Starting /dee2/code/volunteer_pipeline.sh SRR28623252 current disk space = 3052083453952 free memory = 1437967240 SRR28623252 SRAfilesize e542a9c0c8d74e511988e4edd1d8bebb SRR28623252.sra SRR28623252.sra file validated SRR28623252 is paired end SRR28623252 is conventional basespace SRR28623252 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623252_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4485 37.0 37.0 37.0 37.0 37.0 2 36.491 37.0 37.0 37.0 37.0 37.0 3 36.552 37.0 37.0 37.0 37.0 37.0 4 36.6335 37.0 37.0 37.0 37.0 37.0 5 36.6395 37.0 37.0 37.0 37.0 37.0 6 36.657 37.0 37.0 37.0 37.0 37.0 7 36.5225 37.0 37.0 37.0 37.0 37.0 8 36.4345 37.0 37.0 37.0 37.0 37.0 9 36.4995 37.0 37.0 37.0 37.0 37.0 10-14 36.5538 37.0 37.0 37.0 37.0 37.0 15-19 36.58820000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.5551 37.0 37.0 37.0 37.0 37.0 25-29 36.4808 37.0 37.0 37.0 37.0 37.0 30-34 36.4519 37.0 37.0 37.0 37.0 37.0 35-39 36.416700000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.3732 37.0 37.0 37.0 37.0 37.0 45-49 36.3664 37.0 37.0 37.0 37.0 37.0 50-54 36.2697 37.0 37.0 37.0 37.0 37.0 55-59 36.2638 37.0 37.0 37.0 37.0 37.0 60-64 36.2907 37.0 37.0 37.0 37.0 37.0 65-69 36.2478 37.0 37.0 37.0 37.0 37.0 70-74 36.1583 37.0 37.0 37.0 37.0 37.0 75-79 36.1266 37.0 37.0 37.0 37.0 37.0 80-84 36.0572 37.0 37.0 37.0 37.0 37.0 85-89 36.0763 37.0 37.0 37.0 37.0 37.0 90-94 36.0004 37.0 37.0 37.0 37.0 37.0 95-99 35.9356 37.0 37.0 37.0 37.0 37.0 100-104 35.951 37.0 37.0 37.0 37.0 37.0 105-109 35.9928 37.0 37.0 37.0 37.0 37.0 110-114 35.8164 37.0 37.0 37.0 37.0 37.0 115-119 35.866299999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.719 37.0 37.0 37.0 37.0 37.0 125-129 35.5858 37.0 37.0 37.0 37.0 37.0 130-134 35.7958 37.0 37.0 37.0 37.0 37.0 135-139 35.6898 37.0 37.0 37.0 37.0 37.0 140-144 35.415499999999994 37.0 37.0 37.0 37.0 37.0 145-149 35.3188 37.0 37.0 37.0 34.6 37.0 150-151 35.14575 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 2.0 24 2.0 25 6.0 26 11.0 27 9.0 28 14.0 29 24.0 30 29.0 31 36.0 32 66.0 33 86.0 34 158.0 35 389.0 36 2927.0 37 239.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.00200601805417 13.039117352056168 10.481444332998997 42.47743229689067 2 18.3 15.45 36.475 29.775000000000002 3 17.525 18.325 29.049999999999997 35.099999999999994 4 22.725 25.074999999999996 25.775 26.424999999999997 5 24.875 29.825000000000003 25.825 19.475 6 21.125 35.75 23.65 19.475 7 15.475 28.625 39.550000000000004 16.35 8 18.925 28.625 32.05 20.4 9 16.525000000000002 24.175 35.525 23.775 10-14 18.695 30.714999999999996 28.025 22.564999999999998 15-19 19.7 28.71 28.065 23.525 20-24 19.09 28.689999999999998 28.355000000000004 23.865 25-29 19.89 28.910000000000004 27.85 23.35 30-34 19.21 29.744999999999997 27.295 23.75 35-39 19.36 29.235 27.884999999999998 23.52 40-44 19.38 29.25 28.08 23.29 45-49 19.52 29.15 27.084999999999997 24.245 50-54 19.650000000000002 28.625 27.794999999999998 23.93 55-59 19.78 28.689999999999998 27.975 23.555 60-64 19.6 28.68 27.82 23.9 65-69 19.625 28.455000000000002 28.13 23.79 70-74 19.46 29.175 27.67 23.695 75-79 19.895 28.875 27.96 23.27 80-84 19.71 29.005 27.455000000000002 23.830000000000002 85-89 20.244999999999997 28.854999999999997 27.775 23.125 90-94 20.080000000000002 29.360000000000003 27.29 23.27 95-99 20.630000000000003 28.84 27.315 23.215 100-104 20.54 28.975 26.76 23.724999999999998 105-109 19.755 29.335 27.355 23.555 110-114 21.044999999999998 28.84 26.6 23.515 115-119 20.474999999999998 28.694999999999997 27.284999999999997 23.544999999999998 120-124 20.485 28.64 27.060000000000002 23.815 125-129 20.669999999999998 29.255 26.840000000000003 23.235 130-134 21.535 27.93 26.68 23.855 135-139 20.925 28.305000000000003 27.05 23.72 140-144 20.76 28.15 26.93 24.16 145-149 20.835 28.035 26.6 24.529999999999998 150-151 20.225 28.225 27.1375 24.4125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 1.0 22 1.0 23 1.5 24 5.0 25 5.0 26 5.5 27 9.5 28 14.0 29 20.0 30 30.0 31 43.0 32 45.5 33 49.5 34 61.0 35 85.0 36 108.0 37 117.0 38 145.5 39 177.0 40 194.0 41 205.5 42 223.0 43 243.0 44 275.5 45 281.0 46 268.5 47 257.5 48 217.0 49 185.5 50 149.0 51 117.0 52 106.0 53 87.5 54 71.5 55 52.5 56 26.0 57 21.0 58 23.0 59 18.5 60 14.5 61 10.5 62 6.5 63 4.5 64 4.5 65 4.0 66 2.5 67 0.5 68 1.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.325 #Duplication Level Percentage of deduplicated Percentage of total 1 84.28698487992885 71.075 2 13.311592054550845 22.45 3 2.016009487103469 5.1 4 0.3261191817373258 1.0999999999999999 5 0.029647198339756892 0.125 6 0.029647198339756892 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAGATTACTCCAGCCCATCCCCAGCCACACCCCTCAATACGTGCAAAA 6 0.15 No Hit GCTAACACCAATTTTCCAGCCCAAGTATTAGGTTTTATTTTTCCCGAACA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.44999999999999996 0.0 0.0 0.0 0.0 86-87 0.5625 0.0 0.0 0.0 0.0 88-89 0.6875 0.0 0.0 0.0 0.0 90-91 0.8500000000000001 0.0 0.0 0.0 0.0 92-93 0.9874999999999999 0.0 0.0 0.0 0.0 94-95 1.2375 0.0 0.0 0.0 0.0 96-97 1.4 0.0 0.0 0.0 0.0 98-99 1.8 0.0 0.0 0.0 0.0 100-101 2.125 0.0 0.0 0.0 0.0 102-103 2.4375 0.0 0.0 0.0 0.0 104-105 2.9875 0.0 0.0 0.0 0.0 106-107 3.5 0.0 0.0 0.0 0.0 108-109 3.9875 0.0 0.0 0.0 0.0 110-111 4.3875 0.0 0.0 0.0 0.0 112-113 4.85 0.0 0.0 0.0 0.0 114-115 5.275 0.0 0.0 0.0 0.0 116-117 5.65 0.0 0.0 0.0 0.0 118-119 6.2875 0.0 0.0 0.0 0.0 120-121 7.0875 0.0 0.0 0.0 0.0 122-123 7.9625 0.0 0.0 0.0 0.0 124-125 8.587499999999999 0.0 0.0 0.0 0.0 126-127 9.3 0.0 0.0 0.0 0.0 128-129 10.0 0.0 0.0 0.0 0.0 130-131 10.8375 0.0 0.0 0.0 0.0 132-133 11.475 0.0 0.0 0.0 0.0 134-135 12.1875 0.0 0.0 0.0 0.0 136-137 12.925 0.0 0.0 0.0 0.0 138-139 13.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCGTGC 10 0.006830828 145.0 6 TCATTTG 10 0.006830828 145.0 7 TGAACTC 60 4.3742658E-4 48.333332 145 ACGTCTG 75 0.0012377208 13.533334 140-144 GTCTGAA 65 0.0076375785 13.384615 140-144 CTGAACT 65 0.0076375785 13.384615 140-144 TCTGAAC 65 0.0076375785 13.384615 140-144 AGCACAC 90 0.0048656333 11.277777 135-139 >>END_MODULE SRR28623252 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623252_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.894 37.0 37.0 37.0 37.0 37.0 2 36.395 37.0 37.0 37.0 37.0 37.0 3 36.1175 37.0 37.0 37.0 37.0 37.0 4 36.245 37.0 37.0 37.0 37.0 37.0 5 36.308 37.0 37.0 37.0 37.0 37.0 6 36.2245 37.0 37.0 37.0 37.0 37.0 7 36.296 37.0 37.0 37.0 37.0 37.0 8 36.236 37.0 37.0 37.0 37.0 37.0 9 36.174 37.0 37.0 37.0 37.0 37.0 10-14 36.2124 37.0 37.0 37.0 37.0 37.0 15-19 36.181400000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.205799999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.131600000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.017 37.0 37.0 37.0 37.0 37.0 35-39 36.0236 37.0 37.0 37.0 37.0 37.0 40-44 35.947700000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.0101 37.0 37.0 37.0 37.0 37.0 50-54 35.947 37.0 37.0 37.0 37.0 37.0 55-59 35.8064 37.0 37.0 37.0 37.0 37.0 60-64 35.8206 37.0 37.0 37.0 37.0 37.0 65-69 35.8851 37.0 37.0 37.0 37.0 37.0 70-74 35.84259999999999 37.0 37.0 37.0 37.0 37.0 75-79 35.8552 37.0 37.0 37.0 37.0 37.0 80-84 35.8337 37.0 37.0 37.0 37.0 37.0 85-89 35.7405 37.0 37.0 37.0 37.0 37.0 90-94 35.6891 37.0 37.0 37.0 37.0 37.0 95-99 35.6225 37.0 37.0 37.0 37.0 37.0 100-104 35.536500000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.565099999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.5549 37.0 37.0 37.0 37.0 37.0 115-119 35.5068 37.0 37.0 37.0 37.0 37.0 120-124 35.51100000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.0683 37.0 37.0 37.0 32.2 37.0 130-134 35.3534 37.0 37.0 37.0 34.6 37.0 135-139 35.1005 37.0 37.0 37.0 29.8 37.0 140-144 35.1625 37.0 37.0 37.0 29.8 37.0 145-149 35.1802 37.0 37.0 37.0 34.6 37.0 150-151 34.69175 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 5.0 14 4.0 15 4.0 16 5.0 17 1.0 18 1.0 19 0.0 20 2.0 21 11.0 22 9.0 23 3.0 24 10.0 25 13.0 26 6.0 27 11.0 28 18.0 29 21.0 30 21.0 31 37.0 32 61.0 33 114.0 34 221.0 35 589.0 36 2534.0 37 297.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.2 20.974999999999998 12.275 26.55 2 26.75 26.025 29.9 17.325 3 22.3 27.55 31.525 18.625 4 26.0 32.35 23.599999999999998 18.05 5 25.4 35.5 22.725 16.375 6 21.0 38.275 23.125 17.599999999999998 7 21.15 20.9 38.574999999999996 19.375 8 22.725 25.55 28.95 22.775000000000002 9 22.925 25.474999999999998 28.975 22.625 10-14 24.27 29.435 26.16 20.135 15-19 23.91 27.389999999999997 28.23 20.47 20-24 23.93 28.29 27.034999999999997 20.745 25-29 23.16 27.705000000000002 27.845 21.29 30-34 21.8 28.475 29.205 20.52 35-39 23.335 28.58 28.225 19.86 40-44 23.79 28.785 27.46 19.965 45-49 23.505000000000003 28.060000000000002 29.099999999999998 19.335 50-54 23.200000000000003 29.025000000000002 28.09 19.685 55-59 23.035 28.335 28.57 20.06 60-64 23.645 28.155 28.275 19.925 65-69 23.474999999999998 28.585 28.595 19.345000000000002 70-74 24.09 28.4 27.26 20.25 75-79 22.355 28.694999999999997 28.93 20.02 80-84 23.825 28.76 27.495000000000005 19.919999999999998 85-89 23.565 28.494999999999997 28.144999999999996 19.794999999999998 90-94 23.84 28.275 28.249999999999996 19.634999999999998 95-99 23.31 28.465 27.525 20.7 100-104 24.104999999999997 28.43 27.455000000000002 20.01 105-109 24.279999999999998 28.43 27.655 19.634999999999998 110-114 24.7 28.535 27.250000000000004 19.515 115-119 24.575 28.725 26.805 19.895 120-124 24.775 28.725 27.68 18.82 125-129 25.47 28.799999999999997 26.93 18.8 130-134 26.21 28.68 26.795 18.315 135-139 25.919999999999998 27.97 27.055 19.055 140-144 26.435 28.02 26.784999999999997 18.759999999999998 145-149 26.735 27.810000000000002 26.655 18.8 150-151 26.75 27.900000000000002 27.1 18.25 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 1.0 14 2.0 15 2.5 16 1.0 17 2.5 18 2.5 19 2.0 20 3.0 21 1.5 22 1.0 23 0.5 24 2.0 25 5.0 26 5.5 27 8.5 28 11.0 29 11.5 30 13.0 31 21.0 32 33.5 33 38.5 34 55.0 35 78.0 36 98.0 37 128.0 38 148.0 39 176.0 40 205.5 41 216.0 42 242.0 43 259.5 44 264.5 45 287.0 46 284.5 47 256.0 48 235.0 49 198.0 50 161.0 51 124.0 52 90.5 53 71.5 54 50.5 55 40.5 56 29.5 57 24.0 58 25.0 59 18.5 60 12.5 61 11.5 62 8.0 63 2.5 64 2.0 65 2.0 66 1.5 67 2.0 68 2.0 69 1.0 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.5 76 2.0 77 1.5 78 0.0 79 1.0 80 1.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.95 #Duplication Level Percentage of deduplicated Percentage of total 1 85.22660388463802 72.39999999999999 2 12.477928193054739 21.2 3 1.883460859329017 4.8 4 0.3237198351971748 1.0999999999999999 5 0.02942907592701589 0.125 6 0.02942907592701589 0.15 7 0.0 0.0 8 0.0 0.0 9 0.02942907592701589 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit ATTTTTGTCACAAGATCTCGCAGCTGGTCTTTTGTTGAACGTCCTGGATT 6 0.15 No Hit CTTGGCTCGGCTTCACTTGCAGCTGTCACTGTTGTTGCTGTAGTATTGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.44999999999999996 0.0 0.0 0.0 0.0 86-87 0.5625 0.0 0.0 0.0 0.0 88-89 0.6875 0.0 0.0 0.0 0.0 90-91 0.8500000000000001 0.0 0.0 0.0 0.0 92-93 0.9874999999999999 0.0 0.0 0.0 0.0 94-95 1.2375 0.0 0.0 0.0 0.0 96-97 1.4 0.0 0.0 0.0 0.0 98-99 1.8 0.0 0.0 0.0 0.0 100-101 2.1375 0.0 0.0 0.0 0.0 102-103 2.475 0.0 0.0 0.0 0.0 104-105 3.025 0.0 0.0 0.0 0.0 106-107 3.5374999999999996 0.0 0.0 0.0 0.0 108-109 4.0125 0.0 0.0 0.0 0.0 110-111 4.425 0.0 0.0 0.0 0.0 112-113 4.9 0.0 0.0 0.0 0.0 114-115 5.324999999999999 0.0 0.0 0.0 0.0 116-117 5.7 0.0 0.0 0.0 0.0 118-119 6.375 0.0 0.0 0.0 0.0 120-121 7.175 0.0 0.0 0.0 0.0 122-123 8.0375 0.0 0.0 0.0 0.0 124-125 8.662500000000001 0.0 0.0 0.0 0.0 126-127 9.45 0.0 0.0 0.0 0.0 128-129 10.175 0.0 0.0 0.0 0.0 130-131 11.0375 0.0 0.0 0.0 0.0 132-133 11.65 0.0 0.0 0.0 0.0 134-135 12.3625 0.0 0.0 0.0 0.0 136-137 13.1125 0.0 0.0 0.0 0.0 138-139 14.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTGAGT 10 0.006830828 145.0 6 AGGGAAA 60 4.3742658E-4 48.333332 145 TAGGGAA 60 0.004491891 14.500001 140-144 GTGTAGG 75 0.0012377208 13.533334 140-144 CGTGTAG 75 0.0012377208 13.533334 140-144 GTAGGGA 65 0.0076375785 13.384615 140-144 AGCGTCG 85 0.0031733946 11.941176 135-139 >>END_MODULE Read 1877588 spots for SRR28623252.sra Written 1877588 spots for SRR28623252.sra Read 1877588 spots for SRR28623252.sra Written 1877588 spots for SRR28623252.sra Read 1877588 spots for SRR28623252.sra Written 1877588 spots for SRR28623252.sra Read 1877588 spots for SRR28623252.sra Written 1877588 spots for SRR28623252.sra Read 1877588 spots for SRR28623252.sra Written 1877588 spots for SRR28623252.sra Read 1877588 spots for SRR28623252.sra Written 1877588 spots for SRR28623252.sra Read 1877588 spots for SRR28623252.sra Written 1877588 spots for SRR28623252.sra Read 1877588 spots for SRR28623252.sra Written 1877588 spots for SRR28623252.sra Read 1877588 spots for SRR28623252.sra Written 1877588 spots for SRR28623252.sra Read 1877588 spots for SRR28623252.sra Written 1877588 spots for SRR28623252.sra Read 1877588 spots for SRR28623252.sra Written 1877588 spots for SRR28623252.sra Read 1877588 spots for SRR28623252.sra Written 1877588 spots for SRR28623252.sra Read 1877588 spots for SRR28623252.sra Written 1877588 spots for SRR28623252.sra Read 1877588 spots for SRR28623252.sra Written 1877588 spots for SRR28623252.sra Read 1877588 spots for SRR28623252.sra Written 1877588 spots for SRR28623252.sra Read 1877588 spots for SRR28623252.sra Written 1877588 spots for SRR28623252.sra Read 1877588 spots for SRR28623252.sra Written 1877588 spots for SRR28623252.sra Read 1877588 spots for SRR28623252.sra Written 1877588 spots for SRR28623252.sra Read 1877599 spots for SRR28623252.sra Written 1877599 spots for SRR28623252.sra Read 1877588 spots for SRR28623252.sra Written 1877588 spots for SRR28623252.sra SRR ids: ['SRR28623252.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bdblfzn5 SRR28623252.sra spots: 37551771 blocks: [[1, 1877588], [1877589, 3755176], [3755177, 5632764], [5632765, 7510352], [7510353, 9387940], [9387941, 11265528], [11265529, 13143116], [13143117, 15020704], [15020705, 16898292], [16898293, 18775880], [18775881, 20653468], [20653469, 22531056], [22531057, 24408644], [24408645, 26286232], [26286233, 28163820], [28163821, 30041408], [30041409, 31918996], [31918997, 33796584], [33796585, 35674172], [35674173, 37551771]] SRR28623252 file size 13868119 SRR28623252 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623252 SRR28623252_1.fastq SRR28623252_2.fastq Input file: SRR28623252_1.fastq Paired file: SRR28623252_2.fastq trimmed: SRR28623252-trimmed-pair1.fastq, SRR28623252-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 11:24:28 2025 >> started Tue Feb 11 11:25:26 2025 >> done (57.817s) 37551771 read pairs processed; of these: 33 ( 0.00%) short read pairs filtered out after trimming by size control 25945 ( 0.07%) empty read pairs filtered out after trimming by size control 37525793 (99.93%) read pairs available; of these: 6795768 (18.11%) trimmed read pairs available after processing 30730025 (81.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 4 0.00% 21 2 0.00% 22 4 0.00% 23 5 0.00% 24 8 0.00% 25 8 0.00% 26 9 0.00% 27 14 0.00% 28 10 0.00% 29 11 0.00% 30 17 0.00% 31 19 0.00% 32 24 0.00% 33 26 0.00% 34 25 0.00% 35 35 0.00% 36 32 0.00% 37 38 0.00% 38 54 0.00% 39 47 0.00% 40 64 0.00% 41 74 0.00% 42 62 0.00% 43 103 0.00% 44 106 0.00% 45 118 0.00% 46 131 0.00% 47 132 0.00% 48 194 0.00% 49 236 0.00% 50 236 0.00% 51 276 0.00% 52 343 0.00% 53 411 0.00% 54 403 0.00% 55 463 0.00% 56 496 0.00% 57 561 0.00% 58 690 0.00% 59 815 0.00% 60 960 0.00% 61 1090 0.00% 62 1256 0.00% 63 1422 0.00% 64 1613 0.00% 65 1797 0.00% 66 2110 0.01% 67 2377 0.01% 68 2638 0.01% 69 3022 0.01% 70 3484 0.01% 71 3981 0.01% 72 4532 0.01% 73 5363 0.01% 74 5769 0.02% 75 6743 0.02% 76 7822 0.02% 77 8207 0.02% 78 9347 0.02% 79 10634 0.03% 80 11736 0.03% 81 13157 0.04% 82 14834 0.04% 83 16360 0.04% 84 18633 0.05% 85 20765 0.06% 86 22607 0.06% 87 24552 0.07% 88 26291 0.07% 89 28379 0.08% 90 30851 0.08% 91 33189 0.09% 92 35815 0.10% 93 38283 0.10% 94 42075 0.11% 95 44677 0.12% 96 47930 0.13% 97 50583 0.13% 98 53020 0.14% 99 56176 0.15% 100 59051 0.16% 101 61198 0.16% 102 64096 0.17% 103 67715 0.18% 104 70840 0.19% 105 74391 0.20% 106 77682 0.21% 107 80171 0.21% 108 83537 0.22% 109 85064 0.23% 110 86988 0.23% 111 90160 0.24% 112 92884 0.25% 113 94744 0.25% 114 97325 0.26% 115 101674 0.27% 116 103701 0.28% 117 107035 0.29% 118 110718 0.30% 119 111292 0.30% 120 113887 0.30% 121 116497 0.31% 122 115882 0.31% 123 118904 0.32% 124 122380 0.33% 125 123946 0.33% 126 126723 0.34% 127 130134 0.35% 128 131255 0.35% 129 132752 0.35% 130 135242 0.36% 131 135818 0.36% 132 137834 0.37% 133 139301 0.37% 134 140010 0.37% 135 142205 0.38% 136 142267 0.38% 137 146363 0.39% 138 147513 0.39% 139 149983 0.40% 140 150116 0.40% 141 151723 0.40% 142 152853 0.41% 143 151814 0.40% 144 154412 0.41% 145 154409 0.41% 146 154953 0.41% 147 156825 0.42% 148 158422 0.42% 149 158749 0.42% 150 161936 0.43% 151 30730025 81.89% 37525793 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=13.10 fanout-score-rank=13 prefix-density=0.13 prefix-fanout=13.1 sequence=GGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCTACGTTATCTCGTATGCCGTCTTCTGCTTGAAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=17 fanout-score=368.32 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=23.6 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=16.74 fanout-score-rank=15 prefix-density=0.14 prefix-fanout=13.8 sequence=GAGAGAGAGAGTTAAGACAATGGCCTCGAAGAAATCTGCAATCGTATTACCTGGTTCAAAGGTGTTGAAGCACATAGTTTTTGTACGGTTTAATGATGGGATCACTGATGAACAAATTGAGAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=10 fanout-score=342.65 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=27.1 sequence=AAGAAGAAGAAA SRR28623252 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 11:26:53 Started mapping on | Feb 11 11:26:54 Finished on | Feb 11 11:30:27 Mapping speed, Million of reads per hour | 634.24 Number of input reads | 37525793 Average input read length | 284 UNIQUE READS: Uniquely mapped reads number | 30154850 Uniquely mapped reads % | 80.36% Average mapped length | 286.16 Number of splices: Total | 27311909 Number of splices: Annotated (sjdb) | 26655013 Number of splices: GT/AG | 26830885 Number of splices: GC/AG | 359138 Number of splices: AT/AC | 25156 Number of splices: Non-canonical | 96730 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.04% Deletion average length | 2.89 Insertion rate per base | 0.03% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 868431 % of reads mapped to multiple loci | 2.31% Number of reads mapped to too many loci | 214403 % of reads mapped to too many loci | 0.57% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 16.52% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 6502512 6502512 6502512 N_multimapping 868431 868431 868431 N_noFeature 1185261 29797951 1345177 N_ambiguous 594262 5951 392753 UnstrandedReadsAssigned:28375327 PositiveStrandReadsAssigned:350948 NegativeStrandReadsAssigned:28416920 Dataset is classified negative stranded MeadianReadLen=143 20thPercentileLength=143 echo kmer=139 SRR28623252 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623252-trimmed-pair1.fastq SRR28623252-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,525,793 reads, 33,673,270 reads pseudoaligned [quant] estimated average fragment length: 210.742 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,078 rounds 52401 SRR28623252.ke.tsv 34699 SRR28623252.se.tsv 87100 total ==> SRR28623252.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1808.26 2078 34.4194 Potri.005G024800.1.v4.1 1035 825.258 2297 83.3661 Potri.004G059700.1.v4.1 961 751.268 96 3.82732 Potri.007G009000.2.v4.1 1416 1206.26 0 0 Potri.003G141000.2.v4.1 2943 2733.26 944.162 10.3463 Potri.016G087400.1.v4.1 270 102.083 2837.64 832.571 Potri.015G069301.1.v4.1 564 358.066 0 0 Potri.010G195200.1.v4.1 1773 1563.26 49 0.938823 Potri.012G127500.1.v4.1 977 767.268 7956 310.574 ==> SRR28623252.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1626 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 503 Potri.001G212900.v4.1 32 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR28623252 completed mapping pipeline successfully