Starting /dee2/code/volunteer_pipeline.sh SRR28623251 current disk space = 3051231043584 free memory = 1580065640 SRR28623251 SRAfilesize 094ce0a97adbac7562b0b2bba707a5c7 SRR28623251.sra SRR28623251.sra file validated SRR28623251 is paired end SRR28623251 is conventional basespace SRR28623251 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623251_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.785 37.0 37.0 37.0 37.0 37.0 2 36.385 37.0 37.0 37.0 37.0 37.0 3 36.4295 37.0 37.0 37.0 37.0 37.0 4 36.4885 37.0 37.0 37.0 37.0 37.0 5 36.5785 37.0 37.0 37.0 37.0 37.0 6 36.579 37.0 37.0 37.0 37.0 37.0 7 36.56075 37.0 37.0 37.0 37.0 37.0 8 36.5095 37.0 37.0 37.0 37.0 37.0 9 36.583 37.0 37.0 37.0 37.0 37.0 10-14 36.5793 37.0 37.0 37.0 37.0 37.0 15-19 36.5377 37.0 37.0 37.0 37.0 37.0 20-24 36.512899999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.472500000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.3947 37.0 37.0 37.0 37.0 37.0 35-39 36.3625 37.0 37.0 37.0 37.0 37.0 40-44 36.3366 37.0 37.0 37.0 37.0 37.0 45-49 36.292100000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.207100000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.2159 37.0 37.0 37.0 37.0 37.0 60-64 36.2223 37.0 37.0 37.0 37.0 37.0 65-69 36.066500000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.1379 37.0 37.0 37.0 37.0 37.0 75-79 36.032500000000006 37.0 37.0 37.0 37.0 37.0 80-84 35.982299999999995 37.0 37.0 37.0 37.0 37.0 85-89 35.974599999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.0089 37.0 37.0 37.0 37.0 37.0 95-99 35.8335 37.0 37.0 37.0 37.0 37.0 100-104 35.8081 37.0 37.0 37.0 37.0 37.0 105-109 35.813500000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.6299 37.0 37.0 37.0 37.0 37.0 115-119 35.6532 37.0 37.0 37.0 37.0 37.0 120-124 35.5834 37.0 37.0 37.0 37.0 37.0 125-129 35.5338 37.0 37.0 37.0 37.0 37.0 130-134 35.1169 37.0 37.0 37.0 27.4 37.0 135-139 35.1075 37.0 37.0 37.0 29.8 37.0 140-144 34.7779 37.0 37.0 37.0 25.0 37.0 145-149 34.5437 37.0 37.0 37.0 25.0 37.0 150-151 33.672 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 1.0 20 3.0 21 0.0 22 3.0 23 3.0 24 2.0 25 5.0 26 8.0 27 9.0 28 11.0 29 32.0 30 34.0 31 67.0 32 72.0 33 117.0 34 194.0 35 434.0 36 2864.0 37 140.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.13813813813814 14.314314314314313 6.781781781781781 40.765765765765764 2 18.425 15.7 36.775000000000006 29.099999999999998 3 17.575 19.475 28.549999999999997 34.4 4 22.375 26.5 24.675 26.450000000000003 5 24.425 32.975 24.15 18.45 6 19.8 36.825 22.400000000000002 20.974999999999998 7 16.104026006501627 28.132033008252062 38.759689922480625 17.00425106276569 8 18.8 27.375 30.925000000000004 22.900000000000002 9 18.125 23.625 34.150000000000006 24.099999999999998 10-14 19.6 30.85 27.485 22.065 15-19 19.405 28.560000000000002 28.139999999999997 23.895 20-24 19.794999999999998 29.185 27.435 23.585 25-29 19.965 28.310000000000002 27.935 23.79 30-34 19.785 29.17 27.435 23.61 35-39 19.185 29.515 27.82 23.48 40-44 19.869999999999997 29.025000000000002 27.675 23.43 45-49 19.805 29.015 27.779999999999998 23.400000000000002 50-54 19.875 29.235 27.345000000000002 23.544999999999998 55-59 20.23 28.865000000000002 27.555000000000003 23.35 60-64 20.28 28.294999999999998 27.54 23.885 65-69 19.384999999999998 29.12 27.73 23.765 70-74 19.72 29.34 27.389999999999997 23.549999999999997 75-79 19.935 28.294999999999998 28.09 23.68 80-84 19.564999999999998 28.694999999999997 28.025 23.715 85-89 19.64 28.54 27.650000000000002 24.169999999999998 90-94 19.715 29.049999999999997 27.1 24.135 95-99 20.150000000000002 28.675 27.865000000000002 23.31 100-104 20.375 28.76 27.515 23.35 105-109 20.49 28.51 27.67 23.330000000000002 110-114 20.3 29.099999999999998 27.1 23.5 115-119 20.24 28.665000000000003 27.26 23.835 120-124 20.07 28.98 26.674999999999997 24.275 125-129 20.044999999999998 29.185 26.490000000000002 24.279999999999998 130-134 20.285 29.21 26.495 24.01 135-139 20.985 28.465 26.290000000000003 24.26 140-144 20.985 28.244999999999997 26.715 24.055 145-149 20.96 28.09 26.295 24.654999999999998 150-151 20.6375 27.8625 27.3 24.2 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.5 20 2.0 21 1.0 22 2.0 23 4.0 24 4.0 25 4.5 26 5.0 27 5.5 28 13.0 29 22.0 30 25.0 31 29.0 32 37.0 33 51.5 34 66.5 35 81.5 36 101.5 37 121.0 38 142.0 39 160.5 40 187.5 41 213.5 42 240.0 43 254.5 44 255.5 45 245.0 46 247.5 47 262.0 48 240.0 49 196.5 50 151.0 51 137.5 52 112.0 53 87.5 54 80.5 55 50.5 56 31.0 57 29.5 58 26.0 59 17.5 60 13.0 61 8.0 62 6.0 63 6.5 64 3.5 65 2.0 66 1.5 67 1.5 68 2.5 69 2.0 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.7 #Duplication Level Percentage of deduplicated Percentage of total 1 97.67144319344933 95.42500000000001 2 2.3029682702149437 4.5 3 0.0255885363357216 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.3125 0.0 0.0 0.0 0.0 82-83 0.42500000000000004 0.0 0.0 0.0 0.0 84-85 0.575 0.0 0.0 0.0 0.0 86-87 0.7375 0.0 0.0 0.0 0.0 88-89 0.9375 0.0 0.0 0.0 0.0 90-91 1.1875 0.0 0.0 0.0 0.0 92-93 1.4625 0.0 0.0 0.0 0.0 94-95 1.75 0.0 0.0 0.0 0.0 96-97 2.15 0.0 0.0 0.0 0.0 98-99 2.625 0.0 0.0 0.0 0.0 100-101 3.1625 0.0 0.0 0.0 0.0 102-103 3.5374999999999996 0.0 0.0 0.0 0.0 104-105 3.9875 0.0 0.0 0.0 0.0 106-107 4.3375 0.0 0.0 0.0 0.0 108-109 4.9625 0.0 0.0 0.0 0.0 110-111 5.5625 0.0 0.0 0.0 0.0 112-113 6.1125 0.0 0.0 0.0 0.0 114-115 6.8375 0.0 0.0 0.0 0.0 116-117 7.5125 0.0 0.0 0.0 0.0 118-119 8.350000000000001 0.0 0.0 0.0 0.0 120-121 9.075 0.0 0.0 0.0 0.0 122-123 9.9875 0.0 0.0 0.0 0.0 124-125 10.6875 0.0 0.0 0.0 0.0 126-127 11.5375 0.0 0.0 0.0 0.0 128-129 12.399999999999999 0.0 0.0 0.0 0.0 130-131 13.162500000000001 0.0 0.0 0.0 0.0 132-133 13.9375 0.0 0.0 0.0 0.0 134-135 14.8875 0.0 0.0 0.0 0.0 136-137 16.0 0.0 0.0 0.0 0.0 138-139 16.825000000000003 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR28623251 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623251_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.20075 37.0 37.0 37.0 37.0 37.0 2 36.386 37.0 37.0 37.0 37.0 37.0 3 36.359 37.0 37.0 37.0 37.0 37.0 4 36.4505 37.0 37.0 37.0 37.0 37.0 5 36.3975 37.0 37.0 37.0 37.0 37.0 6 36.324 37.0 37.0 37.0 37.0 37.0 7 36.3815 37.0 37.0 37.0 37.0 37.0 8 36.4015 37.0 37.0 37.0 37.0 37.0 9 36.462 37.0 37.0 37.0 37.0 37.0 10-14 36.400099999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.3341 37.0 37.0 37.0 37.0 37.0 20-24 36.3031 37.0 37.0 37.0 37.0 37.0 25-29 36.2237 37.0 37.0 37.0 37.0 37.0 30-34 36.194399999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.115899999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.1607 37.0 37.0 37.0 37.0 37.0 45-49 36.0623 37.0 37.0 37.0 37.0 37.0 50-54 36.0176 37.0 37.0 37.0 37.0 37.0 55-59 35.9686 37.0 37.0 37.0 37.0 37.0 60-64 35.9978 37.0 37.0 37.0 37.0 37.0 65-69 35.95119999999999 37.0 37.0 37.0 37.0 37.0 70-74 35.8965 37.0 37.0 37.0 37.0 37.0 75-79 35.8389 37.0 37.0 37.0 37.0 37.0 80-84 35.804899999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.740899999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.70569999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.644400000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.528499999999994 37.0 37.0 37.0 37.0 37.0 105-109 35.4697 37.0 37.0 37.0 37.0 37.0 110-114 35.4899 37.0 37.0 37.0 37.0 37.0 115-119 35.219 37.0 37.0 37.0 34.6 37.0 120-124 35.2392 37.0 37.0 37.0 29.8 37.0 125-129 35.199 37.0 37.0 37.0 29.8 37.0 130-134 35.1388 37.0 37.0 37.0 25.0 37.0 135-139 35.000099999999996 37.0 37.0 37.0 27.4 37.0 140-144 35.0288 37.0 37.0 37.0 25.0 37.0 145-149 34.736200000000004 37.0 37.0 37.0 25.0 37.0 150-151 34.301249999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 5.0 15 5.0 16 4.0 17 6.0 18 3.0 19 1.0 20 2.0 21 4.0 22 6.0 23 5.0 24 6.0 25 11.0 26 7.0 27 14.0 28 15.0 29 34.0 30 25.0 31 37.0 32 53.0 33 110.0 34 205.0 35 568.0 36 2647.0 37 225.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.6609152288072 21.305326331582897 10.227556889222306 24.8062015503876 2 27.075 25.624999999999996 31.924999999999997 15.375 3 22.400000000000002 26.700000000000003 32.35 18.55 4 25.55 33.425 22.8 18.224999999999998 5 26.724999999999998 35.925000000000004 22.225 15.125 6 21.349999999999998 38.224999999999994 23.0 17.424999999999997 7 21.425 22.925 37.4 18.25 8 22.55 24.95 28.825 23.674999999999997 9 23.35 25.1 29.225 22.325 10-14 23.87 29.81 26.295 20.025000000000002 15-19 23.36 28.105000000000004 27.639999999999997 20.895 20-24 23.32 29.13 27.51 20.04 25-29 23.46 28.575 27.565 20.4 30-34 23.505000000000003 28.83 27.450000000000003 20.215 35-39 23.56 28.205000000000002 28.255000000000003 19.98 40-44 23.405 28.849999999999998 27.145000000000003 20.599999999999998 45-49 23.45 27.775 28.360000000000003 20.415 50-54 23.955000000000002 28.134999999999998 28.15 19.759999999999998 55-59 24.01 27.389999999999997 28.360000000000003 20.24 60-64 23.225 27.689999999999998 28.555000000000003 20.53 65-69 23.54 28.175 28.349999999999998 19.935 70-74 23.669999999999998 27.845 28.225 20.26 75-79 23.635 27.935 28.425 20.005 80-84 23.185 28.205000000000002 28.535 20.075000000000003 85-89 23.419999999999998 28.549999999999997 28.24 19.79 90-94 23.549999999999997 27.765 28.549999999999997 20.135 95-99 23.51 28.435 28.76 19.295 100-104 24.310000000000002 28.12 27.77 19.8 105-109 24.745 28.105000000000004 27.779999999999998 19.37 110-114 24.005000000000003 27.939999999999998 28.139999999999997 19.915 115-119 24.825 28.4 27.265 19.509999999999998 120-124 25.21 28.560000000000002 27.500000000000004 18.73 125-129 25.929999999999996 28.32 27.275 18.475 130-134 25.755 27.689999999999998 27.67 18.884999999999998 135-139 26.090000000000003 28.37 27.029999999999998 18.509999999999998 140-144 26.095000000000002 27.925 27.089999999999996 18.89 145-149 26.845000000000002 28.13 26.515 18.509999999999998 150-151 26.5125 27.712500000000002 26.674999999999997 19.1 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 1.0 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 2.0 19 1.5 20 1.0 21 3.5 22 3.0 23 2.0 24 5.0 25 5.5 26 3.5 27 7.0 28 11.5 29 15.0 30 22.5 31 27.0 32 32.5 33 43.0 34 49.0 35 68.5 36 97.5 37 118.5 38 141.0 39 168.5 40 206.0 41 246.5 42 263.5 43 260.5 44 253.5 45 270.0 46 269.5 47 248.0 48 228.5 49 196.5 50 165.0 51 129.5 52 91.5 53 69.0 54 52.5 55 37.0 56 32.5 57 30.0 58 26.0 59 16.0 60 11.0 61 8.5 62 6.0 63 5.5 64 7.5 65 6.5 66 4.0 67 2.5 68 2.5 69 2.0 70 1.0 71 0.5 72 1.5 73 2.5 74 1.0 75 1.0 76 1.0 77 0.0 78 0.5 79 0.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 1.0 92 1.0 93 0.0 94 0.0 95 0.5 96 0.5 97 1.5 98 2.0 99 1.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.425 #Duplication Level Percentage of deduplicated Percentage of total 1 97.53656658968437 95.025 2 2.412111880934052 4.7 3 0.025660764690787787 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025660764690787787 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.3125 0.0 0.0 0.0 0.0 82-83 0.42500000000000004 0.0 0.0 0.0 0.0 84-85 0.575 0.0 0.0 0.0 0.0 86-87 0.7375 0.0 0.0 0.0 0.0 88-89 0.9375 0.0 0.0 0.0 0.0 90-91 1.1875 0.0 0.0 0.0 0.0 92-93 1.4625 0.0 0.0 0.0 0.0 94-95 1.75 0.0 0.0 0.0 0.0 96-97 2.1624999999999996 0.0 0.0 0.0 0.0 98-99 2.65 0.0 0.0 0.0 0.0 100-101 3.1875 0.0 0.0 0.0 0.0 102-103 3.5875000000000004 0.0 0.0 0.0 0.0 104-105 4.075 0.0 0.0 0.0 0.0 106-107 4.4375 0.0 0.0 0.0 0.0 108-109 5.0875 0.0 0.0 0.0 0.0 110-111 5.675000000000001 0.0 0.0 0.0 0.0 112-113 6.2125 0.0 0.0 0.0 0.0 114-115 6.9375 0.0 0.0 0.0 0.0 116-117 7.637499999999999 0.0 0.0 0.0 0.0 118-119 8.4875 0.0 0.0 0.0 0.0 120-121 9.274999999999999 0.0 0.0 0.0 0.0 122-123 10.2375 0.0 0.0 0.0 0.0 124-125 10.9625 0.0 0.0 0.0 0.0 126-127 11.875 0.0 0.0 0.0 0.0 128-129 12.725000000000001 0.0 0.0 0.0 0.0 130-131 13.524999999999999 0.0 0.0 0.0 0.0 132-133 14.2875 0.0 0.0 0.0 0.0 134-135 15.287500000000001 0.0 0.0 0.0 0.0 136-137 16.4 0.0 0.0 0.0 0.0 138-139 17.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAAACC 10 0.006830828 145.0 9 CTGAAAC 10 0.006830828 145.0 3 >>END_MODULE Read 1078546 spots for SRR28623251.sra Written 1078546 spots for SRR28623251.sra Read 1078546 spots for SRR28623251.sra Written 1078546 spots for SRR28623251.sra Read 1078546 spots for SRR28623251.sra Written 1078546 spots for SRR28623251.sra Read 1078546 spots for SRR28623251.sra Written 1078546 spots for SRR28623251.sra Read 1078546 spots for SRR28623251.sra Written 1078546 spots for SRR28623251.sra Read 1078546 spots for SRR28623251.sra Written 1078546 spots for SRR28623251.sra Read 1078546 spots for SRR28623251.sra Written 1078546 spots for SRR28623251.sra Read 1078546 spots for SRR28623251.sra Written 1078546 spots for SRR28623251.sra Read 1078546 spots for SRR28623251.sra Written 1078546 spots for SRR28623251.sra Read 1078556 spots for SRR28623251.sra Written 1078556 spots for SRR28623251.sra Read 1078546 spots for SRR28623251.sra Written 1078546 spots for SRR28623251.sra Read 1078546 spots for SRR28623251.sra Written 1078546 spots for SRR28623251.sra Read 1078546 spots for SRR28623251.sra Written 1078546 spots for SRR28623251.sra Read 1078546 spots for SRR28623251.sra Written 1078546 spots for SRR28623251.sra Read 1078546 spots for SRR28623251.sra Written 1078546 spots for SRR28623251.sra Read 1078546 spots for SRR28623251.sra Written 1078546 spots for SRR28623251.sra Read 1078546 spots for SRR28623251.sra Written 1078546 spots for SRR28623251.sra Read 1078546 spots for SRR28623251.sra Written 1078546 spots for SRR28623251.sra Read 1078546 spots for SRR28623251.sra Written 1078546 spots for SRR28623251.sra Read 1078546 spots for SRR28623251.sra Written 1078546 spots for SRR28623251.sra SRR ids: ['SRR28623251.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kziy0pdg SRR28623251.sra spots: 21570930 blocks: [[1, 1078546], [1078547, 2157092], [2157093, 3235638], [3235639, 4314184], [4314185, 5392730], [5392731, 6471276], [6471277, 7549822], [7549823, 8628368], [8628369, 9706914], [9706915, 10785460], [10785461, 11864006], [11864007, 12942552], [12942553, 14021098], [14021099, 15099644], [15099645, 16178190], [16178191, 17256736], [17256737, 18335282], [18335283, 19413828], [19413829, 20492374], [20492375, 21570930]] SRR28623251 file size 7961640 SRR28623251 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623251 SRR28623251_1.fastq SRR28623251_2.fastq Input file: SRR28623251_1.fastq Paired file: SRR28623251_2.fastq trimmed: SRR28623251-trimmed-pair1.fastq, SRR28623251-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:01:02 2025 >> started Tue Feb 11 12:01:28 2025 >> done (26.097s) 21570930 read pairs processed; of these: 40 ( 0.00%) short read pairs filtered out after trimming by size control 9056 ( 0.04%) empty read pairs filtered out after trimming by size control 21561834 (99.96%) read pairs available; of these: 5135942 (23.82%) trimmed read pairs available after processing 16425892 (76.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 3 0.00% 21 4 0.00% 22 0 0.00% 23 6 0.00% 24 3 0.00% 25 5 0.00% 26 8 0.00% 27 7 0.00% 28 5 0.00% 29 5 0.00% 30 7 0.00% 31 10 0.00% 32 12 0.00% 33 16 0.00% 34 22 0.00% 35 23 0.00% 36 30 0.00% 37 32 0.00% 38 41 0.00% 39 40 0.00% 40 54 0.00% 41 49 0.00% 42 90 0.00% 43 97 0.00% 44 83 0.00% 45 115 0.00% 46 103 0.00% 47 142 0.00% 48 168 0.00% 49 222 0.00% 50 262 0.00% 51 307 0.00% 52 324 0.00% 53 361 0.00% 54 387 0.00% 55 426 0.00% 56 471 0.00% 57 576 0.00% 58 689 0.00% 59 790 0.00% 60 942 0.00% 61 1065 0.00% 62 1231 0.01% 63 1431 0.01% 64 1566 0.01% 65 1779 0.01% 66 2039 0.01% 67 2315 0.01% 68 2443 0.01% 69 2885 0.01% 70 3296 0.02% 71 3858 0.02% 72 4382 0.02% 73 5020 0.02% 74 5654 0.03% 75 6619 0.03% 76 7232 0.03% 77 7880 0.04% 78 8836 0.04% 79 10058 0.05% 80 10949 0.05% 81 12172 0.06% 82 13829 0.06% 83 15506 0.07% 84 17059 0.08% 85 18965 0.09% 86 20400 0.09% 87 21899 0.10% 88 23390 0.11% 89 25311 0.12% 90 26922 0.12% 91 29446 0.14% 92 31075 0.14% 93 33907 0.16% 94 36509 0.17% 95 38643 0.18% 96 41538 0.19% 97 43794 0.20% 98 45422 0.21% 99 47191 0.22% 100 48935 0.23% 101 50341 0.23% 102 52805 0.24% 103 56385 0.26% 104 58193 0.27% 105 60626 0.28% 106 63664 0.30% 107 65163 0.30% 108 66553 0.31% 109 68713 0.32% 110 68811 0.32% 111 71018 0.33% 112 72737 0.34% 113 74713 0.35% 114 76018 0.35% 115 79227 0.37% 116 81635 0.38% 117 82959 0.38% 118 84783 0.39% 119 85608 0.40% 120 86723 0.40% 121 87882 0.41% 122 87873 0.41% 123 89639 0.42% 124 91883 0.43% 125 92739 0.43% 126 94605 0.44% 127 96716 0.45% 128 97694 0.45% 129 98202 0.46% 130 99739 0.46% 131 98988 0.46% 132 100215 0.46% 133 100445 0.47% 134 100238 0.46% 135 102429 0.48% 136 102152 0.47% 137 104011 0.48% 138 105227 0.49% 139 105979 0.49% 140 105958 0.49% 141 107091 0.50% 142 106446 0.49% 143 106107 0.49% 144 107266 0.50% 145 107234 0.50% 146 106527 0.49% 147 108299 0.50% 148 109214 0.51% 149 109150 0.51% 150 109927 0.51% 151 16425892 76.18% 21561834 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=13.15 fanout-score-rank=12 prefix-density=0.11 prefix-fanout=13.1 sequence=GGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATCGCAATCTCG criterion=fanout-score sequence-density=0.06 sequence-density-rank=26 fanout-score=82.97 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=17.1 sequence=CCTTCTTCACAAT criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=11.43 fanout-score-rank=17 prefix-density=0.14 prefix-fanout=11.4 sequence=GAGAGAGAGAGTTAAGACAATGGCCTCGAAGAAATCTGCAATCGTATTACCTGGTTCAAAGGTGTTGAAGCACATAGTTTTTGTACGGTTTAATGATGGGATCACTGATGAACAAATTGAGAA criterion=fanout-score sequence-density=0.08 sequence-density-rank=13 fanout-score=335.62 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=28.6 sequence=AAGAAGAAGAAA SRR28623251 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:02:10 Started mapping on | Feb 11 12:02:10 Finished on | Feb 11 12:04:16 Mapping speed, Million of reads per hour | 616.05 Number of input reads | 21561834 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 20267555 Uniquely mapped reads % | 94.00% Average mapped length | 287.09 Number of splices: Total | 17760368 Number of splices: Annotated (sjdb) | 17299219 Number of splices: GT/AG | 17440596 Number of splices: GC/AG | 244399 Number of splices: AT/AC | 19426 Number of splices: Non-canonical | 55947 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 3.00 Insertion rate per base | 0.03% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 504366 % of reads mapped to multiple loci | 2.34% Number of reads mapped to too many loci | 164944 % of reads mapped to too many loci | 0.76% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.63% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 789913 789913 789913 N_multimapping 504366 504366 504366 N_noFeature 956648 19999085 1107949 N_ambiguous 229441 1756 111012 UnstrandedReadsAssigned:19081466 PositiveStrandReadsAssigned:266714 NegativeStrandReadsAssigned:19048594 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=142 echo kmer=137 SRR28623251 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623251-trimmed-pair1.fastq SRR28623251-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,561,834 reads, 19,300,867 reads pseudoaligned [quant] estimated average fragment length: 205.149 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,149 rounds 52401 SRR28623251.ke.tsv 34699 SRR28623251.se.tsv 87100 total ==> SRR28623251.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1813.85 1293 35.4662 Potri.005G024800.1.v4.1 1035 830.851 802 48.0251 Potri.004G059700.1.v4.1 961 756.88 220 14.4615 Potri.007G009000.2.v4.1 1416 1211.85 0 0 Potri.003G141000.2.v4.1 2943 2738.85 615.177 11.175 Potri.016G087400.1.v4.1 270 102.557 1528.55 741.538 Potri.015G069301.1.v4.1 564 363.384 0 0 Potri.010G195200.1.v4.1 1773 1568.85 39 1.2368 Potri.012G127500.1.v4.1 977 772.875 10162 654.165 ==> SRR28623251.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1219 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 435 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 18 Potri.001G452600.v4.1 9 SRR28623251 completed mapping pipeline successfully