Starting /dee2/code/volunteer_pipeline.sh SRR28623250 current disk space = 3051956613120 free memory = 1467434196 SRR28623250 SRAfilesize b87ea1c6c351aa634848965b3be62c94 SRR28623250.sra SRR28623250.sra file validated SRR28623250 is paired end SRR28623250 is conventional basespace SRR28623250 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623250_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.70225 37.0 37.0 37.0 37.0 37.0 2 36.385 37.0 37.0 37.0 37.0 37.0 3 36.3905 37.0 37.0 37.0 37.0 37.0 4 36.458 37.0 37.0 37.0 37.0 37.0 5 36.574 37.0 37.0 37.0 37.0 37.0 6 36.656 37.0 37.0 37.0 37.0 37.0 7 36.5585 37.0 37.0 37.0 37.0 37.0 8 36.608 37.0 37.0 37.0 37.0 37.0 9 36.589 37.0 37.0 37.0 37.0 37.0 10-14 36.62179999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.5986 37.0 37.0 37.0 37.0 37.0 20-24 36.5509 37.0 37.0 37.0 37.0 37.0 25-29 36.5077 37.0 37.0 37.0 37.0 37.0 30-34 36.44840000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.407799999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.3665 37.0 37.0 37.0 37.0 37.0 45-49 36.297700000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.2611 37.0 37.0 37.0 37.0 37.0 55-59 36.242200000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.2704 37.0 37.0 37.0 37.0 37.0 65-69 36.1574 37.0 37.0 37.0 37.0 37.0 70-74 36.109 37.0 37.0 37.0 37.0 37.0 75-79 36.1024 37.0 37.0 37.0 37.0 37.0 80-84 36.081199999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.0081 37.0 37.0 37.0 37.0 37.0 90-94 36.0485 37.0 37.0 37.0 37.0 37.0 95-99 35.940999999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.9226 37.0 37.0 37.0 37.0 37.0 105-109 35.874399999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.7789 37.0 37.0 37.0 37.0 37.0 115-119 35.6988 37.0 37.0 37.0 37.0 37.0 120-124 35.5805 37.0 37.0 37.0 37.0 37.0 125-129 35.4894 37.0 37.0 37.0 37.0 37.0 130-134 35.23929999999999 37.0 37.0 37.0 27.4 37.0 135-139 35.1101 37.0 37.0 37.0 27.4 37.0 140-144 34.9373 37.0 37.0 37.0 27.4 37.0 145-149 34.7509 37.0 37.0 37.0 25.0 37.0 150-151 33.84875 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 1.0 25 4.0 26 12.0 27 9.0 28 15.0 29 25.0 30 29.0 31 52.0 32 83.0 33 118.0 34 176.0 35 466.0 36 2844.0 37 164.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.35294117647059 14.317897371714643 9.086357947434292 34.242803504380475 2 20.549999999999997 15.174999999999999 35.949999999999996 28.325 3 17.325 20.325 29.349999999999998 33.0 4 21.125 28.999999999999996 25.124999999999996 24.75 5 24.075 33.175 23.849999999999998 18.9 6 18.975 37.9 23.7 19.425 7 14.924999999999999 28.199999999999996 42.3 14.575 8 17.675 28.325 30.2 23.799999999999997 9 18.0 23.275000000000002 35.65 23.075000000000003 10-14 19.215 30.599999999999998 27.384999999999998 22.8 15-19 19.825 28.189999999999998 28.395 23.59 20-24 19.66 28.485 27.99 23.865 25-29 19.74 29.175 27.42 23.665 30-34 19.025 29.5 27.615000000000002 23.86 35-39 19.765 29.01 27.584999999999997 23.64 40-44 19.725 29.645 27.275 23.355 45-49 20.14 29.53 26.889999999999997 23.44 50-54 19.400000000000002 29.609999999999996 27.089999999999996 23.9 55-59 19.89 28.705000000000002 27.71 23.695 60-64 19.755 29.115000000000002 27.29 23.84 65-69 19.67 29.035 27.575 23.72 70-74 19.505 28.910000000000004 27.83 23.755000000000003 75-79 19.775000000000002 29.125 27.750000000000004 23.35 80-84 19.925 29.794999999999998 27.089999999999996 23.189999999999998 85-89 19.475 29.37 27.57 23.585 90-94 19.715 29.2 27.63 23.455000000000002 95-99 20.055 28.815 27.384999999999998 23.745 100-104 19.634999999999998 28.95 27.295 24.12 105-109 20.75 28.57 26.884999999999998 23.794999999999998 110-114 20.935000000000002 28.405 26.834999999999997 23.825 115-119 20.86 29.345 26.595000000000002 23.200000000000003 120-124 20.54 29.235 26.395000000000003 23.830000000000002 125-129 20.51 29.110000000000003 26.584999999999997 23.794999999999998 130-134 20.205000000000002 28.910000000000004 26.724999999999998 24.16 135-139 20.685000000000002 29.335 26.05 23.93 140-144 20.44 28.95 26.229999999999997 24.38 145-149 20.96 28.425 26.135 24.48 150-151 20.9125 28.012500000000003 26.8 24.275 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 1.0 8 1.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 1.5 21 1.5 22 0.5 23 1.0 24 2.0 25 3.5 26 6.0 27 9.5 28 12.5 29 19.0 30 24.0 31 28.5 32 39.0 33 51.0 34 69.0 35 88.0 36 115.0 37 130.5 38 140.5 39 175.0 40 191.5 41 201.5 42 228.0 43 265.0 44 286.0 45 268.5 46 247.0 47 234.0 48 215.5 49 189.5 50 151.0 51 129.5 52 118.0 53 91.5 54 70.5 55 50.5 56 34.5 57 23.0 58 17.5 59 13.5 60 10.5 61 10.0 62 6.0 63 3.0 64 3.0 65 3.5 66 3.0 67 3.5 68 3.5 69 2.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.65 #Duplication Level Percentage of deduplicated Percentage of total 1 97.64464925755249 95.35 2 2.3041474654377883 4.5 3 0.051203277009728626 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.3375 0.0 0.0 0.0 0.0 80-81 0.4 0.0 0.0 0.0 0.0 82-83 0.475 0.0 0.0 0.0 0.0 84-85 0.6499999999999999 0.0 0.0 0.0 0.0 86-87 0.8374999999999999 0.0 0.0 0.0 0.0 88-89 0.9125000000000001 0.0 0.0 0.0 0.0 90-91 1.0499999999999998 0.0 0.0 0.0 0.0 92-93 1.3375 0.0 0.0 0.0 0.0 94-95 1.6125 0.0 0.0 0.0 0.0 96-97 1.8875 0.0 0.0 0.0 0.0 98-99 2.1375 0.0 0.0 0.0 0.0 100-101 2.4 0.0 0.0 0.0 0.0 102-103 2.7625 0.0 0.0 0.0 0.0 104-105 3.25 0.0 0.0 0.0 0.0 106-107 3.7375 0.0 0.0 0.0 0.0 108-109 4.2375 0.0 0.0 0.0 0.0 110-111 4.737500000000001 0.0 0.0 0.0 0.0 112-113 5.35 0.0 0.0 0.0 0.0 114-115 5.9375 0.0 0.0 0.0 0.0 116-117 6.5125 0.0 0.0 0.0 0.0 118-119 7.05 0.0 0.0 0.0 0.0 120-121 7.625 0.0 0.0 0.0 0.0 122-123 8.3625 0.0 0.0 0.0 0.0 124-125 8.975 0.0 0.0 0.0 0.0 126-127 9.7875 0.0 0.0 0.0 0.0 128-129 10.55 0.0 0.0 0.0 0.0 130-131 11.3875 0.0 0.0 0.0 0.0 132-133 12.0875 0.0 0.0 0.0 0.0 134-135 12.8875 0.0 0.0 0.0 0.0 136-137 13.649999999999999 0.0 0.0 0.0 0.0 138-139 14.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCATTG 10 0.006830828 145.0 3 >>END_MODULE SRR28623250 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623250_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.017 37.0 37.0 37.0 37.0 37.0 2 36.218 37.0 37.0 37.0 37.0 37.0 3 36.2945 37.0 37.0 37.0 37.0 37.0 4 36.2555 37.0 37.0 37.0 37.0 37.0 5 36.2015 37.0 37.0 37.0 37.0 37.0 6 36.187 37.0 37.0 37.0 37.0 37.0 7 36.193 37.0 37.0 37.0 37.0 37.0 8 36.177 37.0 37.0 37.0 37.0 37.0 9 36.27 37.0 37.0 37.0 37.0 37.0 10-14 36.187599999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.08669999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.060199999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.0048 37.0 37.0 37.0 37.0 37.0 30-34 35.9258 37.0 37.0 37.0 37.0 37.0 35-39 35.8272 37.0 37.0 37.0 37.0 37.0 40-44 35.8291 37.0 37.0 37.0 37.0 37.0 45-49 35.8084 37.0 37.0 37.0 37.0 37.0 50-54 35.66799999999999 37.0 37.0 37.0 37.0 37.0 55-59 35.741699999999994 37.0 37.0 37.0 37.0 37.0 60-64 35.6255 37.0 37.0 37.0 37.0 37.0 65-69 35.570499999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.513000000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.51899999999999 37.0 37.0 37.0 37.0 37.0 80-84 35.4286 37.0 37.0 37.0 37.0 37.0 85-89 35.31660000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.352799999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.32020000000001 37.0 37.0 37.0 37.0 37.0 100-104 35.229400000000005 37.0 37.0 37.0 34.6 37.0 105-109 35.1486 37.0 37.0 37.0 29.8 37.0 110-114 35.0698 37.0 37.0 37.0 27.4 37.0 115-119 34.9701 37.0 37.0 37.0 25.0 37.0 120-124 34.898 37.0 37.0 37.0 25.0 37.0 125-129 34.7936 37.0 37.0 37.0 25.0 37.0 130-134 34.7331 37.0 37.0 37.0 25.0 37.0 135-139 34.5001 37.0 37.0 37.0 25.0 37.0 140-144 34.6063 37.0 37.0 37.0 25.0 37.0 145-149 34.254599999999996 37.0 37.0 37.0 25.0 37.0 150-151 33.70325 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 5.0 14 8.0 15 5.0 16 5.0 17 9.0 18 3.0 19 7.0 20 6.0 21 9.0 22 8.0 23 16.0 24 15.0 25 15.0 26 16.0 27 24.0 28 17.0 29 25.0 30 42.0 31 39.0 32 65.0 33 141.0 34 217.0 35 658.0 36 2465.0 37 180.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.85 22.275 13.325000000000001 20.549999999999997 2 30.7 23.974999999999998 28.499999999999996 16.825000000000003 3 23.599999999999998 27.125 31.125000000000004 18.15 4 26.35 33.050000000000004 23.5 17.1 5 26.35 35.199999999999996 21.05 17.4 6 22.925 38.074999999999996 22.2 16.8 7 21.6 21.55 38.800000000000004 18.05 8 23.0 25.75 27.224999999999998 24.025 9 23.549999999999997 25.55 28.65 22.25 10-14 24.815 28.685 26.51 19.99 15-19 24.72 27.894999999999996 27.185 20.200000000000003 20-24 23.555 28.660000000000004 27.35 20.435 25-29 24.37 28.689999999999998 27.215 19.725 30-34 23.66 28.64 27.97 19.73 35-39 24.099999999999998 28.02 27.93 19.950000000000003 40-44 23.415 28.549999999999997 27.825 20.21 45-49 24.195 28.349999999999998 27.865000000000002 19.59 50-54 23.65 28.345 28.415000000000003 19.59 55-59 23.5 28.03 28.565 19.905 60-64 23.715 28.189999999999998 27.97 20.125 65-69 23.855 28.23 28.23 19.685 70-74 24.14 27.47 27.779999999999998 20.61 75-79 23.715 28.4 28.810000000000002 19.075 80-84 23.98 28.345 28.15 19.525000000000002 85-89 23.830000000000002 28.384999999999998 27.975 19.81 90-94 23.915 28.53 28.105000000000004 19.45 95-99 23.615 28.62 27.735 20.03 100-104 24.43 28.544999999999998 27.85 19.175 105-109 24.099999999999998 28.689999999999998 28.050000000000004 19.16 110-114 24.385 28.865000000000002 27.634999999999998 19.115 115-119 25.055 28.345 27.224999999999998 19.375 120-124 25.28 28.88 26.83 19.009999999999998 125-129 25.05 28.815 27.38 18.755 130-134 25.619999999999997 28.605000000000004 26.69 19.085 135-139 25.924999999999997 29.025000000000002 26.51 18.54 140-144 26.69 28.365000000000002 26.169999999999998 18.775 145-149 26.495 27.689999999999998 27.384999999999998 18.43 150-151 26.1 29.012500000000003 26.487500000000004 18.4 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 1.5 4 2.5 5 2.0 6 1.5 7 1.5 8 1.5 9 1.0 10 1.0 11 1.0 12 1.5 13 1.5 14 1.5 15 2.5 16 3.0 17 2.5 18 1.0 19 0.5 20 1.0 21 2.0 22 4.0 23 3.0 24 4.5 25 7.0 26 3.0 27 5.0 28 10.0 29 13.0 30 18.5 31 23.0 32 27.5 33 36.5 34 47.0 35 63.0 36 97.5 37 121.5 38 149.0 39 175.0 40 182.0 41 211.0 42 250.0 43 268.5 44 289.5 45 292.5 46 272.0 47 255.5 48 217.0 49 176.5 50 153.0 51 128.0 52 112.5 53 91.5 54 56.5 55 40.5 56 27.5 57 20.5 58 18.0 59 13.0 60 12.0 61 7.5 62 5.5 63 5.0 64 4.5 65 5.0 66 3.0 67 1.5 68 1.5 69 0.5 70 1.0 71 1.0 72 0.5 73 1.5 74 2.0 75 1.0 76 0.5 77 0.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 1.0 84 1.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 1.0 91 1.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.5 98 1.0 99 3.0 100 11.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.675 #Duplication Level Percentage of deduplicated Percentage of total 1 97.43987587276959 94.19999999999999 2 2.379105249547453 4.6 3 0.12929919834497025 0.375 4 0.02585983966899405 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02585983966899405 0.7250000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 29 0.7250000000000001 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.3375 0.0 0.0 0.0 0.0 80-81 0.4 0.0 0.0 0.0 0.0 82-83 0.475 0.0 0.0 0.0 0.0 84-85 0.6499999999999999 0.0 0.0 0.0 0.0 86-87 0.8374999999999999 0.0 0.0 0.0 0.0 88-89 0.9375 0.0 0.0 0.0 0.0 90-91 1.0750000000000002 0.0 0.0 0.0 0.0 92-93 1.3624999999999998 0.0 0.0 0.0 0.0 94-95 1.65 0.0 0.0 0.0 0.0 96-97 1.9125 0.0 0.0 0.0 0.0 98-99 2.175 0.0 0.0 0.0 0.0 100-101 2.45 0.0 0.0 0.0 0.0 102-103 2.85 0.0 0.0 0.0 0.0 104-105 3.3875 0.0 0.0 0.0 0.0 106-107 3.8875 0.0 0.0 0.0 0.0 108-109 4.425 0.0 0.0 0.0 0.0 110-111 4.9375 0.0 0.0 0.0 0.0 112-113 5.6 0.0 0.0 0.0 0.0 114-115 6.2125 0.0 0.0 0.0 0.0 116-117 6.8125 0.0 0.0 0.0 0.0 118-119 7.375 0.0 0.0 0.0 0.0 120-121 7.9625 0.0 0.0 0.0 0.0 122-123 8.6875 0.0 0.0 0.0 0.0 124-125 9.325 0.0 0.0 0.0 0.0 126-127 10.1375 0.0 0.0 0.0 0.0 128-129 10.899999999999999 0.0 0.0 0.0 0.0 130-131 11.75 0.0 0.0 0.0 0.0 132-133 12.45 0.0 0.0 0.0 0.0 134-135 13.274999999999999 0.0 0.0 0.0 0.0 136-137 14.0625 0.0 0.0 0.0 0.0 138-139 14.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTGTAG 10 0.006830828 145.0 6 >>END_MODULE Read 937953 spots for SRR28623250.sra Written 937953 spots for SRR28623250.sra Read 937953 spots for SRR28623250.sra Written 937953 spots for SRR28623250.sra Read 937953 spots for SRR28623250.sra Written 937953 spots for SRR28623250.sra Read 937953 spots for SRR28623250.sra Written 937953 spots for SRR28623250.sra Read 937953 spots for SRR28623250.sra Written 937953 spots for SRR28623250.sra Read 937953 spots for SRR28623250.sra Written 937953 spots for SRR28623250.sra Read 937953 spots for SRR28623250.sra Written 937953 spots for SRR28623250.sra Read 937953 spots for SRR28623250.sra Written 937953 spots for SRR28623250.sra Read 937953 spots for SRR28623250.sra Written 937953 spots for SRR28623250.sra Read 937953 spots for SRR28623250.sra Written 937953 spots for SRR28623250.sra Read 937958 spots for SRR28623250.sra Written 937958 spots for SRR28623250.sra Read 937953 spots for SRR28623250.sra Written 937953 spots for SRR28623250.sra Read 937953 spots for SRR28623250.sra Written 937953 spots for SRR28623250.sra Read 937953 spots for SRR28623250.sra Written 937953 spots for SRR28623250.sra Read 937953 spots for SRR28623250.sra Written 937953 spots for SRR28623250.sra Read 937953 spots for SRR28623250.sra Written 937953 spots for SRR28623250.sra Read 937953 spots for SRR28623250.sra Written 937953 spots for SRR28623250.sra Read 937953 spots for SRR28623250.sra Written 937953 spots for SRR28623250.sra Read 937953 spots for SRR28623250.sra Written 937953 spots for SRR28623250.sra Read 937953 spots for SRR28623250.sra Written 937953 spots for SRR28623250.sra SRR ids: ['SRR28623250.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ubqzkyh5 SRR28623250.sra spots: 18759065 blocks: [[1, 937953], [937954, 1875906], [1875907, 2813859], [2813860, 3751812], [3751813, 4689765], [4689766, 5627718], [5627719, 6565671], [6565672, 7503624], [7503625, 8441577], [8441578, 9379530], [9379531, 10317483], [10317484, 11255436], [11255437, 12193389], [12193390, 13131342], [13131343, 14069295], [14069296, 15007248], [15007249, 15945201], [15945202, 16883154], [16883155, 17821107], [17821108, 18759065]] SRR28623250 file size 6922303 SRR28623250 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623250 SRR28623250_1.fastq SRR28623250_2.fastq Input file: SRR28623250_1.fastq Paired file: SRR28623250_2.fastq trimmed: SRR28623250-trimmed-pair1.fastq, SRR28623250-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 11:21:23 2025 >> started Tue Feb 11 11:21:47 2025 >> done (24.249s) 18759065 read pairs processed; of these: 24 ( 0.00%) short read pairs filtered out after trimming by size control 26719 ( 0.14%) empty read pairs filtered out after trimming by size control 18732322 (99.86%) read pairs available; of these: 3995570 (21.33%) trimmed read pairs available after processing 14736752 (78.67%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 1 0.00% 21 3 0.00% 22 4 0.00% 23 2 0.00% 24 7 0.00% 25 7 0.00% 26 8 0.00% 27 5 0.00% 28 6 0.00% 29 9 0.00% 30 12 0.00% 31 14 0.00% 32 9 0.00% 33 12 0.00% 34 22 0.00% 35 11 0.00% 36 16 0.00% 37 15 0.00% 38 21 0.00% 39 23 0.00% 40 30 0.00% 41 33 0.00% 42 41 0.00% 43 44 0.00% 44 52 0.00% 45 59 0.00% 46 79 0.00% 47 91 0.00% 48 94 0.00% 49 126 0.00% 50 146 0.00% 51 178 0.00% 52 190 0.00% 53 222 0.00% 54 253 0.00% 55 288 0.00% 56 318 0.00% 57 383 0.00% 58 460 0.00% 59 527 0.00% 60 638 0.00% 61 744 0.00% 62 978 0.01% 63 1050 0.01% 64 1126 0.01% 65 1278 0.01% 66 1509 0.01% 67 1693 0.01% 68 1947 0.01% 69 2270 0.01% 70 2571 0.01% 71 3158 0.02% 72 3679 0.02% 73 4159 0.02% 74 4600 0.02% 75 5098 0.03% 76 5521 0.03% 77 6160 0.03% 78 6967 0.04% 79 7701 0.04% 80 8634 0.05% 81 9913 0.05% 82 11354 0.06% 83 12396 0.07% 84 13798 0.07% 85 14633 0.08% 86 15782 0.08% 87 16832 0.09% 88 18196 0.10% 89 19358 0.10% 90 20820 0.11% 91 22833 0.12% 92 24058 0.13% 93 26609 0.14% 94 28229 0.15% 95 29791 0.16% 96 30718 0.16% 97 32354 0.17% 98 33222 0.18% 99 34987 0.19% 100 36539 0.20% 101 38080 0.20% 102 40500 0.22% 103 42704 0.23% 104 44393 0.24% 105 46110 0.25% 106 47872 0.26% 107 48326 0.26% 108 49660 0.27% 109 50721 0.27% 110 51310 0.27% 111 53633 0.29% 112 55737 0.30% 113 57643 0.31% 114 59391 0.32% 115 61111 0.33% 116 62073 0.33% 117 63074 0.34% 118 64347 0.34% 119 64084 0.34% 120 65487 0.35% 121 66614 0.36% 122 67935 0.36% 123 70258 0.38% 124 71897 0.38% 125 72605 0.39% 126 74436 0.40% 127 74323 0.40% 128 75013 0.40% 129 75438 0.40% 130 76172 0.41% 131 76255 0.41% 132 78346 0.42% 133 79678 0.43% 134 80452 0.43% 135 81261 0.43% 136 82034 0.44% 137 82927 0.44% 138 83318 0.44% 139 83016 0.44% 140 82951 0.44% 141 83724 0.45% 142 84628 0.45% 143 85167 0.45% 144 86932 0.46% 145 87303 0.47% 146 87118 0.47% 147 87672 0.47% 148 88319 0.47% 149 87772 0.47% 150 88023 0.47% 151 14736752 78.67% 18732322 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=22.84 fanout-score-rank=5 prefix-density=0.33 prefix-fanout=22.8 sequence=GGATCGGAAGAGCACACGTCTGAACTCCAGTCACACACCAGTATCTCGTATGCCGTCTTCTGCTTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=137.11 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=13.4 sequence=AAAACAACAACTCAACCCCAAGGGTTTTATTTTTAAGGAATAGCAGCACTCCCTTCACATAGCACAGCACAAACAAGAAATCAAGACACGAACATTCAGTGGTTCAAAACCAGCATTTATTGCACATTACATTACTTTATTCCCATGAAATAGCCCGGCCGAAGTCGTTACTCCTGAGCATTTAGTAGAGAAAGTAGTCTATCACAAGACGCTGTGACAAAGTAGGCAAAAATCCTTCTGCAAATGCAGCAAGAGCAGCAGAATCGAGGTACTCTTGCAAACCTGACTTGCTCTCAAATGTAGATTCAAAGGCATGAGTGTATCCTCGGTTTAGCTCCGCAGACTCCATGCCCAAATCCGTGCCCCAATTGAAACTCTTCATGGTTGGAATGAGATCGAGCAGATTGGTATAGTCATTAATGTAGTTGTCGATTTGTTCTCGTGTGATCTCATCCTTGAACCGAGTCAACAATGTGTGCTTCACAAGCTTTGGAGTTCTGGTTGCCATGTC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=10.11 fanout-score-rank=18 prefix-density=0.13 prefix-fanout=10.1 sequence=GAGAGAGAGAGTTAAGACAATGGCCTCGAAGAAATCTGCAATCGTATTACCTGGTTCAAAGGTGTTGAAGCACATAGTTTTTGTACGGTTTAATGATGGGATCACTGATGAACAAATTGAGAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=21 fanout-score=200.72 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=22.3 sequence=AGAAGAAGATGT SRR28623250 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 11:22:36 Started mapping on | Feb 11 11:22:37 Finished on | Feb 11 11:25:20 Mapping speed, Million of reads per hour | 413.72 Number of input reads | 18732322 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 17081065 Uniquely mapped reads % | 91.18% Average mapped length | 288.31 Number of splices: Total | 14871379 Number of splices: Annotated (sjdb) | 14541408 Number of splices: GT/AG | 14619498 Number of splices: GC/AG | 187578 Number of splices: AT/AC | 13503 Number of splices: Non-canonical | 50800 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.91 Insertion rate per base | 0.03% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 556876 % of reads mapped to multiple loci | 2.97% Number of reads mapped to too many loci | 86078 % of reads mapped to too many loci | 0.46% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.95% % of reads unmapped: other | 0.43% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1094381 1094381 1094381 N_multimapping 556876 556876 556876 N_noFeature 623878 16870624 736376 N_ambiguous 191677 1155 92907 UnstrandedReadsAssigned:16265510 PositiveStrandReadsAssigned:209286 NegativeStrandReadsAssigned:16251782 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR28623250 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623250-trimmed-pair1.fastq SRR28623250-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,732,322 reads, 16,639,215 reads pseudoaligned [quant] estimated average fragment length: 212.426 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,068 rounds 52401 SRR28623250.ke.tsv 34699 SRR28623250.se.tsv 87100 total ==> SRR28623250.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1806.57 723 23.4435 Potri.005G024800.1.v4.1 1035 823.574 560 39.8314 Potri.004G059700.1.v4.1 961 749.598 47 3.6729 Potri.007G009000.2.v4.1 1416 1204.57 0 0 Potri.003G141000.2.v4.1 2943 2731.57 523.624 11.2291 Potri.016G087400.1.v4.1 270 99.9822 1157.26 678.031 Potri.015G069301.1.v4.1 564 357.233 0 0 Potri.010G195200.1.v4.1 1773 1561.57 37 1.38797 Potri.012G127500.1.v4.1 977 765.579 4210 322.131 ==> SRR28623250.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 848 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 293 Potri.001G212900.v4.1 33 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 2 SRR28623250 completed mapping pipeline successfully