-79 35.9159 37.0 37.0 37.0 37.0 37.0 80-84 35.8643 37.0 37.0 37.0 37.0 37.0 85-89 35.7814 37.0 37.0 37.0 37.0 37.0 90-94 35.7846 37.0 37.0 37.0 37.0 37.0 95-99 35.738099999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.601 37.0 37.0 37.0 37.0 37.0 105-109 35.5499 37.0 37.0 37.0 37.0 37.0 110-114 35.4708 37.0 37.0 37.0 37.0 37.0 115-119 35.3241 37.0 37.0 37.0 32.2 37.0 120-124 35.2547 37.0 37.0 37.0 29.8 37.0 125-129 35.198800000000006 37.0 37.0 37.0 25.0 37.0 130-134 35.111000000000004 37.0 37.0 37.0 25.0 37.0 135-139 34.963699999999996 37.0 37.0 37.0 25.0 37.0 140-144 34.929899999999996 37.0 37.0 37.0 25.0 37.0 145-149 34.6428 37.0 37.0 37.0 25.0 37.0 150-151 34.105 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 2.0 15 2.0 16 2.0 17 1.0 18 1.0 19 2.0 20 1.0 21 2.0 22 9.0 23 6.0 24 4.0 25 13.0 26 9.0 27 15.0 28 14.0 29 26.0 30 23.0 31 42.0 32 65.0 33 101.0 34 209.0 35 631.0 36 2581.0 37 237.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.75918979744936 19.554888722180543 14.978744686171543 28.707176794198553 2 26.674999999999997 23.150000000000002 33.1 17.075000000000003 3 22.425 25.35 33.225 19.0 4 26.0 32.300000000000004 23.825 17.875 5 25.85 34.375 23.275000000000002 16.5 6 21.275 38.5 23.575 16.650000000000002 7 22.650000000000002 20.849999999999998 38.425 18.075 8 22.625 25.2 29.7 22.475 9 23.65 23.925 31.05 21.375 10-14 24.365000000000002 28.73 26.97 19.935 15-19 24.815 28.249999999999996 27.655 19.28 20-24 24.04 28.005000000000003 27.675 20.28 25-29 24.375 27.35 28.355000000000004 19.919999999999998 30-34 24.335 28.03 28.139999999999997 19.495 35-39 23.755000000000003 27.605 28.58 20.06 40-44 24.395 27.36 28.77 19.475 45-49 24.195 27.365000000000002 29.185 19.255 50-54 23.65 27.505000000000003 29.060000000000002 19.785 55-59 23.580000000000002 27.450000000000003 29.62 19.35 60-64 23.885 27.339999999999996 29.75 19.025 65-69 23.65 27.67 29.03 19.650000000000002 70-74 23.32 27.750000000000004 29.54 19.39 75-79 23.265 27.644999999999996 29.455 19.634999999999998 80-84 23.945 27.755000000000003 28.749999999999996 19.55 85-89 24.12 27.575 29.09 19.215 90-94 24.315 27.755000000000003 28.634999999999998 19.295 95-99 24.745 28.265 28.225 18.765 100-104 24.779999999999998 27.815 28.58 18.825 105-109 25.509999999999998 28.15 28.175 18.165 110-114 25.995 27.810000000000002 27.685 18.509999999999998 115-119 26.39 27.675 27.345000000000002 18.59 120-124 26.950000000000003 27.860000000000003 27.634999999999998 17.555 125-129 27.345000000000002 27.839999999999996 27.029999999999998 17.785 130-134 27.950000000000003 27.139999999999997 27.295 17.615 135-139 27.815 26.805 27.634999999999998 17.745 140-144 28.694999999999997 26.640000000000004 27.474999999999998 17.19 145-149 29.015 26.045 28.165000000000003 16.775000000000002 150-151 28.625 25.424999999999997 27.575 18.375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 1.5 6 1.5 7 1.0 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 2.0 19 2.0 20 1.5 21 0.5 22 1.0 23 2.0 24 2.5 25 4.5 26 7.0 27 11.5 28 14.5 29 21.0 30 26.0 31 33.5 32 58.0 33 72.0 34 79.5 35 97.0 36 112.0 37 130.0 38 149.5 39 187.5 40 219.5 41 219.5 42 221.0 43 220.0 44 212.0 45 230.0 46 247.0 47 223.0 48 180.0 49 163.5 50 154.0 51 134.5 52 115.0 53 86.0 54 71.0 55 56.0 56 39.0 57 25.5 58 19.5 59 19.5 60 18.5 61 18.0 62 14.5 63 12.5 64 8.0 65 3.5 66 3.0 67 3.5 68 3.0 69 2.5 70 4.0 71 3.5 72 3.0 73 3.5 74 2.0 75 1.0 76 1.0 77 1.0 78 0.5 79 0.0 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 1.0 89 1.0 90 1.0 91 1.0 92 0.5 93 0.5 94 0.5 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.775 #Duplication Level Percentage of deduplicated Percentage of total 1 97.2358563678636 94.1 2 2.402479979333506 4.65 3 0.25833118057349524 0.75 4 0.07749935417204858 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025833118057349523 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.0875 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.2 0.0 0.0 0.0 0.0 62-63 0.2 0.0 0.0 0.0 0.0 64-65 0.21250000000000002 0.0 0.0 0.0 0.0 66-67 0.225 0.0 0.0 0.0 0.0 68-69 0.2875 0.0 0.0 0.0 0.0 70-71 0.4 0.0 0.0 0.0 0.0 72-73 0.55 0.0 0.0 0.0 0.0 74-75 0.675 0.0 0.0 0.0 0.0 76-77 0.875 0.0 0.0 0.0 0.0 78-79 1.225 0.0 0.0 0.0 0.0 80-81 1.4625 0.0 0.0 0.0 0.0 82-83 1.7374999999999998 0.0 0.0 0.0 0.0 84-85 2.125 0.0 0.0 0.0 0.0 86-87 2.625 0.0 0.0 0.0 0.0 88-89 3.0875 0.0 0.0 0.0 0.0 90-91 3.7249999999999996 0.0 0.0 0.0 0.0 92-93 4.375 0.0 0.0 0.0 0.0 94-95 5.175000000000001 0.0 0.0 0.0 0.0 96-97 5.9875 0.0 0.0 0.0 0.0 98-99 6.75 0.0 0.0 0.0 0.0 100-101 7.574999999999999 0.0 0.0 0.0 0.0 102-103 8.7125 0.0 0.0 0.0 0.0 104-105 9.662500000000001 0.0 0.0 0.0 0.0 106-107 10.8 0.0 0.0 0.0 0.0 108-109 11.875 0.0 0.0 0.0 0.0 110-111 12.8875 0.0 0.0 0.0 0.0 112-113 14.0375 0.0 0.0 0.0 0.0 114-115 15.075 0.0 0.0 0.0 0.0 116-117 16.1125 0.0 0.0 0.0 0.0 118-119 17.3375 0.0 0.0 0.0 0.0 120-121 18.475 0.0 0.0 0.0 0.0 122-123 19.5375 0.0 0.0 0.0 0.0 124-125 20.7375 0.0 0.0 0.0 0.0 126-127 21.75 0.0 0.0 0.0 0.0 128-129 22.975 0.0 0.0 0.0 0.0 130-131 24.237499999999997 0.0 0.0 0.0 0.0 132-133 25.4125 0.0 0.0 0.0 0.0 134-135 26.7125 0.0 0.0 0.0 0.0 136-137 27.737499999999997 0.0 0.0 0.0 0.0 138-139 28.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGATCT 45 6.5511256E-4 19.333332 140-144 GTGTAGA 55 0.0025160722 15.818182 140-144 CTGTGTA 60 0.004491891 14.500001 135-139 CATGTCT 60 0.004491891 14.500001 130-134 GTGCATG 65 0.0076375785 13.384615 130-134 >>END_MODULE Read 582528 spots for SRR28623247.sra Written 582528 spots for SRR28623247.sra Read 582528 spots for SRR28623247.sra Written 582528 spots for SRR28623247.sra Read 582528 spots for SRR28623247.sra Written 582528 spots for SRR28623247.sra Read 582528 spots for SRR28623247.sra Written 582528 spots for SRR28623247.sra Read 582528 spots for SRR28623247.sra Written 582528 spots for SRR28623247.sra Read 582528 spots for SRR28623247.sra Written 582528 spots for SRR28623247.sra Read 582528 spots for SRR28623247.sra Written 582528 spots for SRR28623247.sra Read 582528 spots for SRR28623247.sra Written 582528 spots for SRR28623247.sra Read 582528 spots for SRR28623247.sra Written 582528 spots for SRR28623247.sra Read 582528 spots for SRR28623247.sra Written 582528 spots for SRR28623247.sra Read 582528 spots for SRR28623247.sra Written 582528 spots for SRR28623247.sra Read 582528 spots for SRR28623247.sra Written 582528 spots for SRR28623247.sra Read 582528 spots for SRR28623247.sra Written 582528 spots for SRR28623247.sra Read 582528 spots for SRR28623247.sra Written 582528 spots for SRR28623247.sra Read 582528 spots for SRR28623247.sra Written 582528 spots for SRR28623247.sra Read 582528 spots for SRR28623247.sra Written 582528 spots for SRR28623247.sra Read 582528 spots for SRR28623247.sra Written 582528 spots for SRR28623247.sra Read 582528 spots for SRR28623247.sra Written 582528 spots for SRR28623247.sra Read 582528 spots for SRR28623247.sra Written 582528 spots for SRR28623247.sra Read 582530 spots for SRR28623247.sra Written 582530 spots for SRR28623247.sra SRR ids: ['SRR28623247.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mvu4y61b SRR28623247.sra spots: 11650562 blocks: [[1, 582528], [582529, 1165056], [1165057, 1747584], [1747585, 2330112], [2330113, 2912640], [2912641, 3495168], [3495169, 4077696], [4077697, 4660224], [4660225, 5242752], [5242753, 5825280], [5825281, 6407808], [6407809, 6990336], [6990337, 7572864], [7572865, 8155392], [8155393, 8737920], [8737921, 9320448], [9320449, 9902976], [9902977, 10485504], [10485505, 11068032], [11068033, 11650562]] SRR28623247 file size 4295121 SRR28623247 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623247 SRR28623247_1.fastq SRR28623247_2.fastq Input file: SRR28623247_1.fastq Paired file: SRR28623247_2.fastq trimmed: SRR28623247-trimmed-pair1.fastq, SRR28623247-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 15:41:02 2025 >> started Thu Feb 13 15:41:16 2025 >> done (14.141s) 11650562 read pairs processed; of these: 20 ( 0.00%) short read pairs filtered out after trimming by size control 36494 ( 0.31%) empty read pairs filtered out after trimming by size control 11614048 (99.69%) read pairs available; of these: 4379993 (37.71%) trimmed read pairs available after processing 7234055 (62.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 0 0.00% 21 3 0.00% 22 1 0.00% 23 2 0.00% 24 1 0.00% 25 2 0.00% 26 6 0.00% 27 2 0.00% 28 7 0.00% 29 3 0.00% 30 7 0.00% 31 10 0.00% 32 10 0.00% 33 15 0.00% 34 23 0.00% 35 27 0.00% 36 28 0.00% 37 24 0.00% 38 51 0.00% 39 74 0.00% 40 73 0.00% 41 109 0.00% 42 120 0.00% 43 129 0.00% 44 150 0.00% 45 155 0.00% 46 212 0.00% 47 238 0.00% 48 272 0.00% 49 367 0.00% 50 417 0.00% 51 470 0.00% 52 503 0.00% 53 605 0.01% 54 718 0.01% 55 806 0.01% 56 882 0.01% 57 1000 0.01% 58 1283 0.01% 59 1437 0.01% 60 1795 0.02% 61 1957 0.02% 62 2402 0.02% 63 2543 0.02% 64 3078 0.03% 65 3206 0.03% 66 3689 0.03% 67 4143 0.04% 68 4607 0.04% 69 5180 0.04% 70 6104 0.05% 71 7026 0.06% 72 7881 0.07% 73 9064 0.08% 74 10255 0.09% 75 11466 0.10% 76 12394 0.11% 77 13707 0.12% 78 14904 0.13% 79 16441 0.14% 80 17827 0.15% 81 19911 0.17% 82 21842 0.19% 83 24028 0.21% 84 26166 0.23% 85 28721 0.25% 86 30506 0.26% 87 31994 0.28% 88 33571 0.29% 89 35560 0.31% 90 36636 0.32% 91 38852 0.33% 92 41032 0.35% 93 43561 0.38% 94 45971 0.40% 95 48360 0.42% 96 51197 0.44% 97 52288 0.45% 98 53669 0.46% 99 54551 0.47% 100 55226 0.48% 101 55898 0.48% 102 57977 0.50% 103 59115 0.51% 104 61187 0.53% 105 63671 0.55% 106 64708 0.56% 107 65801 0.57% 108 65389 0.56% 109 66452 0.57% 110 66253 0.57% 111 66359 0.57% 112 67018 0.58% 113 68112 0.59% 114 68897 0.59% 115 71547 0.62% 116 71127 0.61% 117 72664 0.63% 118 72492 0.62% 119 71946 0.62% 120 71553 0.62% 121 70919 0.61% 122 71161 0.61% 123 70905 0.61% 124 71242 0.61% 125 71580 0.62% 126 72768 0.63% 127 73345 0.63% 128 73064 0.63% 129 73292 0.63% 130 72183 0.62% 131 71152 0.61% 132 71473 0.62% 133 71125 0.61% 134 70158 0.60% 135 70682 0.61% 136 71235 0.61% 137 70416 0.61% 138 70736 0.61% 139 70986 0.61% 140 70025 0.60% 141 70691 0.61% 142 70477 0.61% 143 68713 0.59% 144 68136 0.59% 145 67528 0.58% 146 66476 0.57% 147 67442 0.58% 148 66954 0.58% 149 66655 0.57% 150 66752 0.57% 151 7234055 62.29% 11614048 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=35 prefix-density=0.15 prefix-fanout=1.9 sequence=CTCTAAGAGAGTTGACCACAGTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=13 fanout-score=208.23 fanout-score-rank=1 prefix-density=0.63 prefix-fanout=29.4 sequence=AAAAGAAAAGAAA criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=4.70 fanout-score-rank=20 prefix-density=0.20 prefix-fanout=3.4 sequence=GTTGTCAAGCCCCTCAAATGGGAGAAGCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=95.35 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=8.5 sequence=TGGAGATTGTCTCGTACGGTTAAGAGCCTCCGCCCGTCTCTGGGACTATGGACGGGCACGCTCATATCAGGCTATATTTGGTCCGGGTTATTATCGTCGCGGTTACCGTAATACTTCAGATCAGTTAAGTAGGGCCATATGCCTCGGGAATAAGCTGACGGTGACAAGGTTTCCCCCTAATCGAGACGCTGCAATAACACAGGGGCATACAGTAACCAGGCAAGAGTTCAATCGCTTAGTTTCGTGGCGGGATTTGAGGAAAACTGCGACTGTTCTTTAACCAAACATCCGTGCGATTCGTGCCACTCGTAGACGGCATCTCACAGTCACTGAAGGCTATTAAAGAGTTAGCACCCACCATTGGATGAAGCCCAGGATAAGTGACCCCCCCGGACCTTGGAGTTTCATGCTAATCAAAGAAGAGCTAATCCGACGTAAAGTTGCGGCGTTGATTACGCAGGATTGCGACCAAAGAA SRR28623247 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 15:42:02 Started mapping on | Feb 13 15:42:02 Finished on | Feb 13 15:44:18 Mapping speed, Million of reads per hour | 307.43 Number of input reads | 11614048 Average input read length | 276 UNIQUE READS: Uniquely mapped reads number | 9937243 Uniquely mapped reads % | 85.56% Average mapped length | 275.14 Number of splices: Total | 6131041 Number of splices: Annotated (sjdb) | 5966630 Number of splices: GT/AG | 6018509 Number of splices: GC/AG | 77982 Number of splices: AT/AC | 7060 Number of splices: Non-canonical | 27490 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.05% Deletion average length | 2.86 Insertion rate per base | 0.04% Insertion average length | 2.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 232876 % of reads mapped to multiple loci | 2.01% Number of reads mapped to too many loci | 413759 % of reads mapped to too many loci | 3.56% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.27% % of reads unmapped: other | 0.60% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1443929 1443929 1443929 N_multimapping 232876 232876 232876 N_noFeature 438801 9761713 519173 N_ambiguous 137417 1229 41377 UnstrandedReadsAssigned:9361025 PositiveStrandReadsAssigned:174301 NegativeStrandReadsAssigned:9376693 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=121 echo kmer=117 SRR28623247 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623247-trimmed-pair1.fastq SRR28623247-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,614,048 reads, 9,820,013 reads pseudoaligned [quant] estimated average fragment length: 176.074 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,071 rounds 52401 SRR28623247.ke.tsv 34699 SRR28623247.se.tsv 87100 total ==> SRR28623247.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1842.93 350 20.385 Potri.005G024800.1.v4.1 1035 859.926 93 11.6084 Potri.004G059700.1.v4.1 961 785.947 22 3.00455 Potri.007G009000.2.v4.1 1416 1240.93 0 0 Potri.003G141000.2.v4.1 2943 2767.93 157.176 6.0951 Potri.016G087400.1.v4.1 270 118.448 797.796 722.961 Potri.015G069301.1.v4.1 564 391.603 0 0 Potri.010G195200.1.v4.1 1773 1597.93 45 3.02278 Potri.012G127500.1.v4.1 977 801.931 2316 309.993 ==> SRR28623247.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1313 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 328 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR28623247 completed mapping pipeline successfully