Starting /dee2/code/volunteer_pipeline.sh SRR28623253 current disk space = 3051447263232 free memory = 1475117016 SRR28623253 SRAfilesize 0b82e6abda3ba7c42392c50e69b33b1d SRR28623253.sra SRR28623253.sra file validated SRR28623253 is paired end SRR28623253 is conventional basespace SRR28623253 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623253_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9515 37.0 37.0 37.0 37.0 37.0 2 36.3565 37.0 37.0 37.0 37.0 37.0 3 36.523 37.0 37.0 37.0 37.0 37.0 4 36.535 37.0 37.0 37.0 37.0 37.0 5 36.6155 37.0 37.0 37.0 37.0 37.0 6 36.5615 37.0 37.0 37.0 37.0 37.0 7 36.6075 37.0 37.0 37.0 37.0 37.0 8 36.6485 37.0 37.0 37.0 37.0 37.0 9 36.579 37.0 37.0 37.0 37.0 37.0 10-14 36.5844 37.0 37.0 37.0 37.0 37.0 15-19 36.533100000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.5847 37.0 37.0 37.0 37.0 37.0 25-29 36.507600000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.4557 37.0 37.0 37.0 37.0 37.0 35-39 36.402 37.0 37.0 37.0 37.0 37.0 40-44 36.3907 37.0 37.0 37.0 37.0 37.0 45-49 36.32280000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.299499999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.26049999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.2255 37.0 37.0 37.0 37.0 37.0 65-69 36.1845 37.0 37.0 37.0 37.0 37.0 70-74 36.10510000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.1437 37.0 37.0 37.0 37.0 37.0 80-84 36.0668 37.0 37.0 37.0 37.0 37.0 85-89 36.05499999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.0381 37.0 37.0 37.0 37.0 37.0 95-99 35.9217 37.0 37.0 37.0 37.0 37.0 100-104 35.914500000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.8078 37.0 37.0 37.0 37.0 37.0 110-114 35.8437 37.0 37.0 37.0 37.0 37.0 115-119 35.7416 37.0 37.0 37.0 37.0 37.0 120-124 35.728500000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.543899999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.2712 37.0 37.0 37.0 29.8 37.0 135-139 35.2236 37.0 37.0 37.0 29.8 37.0 140-144 35.043 37.0 37.0 37.0 27.4 37.0 145-149 34.8973 37.0 37.0 37.0 25.0 37.0 150-151 34.09025 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 2.0 23 2.0 24 1.0 25 5.0 26 5.0 27 11.0 28 19.0 29 25.0 30 35.0 31 51.0 32 63.0 33 98.0 34 173.0 35 452.0 36 2902.0 37 155.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.83174762143215 12.518778167250877 9.489233850776165 40.16024036054081 2 17.849999999999998 14.274999999999999 38.725 29.15 3 17.65 19.125 29.15 34.075 4 23.5 25.575 24.075 26.85 5 24.175 33.300000000000004 23.674999999999997 18.85 6 20.375 36.425000000000004 22.5 20.7 7 15.950000000000001 27.025 40.375 16.650000000000002 8 17.424999999999997 26.775 32.25 23.549999999999997 9 18.425 23.849999999999998 33.725 24.0 10-14 20.005 30.475 27.18 22.34 15-19 19.615 28.835 28.37 23.18 20-24 20.7 28.895 27.639999999999997 22.765 25-29 19.915 29.075 27.6 23.41 30-34 20.445 29.304999999999996 27.02 23.23 35-39 20.345 28.92 27.495000000000005 23.24 40-44 20.09 28.720000000000002 27.939999999999998 23.25 45-49 19.43 29.915000000000003 26.995 23.66 50-54 19.945 28.64 28.060000000000002 23.355 55-59 20.225 28.895 27.865000000000002 23.015 60-64 20.630000000000003 28.715000000000003 27.74 22.915 65-69 20.549999999999997 28.52 27.495000000000005 23.435 70-74 20.555 29.015 27.265 23.165 75-79 19.67 28.27 28.315 23.745 80-84 20.22 28.575 27.47 23.735 85-89 20.05 28.605000000000004 27.705000000000002 23.64 90-94 20.294999999999998 28.525 27.589999999999996 23.59 95-99 20.560000000000002 28.705000000000002 27.32 23.415 100-104 20.585 29.580000000000002 26.889999999999997 22.945 105-109 20.97 28.849999999999998 27.105 23.075000000000003 110-114 20.87 28.765 26.99 23.375 115-119 21.490000000000002 28.994999999999997 26.375 23.14 120-124 21.18 29.104999999999997 26.495 23.22 125-129 21.22 28.38 26.51 23.89 130-134 21.135 28.775000000000002 26.265 23.825 135-139 21.349999999999998 28.155 26.05 24.445 140-144 21.13 28.22 26.305 24.345 145-149 20.96 28.685 25.929999999999996 24.425 150-151 19.950000000000003 29.099999999999998 26.2875 24.6625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 0.5 21 1.0 22 2.0 23 2.5 24 4.0 25 5.5 26 4.0 27 7.0 28 16.0 29 23.5 30 22.0 31 25.5 32 38.5 33 47.0 34 56.0 35 67.5 36 93.5 37 117.0 38 145.0 39 174.5 40 183.5 41 208.5 42 253.0 43 273.0 44 266.0 45 248.0 46 248.0 47 240.5 48 214.5 49 205.5 50 171.0 51 133.0 52 106.0 53 84.5 54 76.0 55 58.5 56 42.0 57 37.0 58 30.0 59 19.5 60 13.5 61 10.0 62 6.0 63 4.5 64 4.0 65 1.5 66 1.0 67 1.0 68 1.0 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.52829231159605 97.075 2 1.446333417914235 2.85 3 0.025374270489723422 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.2875 0.0 0.0 0.0 0.0 78-79 0.38749999999999996 0.0 0.0 0.0 0.0 80-81 0.4875 0.0 0.0 0.0 0.0 82-83 0.6375 0.0 0.0 0.0 0.0 84-85 0.775 0.0 0.0 0.0 0.0 86-87 0.9375 0.0 0.0 0.0 0.0 88-89 1.0875 0.0 0.0 0.0 0.0 90-91 1.25 0.0 0.0 0.0 0.0 92-93 1.525 0.0 0.0 0.0 0.0 94-95 1.7999999999999998 0.0 0.0 0.0 0.0 96-97 2.1875 0.0 0.0 0.0 0.0 98-99 2.4625 0.0 0.0 0.0 0.0 100-101 2.775 0.0 0.0 0.0 0.0 102-103 3.1125 0.0 0.0 0.0 0.0 104-105 3.6875 0.0 0.0 0.0 0.0 106-107 4.325 0.0 0.0 0.0 0.0 108-109 4.875 0.0 0.0 0.0 0.0 110-111 5.325 0.0 0.0 0.0 0.0 112-113 5.8625 0.0 0.0 0.0 0.0 114-115 6.65 0.0 0.0 0.0 0.0 116-117 7.475 0.0 0.0 0.0 0.0 118-119 8.3625 0.0 0.0 0.0 0.0 120-121 9.0875 0.0 0.0 0.0 0.0 122-123 9.7875 0.0 0.0 0.0 0.0 124-125 10.600000000000001 0.0 0.0 0.0 0.0 126-127 11.3875 0.0 0.0 0.0 0.0 128-129 12.275 0.0 0.0 0.0 0.0 130-131 13.175 0.0 0.0 0.0 0.0 132-133 14.15 0.0 0.0 0.0 0.0 134-135 15.0125 0.0 0.0 0.0 0.0 136-137 15.9125 0.0 0.0 0.0 0.0 138-139 16.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTTGC 10 0.006830828 145.0 8 ACTCTTG 10 0.006830828 145.0 7 >>END_MODULE SRR28623253 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623253_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.332 37.0 37.0 37.0 37.0 37.0 2 36.4435 37.0 37.0 37.0 37.0 37.0 3 36.4475 37.0 37.0 37.0 37.0 37.0 4 36.4425 37.0 37.0 37.0 37.0 37.0 5 36.44 37.0 37.0 37.0 37.0 37.0 6 36.4 37.0 37.0 37.0 37.0 37.0 7 36.37 37.0 37.0 37.0 37.0 37.0 8 36.36 37.0 37.0 37.0 37.0 37.0 9 36.457 37.0 37.0 37.0 37.0 37.0 10-14 36.312200000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.315 37.0 37.0 37.0 37.0 37.0 20-24 36.285900000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.1605 37.0 37.0 37.0 37.0 37.0 30-34 36.1937 37.0 37.0 37.0 37.0 37.0 35-39 36.1377 37.0 37.0 37.0 37.0 37.0 40-44 36.072500000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.0045 37.0 37.0 37.0 37.0 37.0 50-54 36.028099999999995 37.0 37.0 37.0 37.0 37.0 55-59 35.973 37.0 37.0 37.0 37.0 37.0 60-64 35.9611 37.0 37.0 37.0 37.0 37.0 65-69 35.8925 37.0 37.0 37.0 37.0 37.0 70-74 35.7976 37.0 37.0 37.0 37.0 37.0 75-79 35.8265 37.0 37.0 37.0 37.0 37.0 80-84 35.826499999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.6969 37.0 37.0 37.0 37.0 37.0 90-94 35.7245 37.0 37.0 37.0 37.0 37.0 95-99 35.603 37.0 37.0 37.0 37.0 37.0 100-104 35.544999999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.5809 37.0 37.0 37.0 37.0 37.0 110-114 35.4798 37.0 37.0 37.0 37.0 37.0 115-119 35.439099999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.262 37.0 37.0 37.0 34.6 37.0 125-129 35.3449 37.0 37.0 37.0 37.0 37.0 130-134 35.282199999999996 37.0 37.0 37.0 34.6 37.0 135-139 35.139700000000005 37.0 37.0 37.0 27.4 37.0 140-144 35.1012 37.0 37.0 37.0 27.4 37.0 145-149 34.799 37.0 37.0 37.0 25.0 37.0 150-151 34.4065 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 9.0 14 8.0 15 6.0 16 1.0 17 5.0 18 3.0 19 2.0 20 4.0 21 10.0 22 6.0 23 9.0 24 5.0 25 16.0 26 15.0 27 13.0 28 10.0 29 21.0 30 26.0 31 35.0 32 41.0 33 81.0 34 156.0 35 453.0 36 2779.0 37 284.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.49624812406203 19.459729864932466 12.08104052026013 25.962981490745374 2 27.075 24.55 32.074999999999996 16.3 3 21.525 26.400000000000002 33.25 18.825 4 26.85 32.85 21.925 18.375 5 26.450000000000003 35.775 21.95 15.825 6 20.424999999999997 38.375 22.725 18.475 7 21.625 21.575 37.7 19.1 8 21.075 26.375 27.950000000000003 24.6 9 23.05 24.175 29.125 23.65 10-14 24.14 28.935 26.41 20.515 15-19 23.145 27.775 28.415000000000003 20.665 20-24 23.715 28.415000000000003 27.435 20.435 25-29 24.099999999999998 27.625 27.6 20.674999999999997 30-34 23.335 27.560000000000002 28.465 20.64 35-39 23.055 28.63 27.82 20.495 40-44 23.3 28.67 27.894999999999996 20.135 45-49 23.075000000000003 28.825 27.675 20.424999999999997 50-54 23.315 28.665000000000003 28.075 19.945 55-59 23.855 27.68 28.065 20.4 60-64 23.48 27.845 28.27 20.405 65-69 23.35 28.235 28.07 20.345 70-74 23.605 27.944999999999997 28.18 20.27 75-79 23.745 28.355000000000004 27.839999999999996 20.06 80-84 23.62 28.175 27.939999999999998 20.265 85-89 23.465 28.27 27.85 20.415 90-94 23.355 28.625 28.095 19.925 95-99 23.74 27.91 28.21 20.14 100-104 24.18 27.83 27.855 20.135 105-109 24.16 28.610000000000003 27.54 19.689999999999998 110-114 24.895 28.71 27.105 19.29 115-119 25.040000000000003 28.165000000000003 26.855 19.939999999999998 120-124 25.21 28.689999999999998 26.584999999999997 19.515 125-129 25.119999999999997 28.32 27.05 19.509999999999998 130-134 25.585 28.470000000000002 26.515 19.43 135-139 26.46 28.470000000000002 26.369999999999997 18.7 140-144 25.525 28.884999999999998 26.565 19.025 145-149 26.61 28.475 25.935000000000002 18.98 150-151 26.375 29.2 26.724999999999998 17.7 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 1.5 8 2.5 9 3.0 10 2.5 11 3.0 12 3.5 13 2.5 14 1.5 15 1.5 16 1.5 17 1.0 18 1.5 19 1.5 20 1.0 21 1.5 22 3.0 23 3.5 24 3.0 25 3.5 26 6.0 27 7.0 28 7.0 29 13.5 30 20.5 31 28.5 32 39.0 33 37.0 34 45.5 35 72.0 36 92.0 37 103.5 38 136.0 39 165.5 40 194.0 41 224.5 42 246.5 43 260.5 44 260.5 45 269.0 46 257.0 47 240.5 48 228.0 49 191.0 50 161.5 51 130.0 52 100.0 53 93.0 54 80.0 55 58.0 56 42.0 57 36.0 58 24.0 59 18.0 60 13.5 61 7.0 62 7.0 63 6.5 64 3.5 65 1.0 66 0.5 67 2.0 68 2.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.5 74 1.0 75 0.5 76 0.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.5 82 1.0 83 0.5 84 0.0 85 0.0 86 0.5 87 0.5 88 1.0 89 1.5 90 2.0 91 1.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 1.5 100 5.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.925 #Duplication Level Percentage of deduplicated Percentage of total 1 98.36609650242532 96.325 2 1.5573142711258616 3.05 3 0.051059484299208584 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025529742149604292 0.475 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 19 0.475 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.36250000000000004 0.0 0.0 0.0 0.0 80-81 0.4625 0.0 0.0 0.0 0.0 82-83 0.6125 0.0 0.0 0.0 0.0 84-85 0.75 0.0 0.0 0.0 0.0 86-87 0.9125 0.0 0.0 0.0 0.0 88-89 1.0625 0.0 0.0 0.0 0.0 90-91 1.225 0.0 0.0 0.0 0.0 92-93 1.5 0.0 0.0 0.0 0.0 94-95 1.7875 0.0 0.0 0.0 0.0 96-97 2.175 0.0 0.0 0.0 0.0 98-99 2.4875 0.0 0.0 0.0 0.0 100-101 2.775 0.0 0.0 0.0 0.0 102-103 3.1125 0.0 0.0 0.0 0.0 104-105 3.7 0.0 0.0 0.0 0.0 106-107 4.375 0.0 0.0 0.0 0.0 108-109 4.9625 0.0 0.0 0.0 0.0 110-111 5.4375 0.0 0.0 0.0 0.0 112-113 5.9875 0.0 0.0 0.0 0.0 114-115 6.8375 0.0 0.0 0.0 0.0 116-117 7.7 0.0 0.0 0.0 0.0 118-119 8.600000000000001 0.0 0.0 0.0 0.0 120-121 9.3625 0.0 0.0 0.0 0.0 122-123 10.075 0.0 0.0 0.0 0.0 124-125 10.899999999999999 0.0 0.0 0.0 0.0 126-127 11.675 0.0 0.0 0.0 0.0 128-129 12.575 0.0 0.0 0.0 0.0 130-131 13.5125 0.0 0.0 0.0 0.0 132-133 14.525 0.0 0.0 0.0 0.0 134-135 15.4 0.0 0.0 0.0 0.0 136-137 16.3375 0.0 0.0 0.0 0.0 138-139 17.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1414789 spots for SRR28623253.sra Written 1414789 spots for SRR28623253.sra Read 1414789 spots for SRR28623253.sra Written 1414789 spots for SRR28623253.sra Read 1414789 spots for SRR28623253.sra Written 1414789 spots for SRR28623253.sra Read 1414789 spots for SRR28623253.sra Written 1414789 spots for SRR28623253.sra Read 1414789 spots for SRR28623253.sra Written 1414789 spots for SRR28623253.sra Read 1414789 spots for SRR28623253.sra Written 1414789 spots for SRR28623253.sra Read 1414789 spots for SRR28623253.sra Written 1414789 spots for SRR28623253.sra Read 1414789 spots for SRR28623253.sra Written 1414789 spots for SRR28623253.sra Read 1414789 spots for SRR28623253.sra Written 1414789 spots for SRR28623253.sra Read 1414789 spots for SRR28623253.sra Written 1414789 spots for SRR28623253.sra Read 1414789 spots for SRR28623253.sra Written 1414789 spots for SRR28623253.sra Read 1414789 spots for SRR28623253.sra Written 1414789 spots for SRR28623253.sra Read 1414789 spots for SRR28623253.sra Written 1414789 spots for SRR28623253.sra Read 1414789 spots for SRR28623253.sra Written 1414789 spots for SRR28623253.sra Read 1414789 spots for SRR28623253.sra Written 1414789 spots for SRR28623253.sra Read 1414789 spots for SRR28623253.sra Written 1414789 spots for SRR28623253.sra Read 1414789 spots for SRR28623253.sra Written 1414789 spots for SRR28623253.sra Read 1414789 spots for SRR28623253.sra Written 1414789 spots for SRR28623253.sra Read 1414789 spots for SRR28623253.sra Written 1414789 spots for SRR28623253.sra Read 1414806 spots for SRR28623253.sra Written 1414806 spots for SRR28623253.sra SRR ids: ['SRR28623253.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ca2m5eip SRR28623253.sra spots: 28295797 blocks: [[1, 1414789], [1414790, 2829578], [2829579, 4244367], [4244368, 5659156], [5659157, 7073945], [7073946, 8488734], [8488735, 9903523], [9903524, 11318312], [11318313, 12733101], [12733102, 14147890], [14147891, 15562679], [15562680, 16977468], [16977469, 18392257], [18392258, 19807046], [19807047, 21221835], [21221836, 22636624], [22636625, 24051413], [24051414, 25466202], [25466203, 26880991], [26880992, 28295797]] SRR28623253 file size 10447118 SRR28623253 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623253 SRR28623253_1.fastq SRR28623253_2.fastq Input file: SRR28623253_1.fastq Paired file: SRR28623253_2.fastq trimmed: SRR28623253-trimmed-pair1.fastq, SRR28623253-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 11:50:37 2025 >> started Tue Feb 11 11:51:09 2025 >> done (31.856s) 28295797 read pairs processed; of these: 26 ( 0.00%) short read pairs filtered out after trimming by size control 13902 ( 0.05%) empty read pairs filtered out after trimming by size control 28281869 (99.95%) read pairs available; of these: 6596087 (23.32%) trimmed read pairs available after processing 21685782 (76.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 4 0.00% 21 8 0.00% 22 2 0.00% 23 2 0.00% 24 4 0.00% 25 4 0.00% 26 9 0.00% 27 1 0.00% 28 7 0.00% 29 6 0.00% 30 12 0.00% 31 14 0.00% 32 14 0.00% 33 16 0.00% 34 19 0.00% 35 22 0.00% 36 20 0.00% 37 36 0.00% 38 46 0.00% 39 56 0.00% 40 59 0.00% 41 69 0.00% 42 104 0.00% 43 95 0.00% 44 96 0.00% 45 155 0.00% 46 148 0.00% 47 183 0.00% 48 207 0.00% 49 241 0.00% 50 289 0.00% 51 306 0.00% 52 373 0.00% 53 443 0.00% 54 517 0.00% 55 567 0.00% 56 628 0.00% 57 739 0.00% 58 808 0.00% 59 950 0.00% 60 1192 0.00% 61 1352 0.00% 62 1545 0.01% 63 1712 0.01% 64 2001 0.01% 65 2297 0.01% 66 2549 0.01% 67 2824 0.01% 68 3358 0.01% 69 3781 0.01% 70 4375 0.02% 71 5034 0.02% 72 5741 0.02% 73 6551 0.02% 74 7364 0.03% 75 8469 0.03% 76 9414 0.03% 77 10370 0.04% 78 11655 0.04% 79 12903 0.05% 80 14296 0.05% 81 16112 0.06% 82 17788 0.06% 83 19806 0.07% 84 22123 0.08% 85 24252 0.09% 86 26216 0.09% 87 28344 0.10% 88 30836 0.11% 89 32692 0.12% 90 35152 0.12% 91 38035 0.13% 92 40474 0.14% 93 43668 0.15% 94 46680 0.17% 95 49905 0.18% 96 52550 0.19% 97 55546 0.20% 98 57214 0.20% 99 59710 0.21% 100 62978 0.22% 101 64278 0.23% 102 67794 0.24% 103 70646 0.25% 104 73649 0.26% 105 76883 0.27% 106 80947 0.29% 107 82189 0.29% 108 84251 0.30% 109 86968 0.31% 110 87903 0.31% 111 91021 0.32% 112 93172 0.33% 113 94358 0.33% 114 97617 0.35% 115 100814 0.36% 116 103467 0.37% 117 106599 0.38% 118 108149 0.38% 119 108896 0.39% 120 111277 0.39% 121 111951 0.40% 122 112597 0.40% 123 114712 0.41% 124 117436 0.42% 125 117722 0.42% 126 120751 0.43% 127 123513 0.44% 128 124388 0.44% 129 126170 0.45% 130 128393 0.45% 131 127561 0.45% 132 128338 0.45% 133 129395 0.46% 134 128783 0.46% 135 130663 0.46% 136 132377 0.47% 137 133575 0.47% 138 135928 0.48% 139 137723 0.49% 140 136968 0.48% 141 138095 0.49% 142 138207 0.49% 143 137481 0.49% 144 139577 0.49% 145 139068 0.49% 146 139433 0.49% 147 140114 0.50% 148 142755 0.50% 149 141860 0.50% 150 143528 0.51% 151 21685782 76.68% 28281869 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=28 prefix-density=0.29 prefix-fanout=2.2 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=213.60 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=15.9 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTGTG criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.86 fanout-score-rank=32 prefix-density=0.47 prefix-fanout=1.9 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.09 sequence-density-rank=26 fanout-score=34.92 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=11.6 sequence=AAGGCCAAGATCCAGGACAAGGA SRR28623253 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 11:51:52 Started mapping on | Feb 11 11:51:52 Finished on | Feb 11 11:54:38 Mapping speed, Million of reads per hour | 613.34 Number of input reads | 28281869 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 26618605 Uniquely mapped reads % | 94.12% Average mapped length | 287.45 Number of splices: Total | 24931142 Number of splices: Annotated (sjdb) | 24359703 Number of splices: GT/AG | 24451516 Number of splices: GC/AG | 373953 Number of splices: AT/AC | 17917 Number of splices: Non-canonical | 87756 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 655009 % of reads mapped to multiple loci | 2.32% Number of reads mapped to too many loci | 53843 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.17% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1008255 1008255 1008255 N_multimapping 655009 655009 655009 N_noFeature 1071313 26217881 1252403 N_ambiguous 377781 1719 157114 UnstrandedReadsAssigned:25169511 PositiveStrandReadsAssigned:399005 NegativeStrandReadsAssigned:25209088 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=143 echo kmer=139 SRR28623253 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623253-trimmed-pair1.fastq SRR28623253-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,281,869 reads, 25,442,237 reads pseudoaligned [quant] estimated average fragment length: 207.838 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,173 rounds 52401 SRR28623253.ke.tsv 34699 SRR28623253.se.tsv 87100 total ==> SRR28623253.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1811.16 2452 51.804 Potri.005G024800.1.v4.1 1035 828.162 745 34.4224 Potri.004G059700.1.v4.1 961 754.182 75 3.80526 Potri.007G009000.2.v4.1 1416 1209.16 0 0 Potri.003G141000.2.v4.1 2943 2736.16 1916.51 26.8021 Potri.016G087400.1.v4.1 270 102.029 1254.34 470.423 Potri.015G069301.1.v4.1 564 361.317 0 0 Potri.010G195200.1.v4.1 1773 1566.16 273.966 6.69361 Potri.012G127500.1.v4.1 977 770.175 49 2.43448 ==> SRR28623253.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 35 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 425 Potri.001G212900.v4.1 112 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 237 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 32 SRR28623253 completed mapping pipeline successfully