Starting /dee2/code/volunteer_pipeline.sh SRR28623248 current disk space = 3088694681600 free memory = 1425295048 SRR28623248 SRAfilesize 7777102a514118a2e06caee01d82a312 SRR28623248.sra SRR28623248.sra file validated SRR28623248 is paired end SRR28623248 is conventional basespace SRR28623248 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623248_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.41975 37.0 37.0 37.0 37.0 37.0 2 36.4895 37.0 37.0 37.0 37.0 37.0 3 36.5485 37.0 37.0 37.0 37.0 37.0 4 36.6195 37.0 37.0 37.0 37.0 37.0 5 36.6315 37.0 37.0 37.0 37.0 37.0 6 36.681 37.0 37.0 37.0 37.0 37.0 7 36.547 37.0 37.0 37.0 37.0 37.0 8 36.4895 37.0 37.0 37.0 37.0 37.0 9 36.578 37.0 37.0 37.0 37.0 37.0 10-14 36.5874 37.0 37.0 37.0 37.0 37.0 15-19 36.52230000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.55309999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.485 37.0 37.0 37.0 37.0 37.0 30-34 36.4827 37.0 37.0 37.0 37.0 37.0 35-39 36.4333 37.0 37.0 37.0 37.0 37.0 40-44 36.3954 37.0 37.0 37.0 37.0 37.0 45-49 36.341100000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.2474 37.0 37.0 37.0 37.0 37.0 55-59 36.2555 37.0 37.0 37.0 37.0 37.0 60-64 36.2641 37.0 37.0 37.0 37.0 37.0 65-69 36.1858 37.0 37.0 37.0 37.0 37.0 70-74 36.14399999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.1189 37.0 37.0 37.0 37.0 37.0 80-84 36.0647 37.0 37.0 37.0 37.0 37.0 85-89 36.080799999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.007999999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.8898 37.0 37.0 37.0 37.0 37.0 100-104 35.9545 37.0 37.0 37.0 37.0 37.0 105-109 35.919799999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.839800000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.8609 37.0 37.0 37.0 37.0 37.0 120-124 35.759800000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.585499999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.7494 37.0 37.0 37.0 37.0 37.0 135-139 35.5934 37.0 37.0 37.0 37.0 37.0 140-144 35.4215 37.0 37.0 37.0 37.0 37.0 145-149 35.32449999999999 37.0 37.0 37.0 34.6 37.0 150-151 35.35675 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 1.0 22 3.0 23 4.0 24 6.0 25 5.0 26 10.0 27 9.0 28 18.0 29 27.0 30 27.0 31 47.0 32 44.0 33 79.0 34 151.0 35 332.0 36 2960.0 37 276.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.04061168212584 14.640260716971673 7.244923539734269 36.07420406116822 2 18.55 15.625 36.425000000000004 29.4 3 16.3 20.1 28.299999999999997 35.3 4 22.875 27.275 23.5 26.35 5 22.05 36.275 21.85 19.825 6 20.674999999999997 36.449999999999996 22.95 19.925 7 15.1 28.775000000000002 39.074999999999996 17.05 8 17.224999999999998 27.675 32.074999999999996 23.025000000000002 9 17.175 24.099999999999998 34.55 24.175 10-14 19.645000000000003 30.98 27.525 21.85 15-19 19.52 28.794999999999998 28.51 23.175 20-24 20.035 28.845 27.6 23.52 25-29 19.63 28.660000000000004 28.185 23.525 30-34 19.025 29.599999999999998 27.744999999999997 23.630000000000003 35-39 19.84 29.49 27.315 23.355 40-44 19.23 29.549999999999997 27.529999999999998 23.69 45-49 19.259999999999998 28.89 28.249999999999996 23.599999999999998 50-54 20.044999999999998 29.57 26.875 23.51 55-59 19.185 29.565 27.98 23.27 60-64 19.634999999999998 29.315 27.639999999999997 23.41 65-69 19.515 29.215000000000003 27.685 23.585 70-74 20.405 29.195 26.974999999999998 23.425 75-79 19.755 28.975 27.725 23.544999999999998 80-84 19.825 28.225 28.63 23.32 85-89 20.465 29.04 27.02 23.474999999999998 90-94 20.18 29.48 26.87 23.47 95-99 19.675 29.67 26.88 23.775 100-104 20.265 28.860000000000003 27.685 23.189999999999998 105-109 20.015 29.69 27.515 22.78 110-114 19.755 29.345 27.034999999999997 23.865 115-119 20.305 28.23 27.57 23.895 120-124 20.990000000000002 28.96 26.32 23.73 125-129 20.549999999999997 28.89 26.91 23.65 130-134 20.82 28.89 26.340000000000003 23.95 135-139 20.9 28.744999999999997 26.045 24.310000000000002 140-144 20.815 29.025000000000002 25.900000000000002 24.26 145-149 21.135 29.759999999999998 25.319999999999997 23.785 150-151 21.712500000000002 28.999999999999996 24.8125 24.474999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 2.5 24 6.0 25 6.5 26 4.5 27 8.0 28 13.5 29 18.0 30 29.5 31 33.5 32 38.5 33 55.5 34 77.0 35 92.0 36 98.0 37 119.5 38 159.0 39 182.5 40 195.5 41 204.5 42 223.5 43 256.0 44 277.0 45 264.5 46 234.0 47 233.0 48 236.0 49 197.0 50 147.0 51 119.0 52 103.5 53 85.0 54 61.0 55 54.0 56 46.0 57 33.5 58 23.5 59 18.5 60 14.0 61 6.0 62 3.0 63 3.0 64 2.5 65 1.5 66 1.0 67 1.5 68 1.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 86.49041255084254 74.425 2 11.301568855316676 19.45 3 1.7431725740848343 4.5 4 0.43579314352120857 1.5 5 0.029052876234747237 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCGATTAATACAATATTACAACCAATCTTCTTAGGATCCCTTTTTCACT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0375 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.0875 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.21250000000000002 0.0 0.0 0.0 0.0 70-71 0.2625 0.0 0.0 0.0 0.0 72-73 0.3375 0.0 0.0 0.0 0.0 74-75 0.375 0.0 0.0 0.0 0.0 76-77 0.475 0.0 0.0 0.0 0.0 78-79 0.6 0.0 0.0 0.0 0.0 80-81 0.625 0.0 0.0 0.0 0.0 82-83 0.7375 0.0 0.0 0.0 0.0 84-85 0.8125 0.0 0.0 0.0 0.0 86-87 1.0125 0.0 0.0 0.0 0.0 88-89 1.15 0.0 0.0 0.0 0.0 90-91 1.225 0.0 0.0 0.0 0.0 92-93 1.2875 0.0 0.0 0.0 0.0 94-95 1.3875000000000002 0.0 0.0 0.0 0.0 96-97 1.65 0.0 0.0 0.0 0.0 98-99 1.9875 0.0 0.0 0.0 0.0 100-101 2.4375 0.0 0.0 0.0 0.0 102-103 2.8125 0.0 0.0 0.0 0.0 104-105 3.1624999999999996 0.0 0.0 0.0 0.0 106-107 3.625 0.0 0.0 0.0 0.0 108-109 4.1375 0.0 0.0 0.0 0.0 110-111 4.5625 0.0 0.0 0.0 0.0 112-113 5.225 0.0 0.0 0.0 0.0 114-115 5.9375 0.0 0.0 0.0 0.0 116-117 6.6 0.0 0.0 0.0 0.0 118-119 7.1875 0.0 0.0 0.0 0.0 120-121 7.725 0.0 0.0 0.0 0.0 122-123 8.4125 0.0 0.0 0.0 0.0 124-125 9.0125 0.0 0.0 0.0 0.0 126-127 9.587499999999999 0.0 0.0 0.0 0.0 128-129 10.1375 0.0 0.0 0.0 0.0 130-131 11.1 0.0 0.0 0.0 0.0 132-133 11.899999999999999 0.0 0.0 0.0 0.0 134-135 12.7 0.0 0.0 0.0 0.0 136-137 13.5 0.0 0.0 0.0 0.0 138-139 14.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR28623248 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623248_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9105 37.0 37.0 37.0 37.0 37.0 2 36.2395 37.0 37.0 37.0 37.0 37.0 3 36.1495 37.0 37.0 37.0 37.0 37.0 4 36.1435 37.0 37.0 37.0 37.0 37.0 5 36.3995 37.0 37.0 37.0 37.0 37.0 6 36.2825 37.0 37.0 37.0 37.0 37.0 7 36.2195 37.0 37.0 37.0 37.0 37.0 8 36.2975 37.0 37.0 37.0 37.0 37.0 9 36.087 37.0 37.0 37.0 37.0 37.0 10-14 36.2606 37.0 37.0 37.0 37.0 37.0 15-19 36.1828 37.0 37.0 37.0 37.0 37.0 20-24 36.1715 37.0 37.0 37.0 37.0 37.0 25-29 36.1207 37.0 37.0 37.0 37.0 37.0 30-34 36.0734 37.0 37.0 37.0 37.0 37.0 35-39 36.0658 37.0 37.0 37.0 37.0 37.0 40-44 35.999900000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.011 37.0 37.0 37.0 37.0 37.0 50-54 35.9182 37.0 37.0 37.0 37.0 37.0 55-59 35.8181 37.0 37.0 37.0 37.0 37.0 60-64 35.7798 37.0 37.0 37.0 37.0 37.0 65-69 35.80329999999999 37.0 37.0 37.0 37.0 37.0 70-74 35.8195 37.0 37.0 37.0 37.0 37.0 75-79 35.8621 37.0 37.0 37.0 37.0 37.0 80-84 35.7061 37.0 37.0 37.0 37.0 37.0 85-89 35.7079 37.0 37.0 37.0 37.0 37.0 90-94 35.60119999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.585899999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.506899999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.4486 37.0 37.0 37.0 37.0 37.0 110-114 35.5623 37.0 37.0 37.0 37.0 37.0 115-119 35.45139999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.489 37.0 37.0 37.0 37.0 37.0 125-129 34.972 37.0 37.0 37.0 27.4 37.0 130-134 35.286 37.0 37.0 37.0 32.2 37.0 135-139 34.977000000000004 37.0 37.0 37.0 25.0 37.0 140-144 35.1943 37.0 37.0 37.0 27.4 37.0 145-149 34.9291 37.0 37.0 37.0 25.0 37.0 150-151 34.52875 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 1.0 15 3.0 16 5.0 17 3.0 18 2.0 19 4.0 20 5.0 21 4.0 22 4.0 23 4.0 24 9.0 25 13.0 26 7.0 27 14.0 28 19.0 29 22.0 30 29.0 31 36.0 32 72.0 33 120.0 34 224.0 35 682.0 36 2483.0 37 232.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.974999999999994 22.650000000000002 9.925 23.45 2 27.575 26.950000000000003 30.25 15.225 3 20.825 27.375 32.4 19.400000000000002 4 25.1 32.425 24.85 17.625 5 25.3 34.75 22.775000000000002 17.175 6 19.875 40.550000000000004 21.224999999999998 18.35 7 20.3 21.575 38.25 19.875 8 21.85 24.775 29.775000000000002 23.599999999999998 9 22.55 23.9 29.65 23.9 10-14 22.814999999999998 29.509999999999998 26.840000000000003 20.835 15-19 23.135 27.985 28.125 20.755000000000003 20-24 22.925 29.060000000000002 27.405 20.61 25-29 23.35 27.825 28.050000000000004 20.775 30-34 23.5 28.175 28.565 19.759999999999998 35-39 23.41 27.515 28.765 20.31 40-44 23.294999999999998 27.889999999999997 28.535 20.28 45-49 23.02 28.34 27.965 20.674999999999997 50-54 23.06 28.505000000000003 28.15 20.285 55-59 23.365 27.834999999999997 28.63 20.169999999999998 60-64 22.465 28.499999999999996 28.804999999999996 20.23 65-69 23.205000000000002 27.955000000000002 28.705000000000002 20.135 70-74 24.044999999999998 28.29 27.939999999999998 19.725 75-79 23.375 27.584999999999997 28.54 20.5 80-84 23.565 27.415 28.939999999999998 20.080000000000002 85-89 23.26 29.044999999999998 27.6 20.095 90-94 23.669999999999998 28.12 28.375 19.835 95-99 23.39 28.610000000000003 27.655 20.345 100-104 23.895 28.32 28.249999999999996 19.535 105-109 24.14 28.365000000000002 27.650000000000002 19.845 110-114 25.295 28.249999999999996 27.37 19.085 115-119 25.47 28.7 26.57 19.259999999999998 120-124 24.884999999999998 28.67 26.924999999999997 19.52 125-129 25.15 29.2 26.955000000000002 18.695 130-134 25.385 28.34 27.060000000000002 19.215 135-139 25.540000000000003 29.065 26.26 19.134999999999998 140-144 26.25 28.775000000000002 26.195 18.78 145-149 26.39 28.29 26.31 19.009999999999998 150-151 26.85 27.187499999999996 26.875 19.0875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 1.0 22 1.0 23 3.5 24 6.5 25 6.0 26 9.0 27 9.5 28 9.0 29 18.5 30 25.0 31 29.0 32 36.0 33 40.5 34 57.0 35 71.5 36 94.0 37 129.0 38 146.5 39 173.5 40 201.5 41 225.5 42 257.5 43 267.5 44 272.0 45 271.5 46 259.0 47 236.5 48 212.5 49 188.5 50 151.5 51 117.5 52 97.5 53 88.5 54 70.5 55 52.5 56 44.0 57 33.0 58 18.5 59 9.5 60 7.0 61 7.5 62 5.5 63 2.0 64 3.5 65 4.0 66 2.0 67 1.0 68 1.0 69 2.0 70 1.5 71 0.0 72 0.5 73 1.5 74 1.5 75 1.5 76 1.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.5 84 0.5 85 1.0 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 1.0 94 1.0 95 0.5 96 1.0 97 1.0 98 0.5 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.75 #Duplication Level Percentage of deduplicated Percentage of total 1 87.20461095100865 75.64999999999999 2 10.864553314121038 18.85 3 1.4697406340057637 3.8249999999999997 4 0.4034582132564841 1.4000000000000001 5 0.028818443804034585 0.125 6 0.028818443804034585 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit CAGACGATGGAGAGAGATGATTGGGTGGTGGAGGAGGAGGTGGACACAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0375 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.0875 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.21250000000000002 0.0 0.0 0.0 0.0 70-71 0.2625 0.0 0.0 0.0 0.0 72-73 0.3375 0.0 0.0 0.0 0.0 74-75 0.4 0.0 0.0 0.0 0.0 76-77 0.5 0.0 0.0 0.0 0.0 78-79 0.625 0.0 0.0 0.0 0.0 80-81 0.65 0.0 0.0 0.0 0.0 82-83 0.7625 0.0 0.0 0.0 0.0 84-85 0.8375 0.0 0.0 0.0 0.0 86-87 1.0375 0.0 0.0 0.0 0.0 88-89 1.1749999999999998 0.0 0.0 0.0 0.0 90-91 1.25 0.0 0.0 0.0 0.0 92-93 1.3125 0.0 0.0 0.0 0.0 94-95 1.4125 0.0 0.0 0.0 0.0 96-97 1.675 0.0 0.0 0.0 0.0 98-99 2.0125 0.0 0.0 0.0 0.0 100-101 2.4625000000000004 0.0 0.0 0.0 0.0 102-103 2.8625 0.0 0.0 0.0 0.0 104-105 3.2125000000000004 0.0 0.0 0.0 0.0 106-107 3.7 0.0 0.0 0.0 0.0 108-109 4.225 0.0 0.0 0.0 0.0 110-111 4.6625 0.0 0.0 0.0 0.0 112-113 5.3 0.0 0.0 0.0 0.0 114-115 5.9875 0.0 0.0 0.0 0.0 116-117 6.625 0.0 0.0 0.0 0.0 118-119 7.2125 0.0 0.0 0.0 0.0 120-121 7.75 0.0 0.0 0.0 0.0 122-123 8.45 0.0 0.0 0.0 0.0 124-125 9.0625 0.0 0.0 0.0 0.0 126-127 9.662500000000001 0.0 0.0 0.0 0.0 128-129 10.225000000000001 0.0 0.0 0.0 0.0 130-131 11.212499999999999 0.0 0.0 0.0 0.0 132-133 12.0 0.0 0.0 0.0 0.0 134-135 12.8125 0.0 0.0 0.0 0.0 136-137 13.625 0.0 0.0 0.0 0.0 138-139 14.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1658089 spots for SRR28623248.sra Written 1658089 spots for SRR28623248.sra Read 1658089 spots for SRR28623248.sra Written 1658089 spots for SRR28623248.sra Read 1658089 spots for SRR28623248.sra Written 1658089 spots for SRR28623248.sra Read 1658096 spots for SRR28623248.sra Written 1658096 spots for SRR28623248.sra Read 1658089 spots for SRR28623248.sra Written 1658089 spots for SRR28623248.sra Read 1658089 spots for SRR28623248.sra Written 1658089 spots for SRR28623248.sra Read 1658089 spots for SRR28623248.sra Written 1658089 spots for SRR28623248.sra Read 1658089 spots for SRR28623248.sra Written 1658089 spots for SRR28623248.sra Read 1658089 spots for SRR28623248.sra Written 1658089 spots for SRR28623248.sra Read 1658089 spots for SRR28623248.sra Written 1658089 spots for SRR28623248.sra Read 1658089 spots for SRR28623248.sra Written 1658089 spots for SRR28623248.sra Read 1658089 spots for SRR28623248.sra Written 1658089 spots for SRR28623248.sra Read 1658089 spots for SRR28623248.sra Written 1658089 spots for SRR28623248.sra Read 1658089 spots for SRR28623248.sra Written 1658089 spots for SRR28623248.sra Read 1658089 spots for SRR28623248.sra Written 1658089 spots for SRR28623248.sra Read 1658089 spots for SRR28623248.sra Written 1658089 spots for SRR28623248.sra Read 1658089 spots for SRR28623248.sra Written 1658089 spots for SRR28623248.sra Read 1658089 spots for SRR28623248.sra Written 1658089 spots for SRR28623248.sra Read 1658089 spots for SRR28623248.sra Written 1658089 spots for SRR28623248.sra Read 1658089 spots for SRR28623248.sra Written 1658089 spots for SRR28623248.sra SRR ids: ['SRR28623248.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hlj8_jug SRR28623248.sra spots: 33161787 blocks: [[1, 1658089], [1658090, 3316178], [3316179, 4974267], [4974268, 6632356], [6632357, 8290445], [8290446, 9948534], [9948535, 11606623], [11606624, 13264712], [13264713, 14922801], [14922802, 16580890], [16580891, 18238979], [18238980, 19897068], [19897069, 21555157], [21555158, 23213246], [23213247, 24871335], [24871336, 26529424], [26529425, 28187513], [28187514, 29845602], [29845603, 31503691], [31503692, 33161787]] SRR28623248 file size 12245552 SRR28623248 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623248 SRR28623248_1.fastq SRR28623248_2.fastq Input file: SRR28623248_1.fastq Paired file: SRR28623248_2.fastq trimmed: SRR28623248-trimmed-pair1.fastq, SRR28623248-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 15:58:07 2025 >> started Thu Feb 13 15:58:46 2025 >> done (38.229s) 33161787 read pairs processed; of these: 32 ( 0.00%) short read pairs filtered out after trimming by size control 13823 ( 0.04%) empty read pairs filtered out after trimming by size control 33147932 (99.96%) read pairs available; of these: 6040314 (18.22%) trimmed read pairs available after processing 27107618 (81.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 1 0.00% 20 2 0.00% 21 5 0.00% 22 7 0.00% 23 6 0.00% 24 9 0.00% 25 10 0.00% 26 8 0.00% 27 7 0.00% 28 14 0.00% 29 12 0.00% 30 17 0.00% 31 18 0.00% 32 25 0.00% 33 32 0.00% 34 30 0.00% 35 31 0.00% 36 41 0.00% 37 44 0.00% 38 64 0.00% 39 70 0.00% 40 60 0.00% 41 69 0.00% 42 103 0.00% 43 119 0.00% 44 105 0.00% 45 118 0.00% 46 139 0.00% 47 162 0.00% 48 211 0.00% 49 216 0.00% 50 248 0.00% 51 353 0.00% 52 342 0.00% 53 383 0.00% 54 426 0.00% 55 494 0.00% 56 573 0.00% 57 648 0.00% 58 729 0.00% 59 849 0.00% 60 1080 0.00% 61 1189 0.00% 62 1384 0.00% 63 1602 0.00% 64 1888 0.01% 65 2021 0.01% 66 2237 0.01% 67 2621 0.01% 68 2851 0.01% 69 3539 0.01% 70 3866 0.01% 71 4496 0.01% 72 5148 0.02% 73 6048 0.02% 74 6725 0.02% 75 7480 0.02% 76 8421 0.03% 77 9234 0.03% 78 10283 0.03% 79 11394 0.03% 80 12643 0.04% 81 14387 0.04% 82 15993 0.05% 83 17607 0.05% 84 19766 0.06% 85 21669 0.07% 86 23013 0.07% 87 24825 0.07% 88 26525 0.08% 89 28520 0.09% 90 30794 0.09% 91 32970 0.10% 92 34854 0.11% 93 37904 0.11% 94 40634 0.12% 95 43116 0.13% 96 46228 0.14% 97 48195 0.15% 98 49731 0.15% 99 52240 0.16% 100 54202 0.16% 101 55456 0.17% 102 58830 0.18% 103 61792 0.19% 104 64649 0.20% 105 68178 0.21% 106 70496 0.21% 107 72379 0.22% 108 74677 0.23% 109 75758 0.23% 110 76561 0.23% 111 79078 0.24% 112 81413 0.25% 113 83035 0.25% 114 86549 0.26% 115 89936 0.27% 116 91883 0.28% 117 95361 0.29% 118 96935 0.29% 119 97369 0.29% 120 99197 0.30% 121 101157 0.31% 122 102028 0.31% 123 103660 0.31% 124 106875 0.32% 125 107968 0.33% 126 111731 0.34% 127 113689 0.34% 128 114123 0.34% 129 115545 0.35% 130 117111 0.35% 131 117803 0.36% 132 118545 0.36% 133 121948 0.37% 134 121098 0.37% 135 123604 0.37% 136 124586 0.38% 137 125887 0.38% 138 128431 0.39% 139 130018 0.39% 140 129708 0.39% 141 130169 0.39% 142 131855 0.40% 143 132171 0.40% 144 133974 0.40% 145 134831 0.41% 146 133845 0.40% 147 135883 0.41% 148 138599 0.42% 149 137888 0.42% 150 139924 0.42% 151 27107618 81.78% 33147932 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.37 fanout-score-rank=36 prefix-density=0.13 prefix-fanout=2.4 sequence=GTGGACTCCTTCTGGAT criterion=fanout-score sequence-density=0.06 sequence-density-rank=19 fanout-score=306.82 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=20.3 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=14.46 fanout-score-rank=10 prefix-density=0.14 prefix-fanout=14.5 sequence=GAGAGAGAGAGTTAAGACAATGGCCTCGAAGAAATCTGCAATCGTATTACCTGGTTCAAAGGTGTTGAAGCACATAGTTTTTGTACGGTTTAATGATGGGATCACTGATGAACAAATTGAGAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=16 fanout-score=341.15 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=26.1 sequence=AAGAAGAAGAAA SRR28623248 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 15:59:26 Started mapping on | Feb 13 15:59:26 Finished on | Feb 13 16:03:06 Mapping speed, Million of reads per hour | 542.42 Number of input reads | 33147932 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 30836122 Uniquely mapped reads % | 93.03% Average mapped length | 290.47 Number of splices: Total | 27475765 Number of splices: Annotated (sjdb) | 26839897 Number of splices: GT/AG | 27008891 Number of splices: GC/AG | 358243 Number of splices: AT/AC | 26576 Number of splices: Non-canonical | 82055 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.97 Insertion rate per base | 0.03% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 796371 % of reads mapped to multiple loci | 2.40% Number of reads mapped to too many loci | 169718 % of reads mapped to too many loci | 0.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.86% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1515439 1515439 1515439 N_multimapping 796371 796371 796371 N_noFeature 1310523 30432526 1507251 N_ambiguous 383110 2515 174462 UnstrandedReadsAssigned:29142489 PositiveStrandReadsAssigned:401081 NegativeStrandReadsAssigned:29154409 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623248 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623248-trimmed-pair1.fastq SRR28623248-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,147,932 reads, 29,501,667 reads pseudoaligned [quant] estimated average fragment length: 219.78 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,122 rounds 52401 SRR28623248.ke.tsv 34699 SRR28623248.se.tsv 87100 total ==> SRR28623248.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1799.22 1466 27.0256 Potri.005G024800.1.v4.1 1035 816.22 714 29.0146 Potri.004G059700.1.v4.1 961 742.254 113 5.04953 Potri.007G009000.2.v4.1 1416 1197.22 0 0 Potri.003G141000.2.v4.1 2943 2724.22 944.585 11.5007 Potri.016G087400.1.v4.1 270 96.6232 2350.3 806.804 Potri.015G069301.1.v4.1 564 349.597 0 0 Potri.010G195200.1.v4.1 1773 1554.22 72 1.53655 Potri.012G127500.1.v4.1 977 758.24 10504 459.488 ==> SRR28623248.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1459 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 644 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 6 SRR28623248 completed mapping pipeline successfully