Starting /dee2/code/volunteer_pipeline.sh SRR28623249 current disk space = 3052642779136 free memory = 1179146396 SRR28623249 SRAfilesize 76b264cc8bbb3d2a8e9d1ab2b31983a2 SRR28623249.sra SRR28623249.sra file validated SRR28623249 is paired end SRR28623249 is conventional basespace SRR28623249 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623249_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.471 37.0 37.0 37.0 37.0 37.0 2 36.5175 37.0 37.0 37.0 37.0 37.0 3 36.586 37.0 37.0 37.0 37.0 37.0 4 36.688 37.0 37.0 37.0 37.0 37.0 5 36.621 37.0 37.0 37.0 37.0 37.0 6 36.689 37.0 37.0 37.0 37.0 37.0 7 36.5815 37.0 37.0 37.0 37.0 37.0 8 36.459 37.0 37.0 37.0 37.0 37.0 9 36.6045 37.0 37.0 37.0 37.0 37.0 10-14 36.64450000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.6053 37.0 37.0 37.0 37.0 37.0 20-24 36.573899999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.4962 37.0 37.0 37.0 37.0 37.0 30-34 36.4819 37.0 37.0 37.0 37.0 37.0 35-39 36.3872 37.0 37.0 37.0 37.0 37.0 40-44 36.4063 37.0 37.0 37.0 37.0 37.0 45-49 36.368 37.0 37.0 37.0 37.0 37.0 50-54 36.3096 37.0 37.0 37.0 37.0 37.0 55-59 36.3314 37.0 37.0 37.0 37.0 37.0 60-64 36.260999999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.2389 37.0 37.0 37.0 37.0 37.0 70-74 36.1842 37.0 37.0 37.0 37.0 37.0 75-79 36.1716 37.0 37.0 37.0 37.0 37.0 80-84 36.1294 37.0 37.0 37.0 37.0 37.0 85-89 36.118100000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.9893 37.0 37.0 37.0 37.0 37.0 95-99 35.8845 37.0 37.0 37.0 37.0 37.0 100-104 36.018299999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.9245 37.0 37.0 37.0 37.0 37.0 110-114 35.830000000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.8898 37.0 37.0 37.0 37.0 37.0 120-124 35.670399999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.617200000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.744099999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.554700000000004 37.0 37.0 37.0 34.6 37.0 140-144 35.248599999999996 37.0 37.0 37.0 29.8 37.0 145-149 35.1134 37.0 37.0 37.0 29.8 37.0 150-151 34.93 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 1.0 21 0.0 22 1.0 23 5.0 24 5.0 25 7.0 26 8.0 27 9.0 28 16.0 29 22.0 30 28.0 31 24.0 32 54.0 33 101.0 34 168.0 35 376.0 36 2928.0 37 246.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.169593577521326 14.57601605619669 8.956347215253386 42.2980431510286 2 17.974999999999998 16.325 36.15 29.549999999999997 3 18.075 18.575 27.975 35.375 4 22.400000000000002 24.474999999999998 23.5 29.625 5 23.724999999999998 30.275000000000002 25.025 20.974999999999998 6 23.1 33.975 23.05 19.875 7 15.45 29.975 39.275 15.299999999999999 8 17.75 27.675 32.324999999999996 22.25 9 18.025 25.025 33.625 23.325000000000003 10-14 19.515 30.995 27.339999999999996 22.15 15-19 19.545 28.605000000000004 28.155 23.695 20-24 19.79 28.849999999999998 27.560000000000002 23.799999999999997 25-29 19.765 30.064999999999998 26.634999999999998 23.535 30-34 19.835 29.445 27.245 23.474999999999998 35-39 20.095 29.049999999999997 27.11 23.745 40-44 19.715 29.685 27.150000000000002 23.45 45-49 19.905 29.459999999999997 27.37 23.265 50-54 20.525 29.360000000000003 26.634999999999998 23.48 55-59 19.59 28.884999999999998 27.63 23.895 60-64 20.535 29.110000000000003 26.32 24.035 65-69 19.785 29.18 26.955000000000002 24.08 70-74 19.67 29.599999999999998 27.310000000000002 23.419999999999998 75-79 20.31 28.435 27.884999999999998 23.369999999999997 80-84 19.93 29.34 26.75 23.98 85-89 20.919999999999998 29.025000000000002 26.700000000000003 23.355 90-94 20.794999999999998 28.78 26.52 23.905 95-99 20.24 29.395 26.915 23.45 100-104 20.93 29.134999999999998 26.029999999999998 23.905 105-109 20.44 29.585 26.145000000000003 23.830000000000002 110-114 20.775 29.225 25.995 24.005000000000003 115-119 21.15 29.075 25.6 24.175 120-124 20.830000000000002 29.220000000000002 25.525 24.425 125-129 21.195 28.38 26.105 24.32 130-134 21.310000000000002 29.270000000000003 25.585 23.835 135-139 21.295 28.52 25.955000000000002 24.23 140-144 21.435000000000002 28.12 26.06 24.385 145-149 21.834999999999997 27.905 25.424999999999997 24.834999999999997 150-151 22.625 27.1625 26.150000000000002 24.0625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 0.5 20 0.5 21 0.5 22 1.0 23 1.0 24 2.0 25 4.5 26 7.5 27 9.5 28 8.5 29 13.0 30 29.0 31 47.0 32 53.0 33 50.5 34 64.0 35 83.5 36 99.5 37 130.0 38 156.5 39 174.5 40 196.5 41 217.0 42 207.5 43 225.0 44 234.0 45 222.0 46 234.5 47 231.5 48 217.5 49 193.0 50 157.0 51 122.0 52 115.0 53 105.5 54 95.0 55 72.5 56 49.5 57 35.5 58 23.5 59 25.5 60 23.0 61 15.5 62 10.5 63 8.0 64 4.0 65 4.0 66 3.5 67 3.5 68 4.0 69 3.0 70 1.0 71 0.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.82499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 85.2932508104922 72.35000000000001 2 12.231063955201886 20.75 3 1.9157088122605364 4.875 4 0.4420866489832007 1.5 5 0.08841732979664013 0.375 6 0.02947244326554671 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGAGAAACAAGGCGGTTAAGATTGGTGTAAGTGGGACGCTCAATGTCAA 6 0.15 No Hit CTACAAGGTACTAATGGTTTTGAACTGAGCGTCCACATGCATCCACCAAC 5 0.125 No Hit GTCCTTACAAGTCCGCTCCTCGGGGAGCTTGATTGATAATTCTGTATAAG 5 0.125 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTAGGTTATCTCGTAT 5 0.125 TruSeq Adapter, Index 22 (97% over 41bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.037500000000000006 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.25 0.0 0.0 0.0 0.0 72-73 0.3125 0.0 0.0 0.0 0.0 74-75 0.375 0.0 0.0 0.0 0.0 76-77 0.4375 0.0 0.0 0.0 0.0 78-79 0.6 0.0 0.0 0.0 0.0 80-81 0.7 0.0 0.0 0.0 0.0 82-83 0.825 0.0 0.0 0.0 0.0 84-85 1.1 0.0 0.0 0.0 0.0 86-87 1.55 0.0 0.0 0.0 0.0 88-89 1.7999999999999998 0.0 0.0 0.0 0.0 90-91 2.1125 0.0 0.0 0.0 0.0 92-93 2.5125 0.0 0.0 0.0 0.0 94-95 3.1125 0.0 0.0 0.0 0.0 96-97 3.4625 0.0 0.0 0.0 0.0 98-99 3.8625 0.0 0.0 0.0 0.0 100-101 4.2875 0.0 0.0 0.0 0.0 102-103 4.775 0.0 0.0 0.0 0.0 104-105 5.2375 0.0 0.0 0.0 0.0 106-107 5.8125 0.0 0.0 0.0 0.0 108-109 6.5375 0.0 0.0 0.0 0.0 110-111 7.1375 0.0 0.0 0.0 0.0 112-113 7.875 0.0 0.0 0.0 0.0 114-115 8.45 0.0 0.0 0.0 0.0 116-117 9.3 0.0 0.0 0.0 0.0 118-119 10.05 0.0 0.0 0.0 0.0 120-121 11.0 0.0 0.0 0.0 0.0 122-123 11.6625 0.0 0.0 0.0 0.0 124-125 12.375 0.0 0.0 0.0 0.0 126-127 13.225000000000001 0.0 0.0 0.0 0.0 128-129 14.05 0.0 0.0 0.0 0.0 130-131 15.05 0.0 0.0 0.0 0.0 132-133 16.025 0.0 0.0 0.0 0.0 134-135 16.9 0.0 0.0 0.0 0.0 136-137 17.775 0.0 0.0 0.0 0.0 138-139 18.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR28623249 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623249_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.768 37.0 37.0 37.0 37.0 37.0 2 36.409 37.0 37.0 37.0 37.0 37.0 3 36.2955 37.0 37.0 37.0 37.0 37.0 4 36.294 37.0 37.0 37.0 37.0 37.0 5 36.4615 37.0 37.0 37.0 37.0 37.0 6 36.238 37.0 37.0 37.0 37.0 37.0 7 36.34 37.0 37.0 37.0 37.0 37.0 8 36.4385 37.0 37.0 37.0 37.0 37.0 9 36.26 37.0 37.0 37.0 37.0 37.0 10-14 36.290200000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.246399999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.301 37.0 37.0 37.0 37.0 37.0 25-29 36.1991 37.0 37.0 37.0 37.0 37.0 30-34 36.1612 37.0 37.0 37.0 37.0 37.0 35-39 36.1608 37.0 37.0 37.0 37.0 37.0 40-44 36.095800000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.0731 37.0 37.0 37.0 37.0 37.0 50-54 36.0314 37.0 37.0 37.0 37.0 37.0 55-59 35.9105 37.0 37.0 37.0 37.0 37.0 60-64 35.8927 37.0 37.0 37.0 37.0 37.0 65-69 35.9331 37.0 37.0 37.0 37.0 37.0 70-74 35.9597 37.0 37.0 37.0 37.0 37.0 75-79 35.9553 37.0 37.0 37.0 37.0 37.0 80-84 35.880700000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.777100000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.770900000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.7876 37.0 37.0 37.0 37.0 37.0 100-104 35.6726 37.0 37.0 37.0 37.0 37.0 105-109 35.56779999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.7228 37.0 37.0 37.0 37.0 37.0 115-119 35.613099999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.6117 37.0 37.0 37.0 37.0 37.0 125-129 35.088499999999996 37.0 37.0 37.0 32.2 37.0 130-134 35.4452 37.0 37.0 37.0 37.0 37.0 135-139 35.187400000000004 37.0 37.0 37.0 29.8 37.0 140-144 35.2274 37.0 37.0 37.0 29.8 37.0 145-149 35.1491 37.0 37.0 37.0 27.4 37.0 150-151 34.746750000000006 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 5.0 16 2.0 17 4.0 18 0.0 19 3.0 20 1.0 21 7.0 22 7.0 23 5.0 24 4.0 25 9.0 26 10.0 27 13.0 28 18.0 29 18.0 30 25.0 31 30.0 32 46.0 33 118.0 34 205.0 35 644.0 36 2578.0 37 248.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.0 21.45 13.8 26.75 2 28.275 26.0 29.7 16.025 3 21.875 27.025 31.924999999999997 19.175 4 24.55 32.1 24.275 19.075 5 27.500000000000004 35.275 21.175 16.05 6 20.8 39.375 22.1 17.724999999999998 7 22.0 22.075 37.675 18.25 8 22.1 25.6 28.95 23.35 9 21.675 24.65 30.875000000000004 22.8 10-14 24.325 28.83 26.424999999999997 20.419999999999998 15-19 24.07 27.99 27.43 20.51 20-24 23.74 28.565 27.52 20.175 25-29 24.065 27.805000000000003 28.055000000000003 20.075000000000003 30-34 24.474999999999998 28.055000000000003 27.685 19.785 35-39 24.165 27.785 27.855 20.195 40-44 24.59 27.465 27.525 20.419999999999998 45-49 23.215 26.945000000000004 28.395 21.445 50-54 23.549999999999997 27.095000000000002 29.075 20.28 55-59 23.705000000000002 27.54 28.78 19.975 60-64 23.23 28.410000000000004 28.139999999999997 20.22 65-69 23.82 27.185 28.77 20.225 70-74 23.48 27.35 28.605000000000004 20.565 75-79 23.455000000000002 27.775 28.415000000000003 20.355 80-84 23.735 27.27 28.715000000000003 20.28 85-89 23.635 27.315 28.68 20.369999999999997 90-94 23.995 27.800000000000004 28.08 20.125 95-99 24.425 27.325 28.52 19.73 100-104 24.285 27.605 28.005000000000003 20.105 105-109 24.755 27.935 27.525 19.785 110-114 25.525 27.36 27.705000000000002 19.41 115-119 25.765 27.650000000000002 26.96 19.625 120-124 25.86 27.43 27.250000000000004 19.46 125-129 26.119999999999997 27.555000000000003 27.36 18.965 130-134 26.87 27.615000000000002 27.155 18.360000000000003 135-139 26.979999999999997 27.54 27.02 18.459999999999997 140-144 27.115000000000002 27.955000000000002 26.755000000000003 18.175 145-149 27.705000000000002 26.69 26.96 18.645 150-151 27.5125 27.35 26.987499999999997 18.15 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 1.0 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 1.0 18 2.0 19 1.5 20 0.5 21 0.5 22 2.0 23 2.0 24 1.0 25 2.0 26 7.5 27 11.5 28 13.0 29 16.5 30 16.0 31 23.0 32 31.0 33 36.0 34 51.0 35 69.0 36 91.5 37 103.0 38 135.5 39 176.5 40 207.0 41 222.5 42 237.5 43 255.0 44 242.0 45 254.0 46 254.5 47 240.0 48 225.0 49 190.5 50 176.5 51 152.5 52 109.5 53 90.0 54 88.5 55 67.5 56 39.5 57 24.0 58 17.0 59 19.0 60 16.0 61 12.5 62 12.0 63 9.0 64 6.0 65 6.0 66 6.0 67 3.0 68 2.0 69 2.5 70 1.5 71 1.0 72 0.5 73 1.5 74 2.0 75 1.5 76 0.5 77 0.5 78 1.0 79 0.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.3 #Duplication Level Percentage of deduplicated Percentage of total 1 85.72684642438453 73.125 2 11.928487690504102 20.349999999999998 3 1.846424384525205 4.725 4 0.4396248534583822 1.5 5 0.0 0.0 6 0.058616647127784284 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATAATTTATGTCCAATATTTGAAGACCAAGAGATTATCATCAATTCTTT 6 0.15 No Hit CAAAAAATCAAAGCTTGGTTTCACTGTATATCCATCCCCGCAAGTTTCCA 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.037500000000000006 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.2875 0.0 0.0 0.0 0.0 74-75 0.35 0.0 0.0 0.0 0.0 76-77 0.4125 0.0 0.0 0.0 0.0 78-79 0.575 0.0 0.0 0.0 0.0 80-81 0.675 0.0 0.0 0.0 0.0 82-83 0.8 0.0 0.0 0.0 0.0 84-85 1.075 0.0 0.0 0.0 0.0 86-87 1.525 0.0 0.0 0.0 0.0 88-89 1.8 0.0 0.0 0.0 0.0 90-91 2.1375 0.0 0.0 0.0 0.0 92-93 2.5375 0.0 0.0 0.0 0.0 94-95 3.175 0.0 0.0 0.0 0.0 96-97 3.5125 0.0 0.0 0.0 0.0 98-99 3.9375 0.0 0.0 0.0 0.0 100-101 4.387499999999999 0.0 0.0 0.0 0.0 102-103 4.875 0.0 0.0 0.0 0.0 104-105 5.3375 0.0 0.0 0.0 0.0 106-107 5.925000000000001 0.0 0.0 0.0 0.0 108-109 6.675 0.0 0.0 0.0 0.0 110-111 7.275 0.0 0.0 0.0 0.0 112-113 8.0375 0.0 0.0 0.0 0.0 114-115 8.625 0.0 0.0 0.0 0.0 116-117 9.475 0.0 0.0 0.0 0.0 118-119 10.225 0.0 0.0 0.0 0.0 120-121 11.175 0.0 0.0 0.0 0.0 122-123 11.8125 0.0 0.0 0.0 0.0 124-125 12.587499999999999 0.0 0.0 0.0 0.0 126-127 13.425 0.0 0.0 0.0 0.0 128-129 14.225 0.0 0.0 0.0 0.0 130-131 15.225 0.0 0.0 0.0 0.0 132-133 16.225 0.0 0.0 0.0 0.0 134-135 17.1 0.0 0.0 0.0 0.0 136-137 17.95 0.0 0.0 0.0 0.0 138-139 18.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATAGCTC 10 0.006830828 145.0 5 CAAACCC 10 0.006830828 145.0 9 >>END_MODULE Read 1631813 spots for SRR28623249.sra Written 1631813 spots for SRR28623249.sra Read 1631813 spots for SRR28623249.sra Written 1631813 spots for SRR28623249.sra Read 1631813 spots for SRR28623249.sra Written 1631813 spots for SRR28623249.sra Read 1631813 spots for SRR28623249.sra Written 1631813 spots for SRR28623249.sra Read 1631813 spots for SRR28623249.sra Written 1631813 spots for SRR28623249.sra Read 1631813 spots for SRR28623249.sra Written 1631813 spots for SRR28623249.sra Read 1631813 spots for SRR28623249.sra Written 1631813 spots for SRR28623249.sra Read 1631813 spots for SRR28623249.sra Written 1631813 spots for SRR28623249.sra Read 1631824 spots for SRR28623249.sra Written 1631824 spots for SRR28623249.sra Read 1631813 spots for SRR28623249.sra Written 1631813 spots for SRR28623249.sra Read 1631813 spots for SRR28623249.sra Written 1631813 spots for SRR28623249.sra Read 1631813 spots for SRR28623249.sra Written 1631813 spots for SRR28623249.sra Read 1631813 spots for SRR28623249.sra Written 1631813 spots for SRR28623249.sra Read 1631813 spots for SRR28623249.sra Written 1631813 spots for SRR28623249.sra Read 1631813 spots for SRR28623249.sra Written 1631813 spots for SRR28623249.sra Read 1631813 spots for SRR28623249.sra Written 1631813 spots for SRR28623249.sra Read 1631813 spots for SRR28623249.sra Written 1631813 spots for SRR28623249.sra Read 1631813 spots for SRR28623249.sra Written 1631813 spots for SRR28623249.sra Read 1631813 spots for SRR28623249.sra Written 1631813 spots for SRR28623249.sra Read 1631813 spots for SRR28623249.sra Written 1631813 spots for SRR28623249.sra SRR ids: ['SRR28623249.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_iuoif_lh SRR28623249.sra spots: 32636271 blocks: [[1, 1631813], [1631814, 3263626], [3263627, 4895439], [4895440, 6527252], [6527253, 8159065], [8159066, 9790878], [9790879, 11422691], [11422692, 13054504], [13054505, 14686317], [14686318, 16318130], [16318131, 17949943], [17949944, 19581756], [19581757, 21213569], [21213570, 22845382], [22845383, 24477195], [24477196, 26109008], [26109009, 27740821], [27740822, 29372634], [29372635, 31004447], [31004448, 32636271]] SRR28623249 file size 12051344 SRR28623249 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623249 SRR28623249_1.fastq SRR28623249_2.fastq Input file: SRR28623249_1.fastq Paired file: SRR28623249_2.fastq trimmed: SRR28623249-trimmed-pair1.fastq, SRR28623249-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 11:03:35 2025 >> started Tue Feb 11 11:04:13 2025 >> done (38.476s) 32636271 read pairs processed; of these: 38 ( 0.00%) short read pairs filtered out after trimming by size control 51205 ( 0.16%) empty read pairs filtered out after trimming by size control 32585028 (99.84%) read pairs available; of these: 7748336 (23.78%) trimmed read pairs available after processing 24836692 (76.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 6 0.00% 21 6 0.00% 22 5 0.00% 23 7 0.00% 24 7 0.00% 25 9 0.00% 26 14 0.00% 27 18 0.00% 28 9 0.00% 29 11 0.00% 30 20 0.00% 31 33 0.00% 32 35 0.00% 33 29 0.00% 34 32 0.00% 35 25 0.00% 36 45 0.00% 37 53 0.00% 38 55 0.00% 39 71 0.00% 40 81 0.00% 41 106 0.00% 42 140 0.00% 43 159 0.00% 44 157 0.00% 45 158 0.00% 46 182 0.00% 47 262 0.00% 48 297 0.00% 49 359 0.00% 50 391 0.00% 51 466 0.00% 52 523 0.00% 53 581 0.00% 54 714 0.00% 55 733 0.00% 56 885 0.00% 57 1031 0.00% 58 1202 0.00% 59 1442 0.00% 60 1583 0.00% 61 1909 0.01% 62 2217 0.01% 63 2563 0.01% 64 3039 0.01% 65 3375 0.01% 66 3662 0.01% 67 4203 0.01% 68 4586 0.01% 69 5336 0.02% 70 6337 0.02% 71 7180 0.02% 72 8487 0.03% 73 9790 0.03% 74 10867 0.03% 75 12383 0.04% 76 13679 0.04% 77 14924 0.05% 78 16508 0.05% 79 18395 0.06% 80 20243 0.06% 81 22619 0.07% 82 25499 0.08% 83 28326 0.09% 84 31269 0.10% 85 34650 0.11% 86 37159 0.11% 87 39939 0.12% 88 41952 0.13% 89 44744 0.14% 90 47682 0.15% 91 50492 0.15% 92 53967 0.17% 93 58048 0.18% 94 61683 0.19% 95 66597 0.20% 96 70367 0.22% 97 73968 0.23% 98 75679 0.23% 99 79039 0.24% 100 81309 0.25% 101 82570 0.25% 102 86257 0.26% 103 89846 0.28% 104 93983 0.29% 105 97021 0.30% 106 101617 0.31% 107 103964 0.32% 108 106413 0.33% 109 107575 0.33% 110 109292 0.34% 111 109368 0.34% 112 112233 0.34% 113 115166 0.35% 114 117299 0.36% 115 122513 0.38% 116 123821 0.38% 117 125473 0.39% 118 127906 0.39% 119 128857 0.40% 120 129907 0.40% 121 131009 0.40% 122 131660 0.40% 123 132261 0.41% 124 133708 0.41% 125 134498 0.41% 126 138363 0.42% 127 141065 0.43% 128 141684 0.43% 129 142509 0.44% 130 143131 0.44% 131 143411 0.44% 132 143155 0.44% 133 144507 0.44% 134 143460 0.44% 135 144659 0.44% 136 145495 0.45% 137 147579 0.45% 138 149608 0.46% 139 151521 0.47% 140 150555 0.46% 141 150132 0.46% 142 152132 0.47% 143 151451 0.46% 144 150409 0.46% 145 151858 0.47% 146 149704 0.46% 147 151345 0.46% 148 152450 0.47% 149 152335 0.47% 150 154986 0.48% 151 24836692 76.22% 32585028 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=3.19 fanout-score-rank=29 prefix-density=0.20 prefix-fanout=2.5 sequence=GGCTTCTCCCATTTGAGGGGCTTGACAACTTCCCAGGTGAAGTCTGGGTCATCCCTTCCAAAATGTCCGTATGCAGCTGTCTTCAAGAACCTATTACCCCCCCTCTTGAGATCCAGGTTGATGGTCATCATTCCAGGCCTAAAGTCAAAGCTCTCCTTCACAATCTTAAGGATCTCCTTGTCAGGAATTTTTCCAGTGCCATAGGTGTCCACAAAGACTGACAAAGGCTCAGGTACACCAATAGCATAGGA criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=186.87 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=13.2 sequence=GAGAAGAAATCATAGATTGCAACCAATAGATAAGGGTTGATTGTACTCCAACATCTCCTGATCGGTTCACTTGGCACTGGCAAGTTGGGTGCGGAGGAGCTTGGCAGCATCAACCATGTTCTTGAGAGCTGGCTTCACCTCAGAGTACTTGCGAGTTTTGAGTCCACAGTCAGGGTTAACCCACAATATGTTTGTCTCAAGCACTGCAAGCATCTTGTTGATTCTATCAGCAATCTCCTCGGTTGATGGTATTCTGGGAGAGTGGATATCATAGACACCAGGACCAATTCCAGCACCATACTTCACTCCCTCACGGAAGACTGAGAGAAGCTTTTCATCGGAGCGAGAGTTCTCGATGGTGATCACATCAGCATCCATGTCGATGATTGAGTGGATAATGTCATTGAAGTTGGAGTAGCACATGTGAGTGTGGATCTGGGTGGTGTCCTGTACGCCACAATTGGTGATCCTGAAGGAGTGGACTGCCCAATCCAAGTAAAAAGCTTGTTCG criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=3.62 fanout-score-rank=32 prefix-density=0.17 prefix-fanout=2.8 sequence=ACCTTGATGAGAA criterion=fanout-score sequence-density=0.08 sequence-density-rank=19 fanout-score=40.54 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=10.5 sequence=AGAAAATGGAAACCTTTCTATTCAC SRR28623249 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 11:05:04 Started mapping on | Feb 11 11:05:05 Finished on | Feb 11 11:11:58 Mapping speed, Million of reads per hour | 284.03 Number of input reads | 32585028 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 27924728 Uniquely mapped reads % | 85.70% Average mapped length | 286.98 Number of splices: Total | 20523897 Number of splices: Annotated (sjdb) | 20043056 Number of splices: GT/AG | 20180989 Number of splices: GC/AG | 248822 Number of splices: AT/AC | 19109 Number of splices: Non-canonical | 74977 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.04% Deletion average length | 2.84 Insertion rate per base | 0.03% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 720457 % of reads mapped to multiple loci | 2.21% Number of reads mapped to too many loci | 849746 % of reads mapped to too many loci | 2.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.99% % of reads unmapped: other | 0.50% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3939843 3939843 3939843 N_multimapping 720457 720457 720457 N_noFeature 1118956 27495378 1312678 N_ambiguous 355462 3305 117137 UnstrandedReadsAssigned:26450310 PositiveStrandReadsAssigned:426045 NegativeStrandReadsAssigned:26494913 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=141 echo kmer=137 SRR28623249 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623249-trimmed-pair1.fastq SRR28623249-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,585,028 reads, 27,424,328 reads pseudoaligned [quant] estimated average fragment length: 205.659 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,095 rounds 52401 SRR28623249.ke.tsv 34699 SRR28623249.se.tsv 87100 total ==> SRR28623249.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1813.34 778 17.3832 Potri.005G024800.1.v4.1 1035 830.341 279 13.6138 Potri.004G059700.1.v4.1 961 756.361 21 1.12492 Potri.007G009000.2.v4.1 1416 1211.34 0 0 Potri.003G141000.2.v4.1 2943 2738.34 416.182 6.15781 Potri.016G087400.1.v4.1 270 103.151 1939.7 761.886 Potri.015G069301.1.v4.1 564 362.778 0 0 Potri.010G195200.1.v4.1 1773 1568.34 33 0.852519 Potri.012G127500.1.v4.1 977 772.346 4097 214.924 ==> SRR28623249.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4277 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 694 Potri.001G212900.v4.1 104 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR28623249 completed mapping pipeline successfully