Starting /dee2/code/volunteer_pipeline.sh SRR28623254 current disk space = 3050931228672 free memory = 1579078904 SRR28623254 SRAfilesize 4850f194820c7ddfd1f0204188c8a9ca SRR28623254.sra SRR28623254.sra file validated SRR28623254 is paired end SRR28623254 is conventional basespace SRR28623254 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623254_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.436 37.0 37.0 37.0 37.0 37.0 2 36.497 37.0 37.0 37.0 37.0 37.0 3 36.6365 37.0 37.0 37.0 37.0 37.0 4 36.722 37.0 37.0 37.0 37.0 37.0 5 36.699 37.0 37.0 37.0 37.0 37.0 6 36.67 37.0 37.0 37.0 37.0 37.0 7 36.661 37.0 37.0 37.0 37.0 37.0 8 36.547 37.0 37.0 37.0 37.0 37.0 9 36.6095 37.0 37.0 37.0 37.0 37.0 10-14 36.610400000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.6393 37.0 37.0 37.0 37.0 37.0 20-24 36.58050000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.547900000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.5297 37.0 37.0 37.0 37.0 37.0 35-39 36.4768 37.0 37.0 37.0 37.0 37.0 40-44 36.393100000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.3088 37.0 37.0 37.0 37.0 37.0 50-54 36.2915 37.0 37.0 37.0 37.0 37.0 55-59 36.219800000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.26370000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.2232 37.0 37.0 37.0 37.0 37.0 70-74 36.1382 37.0 37.0 37.0 37.0 37.0 75-79 36.1297 37.0 37.0 37.0 37.0 37.0 80-84 36.0407 37.0 37.0 37.0 37.0 37.0 85-89 36.109500000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.9936 37.0 37.0 37.0 37.0 37.0 95-99 35.861599999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.869 37.0 37.0 37.0 37.0 37.0 105-109 35.9433 37.0 37.0 37.0 37.0 37.0 110-114 35.884100000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.9125 37.0 37.0 37.0 37.0 37.0 120-124 35.755799999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.724599999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.8075 37.0 37.0 37.0 37.0 37.0 135-139 35.6023 37.0 37.0 37.0 37.0 37.0 140-144 35.326499999999996 37.0 37.0 37.0 34.6 37.0 145-149 35.289899999999996 37.0 37.0 37.0 32.2 37.0 150-151 35.083 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 3.0 22 5.0 23 7.0 24 6.0 25 3.0 26 5.0 27 9.0 28 14.0 29 25.0 30 23.0 31 36.0 32 49.0 33 80.0 34 151.0 35 406.0 36 2855.0 37 322.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.81836427496237 15.002508780732565 10.411440040140493 40.76768690416458 2 17.375 16.875 35.6 30.15 3 17.4 19.0 27.400000000000002 36.199999999999996 4 22.025 27.900000000000002 24.349999999999998 25.724999999999998 5 21.875 32.525 25.124999999999996 20.474999999999998 6 20.65 36.9 21.95 20.5 7 15.475 29.9 39.375 15.25 8 19.400000000000002 27.775 30.775000000000002 22.05 9 18.525 24.275 33.5 23.7 10-14 19.445 32.005 27.389999999999997 21.16 15-19 19.835 28.89 28.084999999999997 23.189999999999998 20-24 19.81 29.759999999999998 27.47 22.96 25-29 19.685 29.770000000000003 27.275 23.27 30-34 19.759999999999998 30.0 27.250000000000004 22.99 35-39 19.96 29.475 27.49 23.075000000000003 40-44 19.68 29.84 26.855 23.625 45-49 19.950000000000003 28.799999999999997 27.22 24.03 50-54 20.45 29.470000000000002 27.800000000000004 22.28 55-59 19.925 29.654999999999998 27.38 23.04 60-64 19.82 30.36 27.47 22.35 65-69 19.975 29.585 27.555000000000003 22.884999999999998 70-74 20.22 29.854999999999997 27.015 22.91 75-79 20.205000000000002 29.755 26.645000000000003 23.395 80-84 19.655 30.095 27.075 23.175 85-89 21.085 29.18 26.369999999999997 23.365 90-94 20.77 29.695 26.665 22.869999999999997 95-99 20.645 29.04 27.150000000000002 23.165 100-104 21.044999999999998 30.220000000000002 26.215 22.52 105-109 20.965 29.054999999999996 26.815 23.165 110-114 20.825 28.744999999999997 26.790000000000003 23.64 115-119 21.154999999999998 29.360000000000003 25.44 24.044999999999998 120-124 20.669999999999998 29.89 25.72 23.72 125-129 21.044999999999998 29.354999999999997 25.674999999999997 23.925 130-134 21.21 28.285 26.334999999999997 24.169999999999998 135-139 20.84 28.24 26.66 24.26 140-144 21.545 28.410000000000004 26.455000000000002 23.59 145-149 21.5 27.735 26.415 24.349999999999998 150-151 21.175 28.075 26.075 24.675 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 0.5 18 0.0 19 0.5 20 1.5 21 1.5 22 2.0 23 3.5 24 6.0 25 8.5 26 8.0 27 11.5 28 14.5 29 14.0 30 31.0 31 50.5 32 50.0 33 58.0 34 82.5 35 99.0 36 98.0 37 129.5 38 167.5 39 179.0 40 220.0 41 233.5 42 209.0 43 213.0 44 241.0 45 248.0 46 228.0 47 227.0 48 219.5 49 175.5 50 143.0 51 119.0 52 100.0 53 85.0 54 65.0 55 59.0 56 47.0 57 31.0 58 24.5 59 21.0 60 16.5 61 10.5 62 8.0 63 6.5 64 3.0 65 2.0 66 5.5 67 8.0 68 4.5 69 1.0 70 0.5 71 0.5 72 0.0 73 0.5 74 1.0 75 1.5 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.3 #Duplication Level Percentage of deduplicated Percentage of total 1 84.42376950780313 70.325 2 12.364945978391356 20.599999999999998 3 2.250900360144058 5.625 4 0.7202881152460985 2.4 5 0.18007202881152462 0.75 6 0.060024009603841535 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGAGTTATCTCGTAT 6 0.15 TruSeq Adapter, Index 6 (97% over 36bp) GGAATATTCTGAAGCTACAGGAAACAAATGGCAGAGTTTGCAAAAGCAAC 6 0.15 No Hit CCGCTTTGATATTCTCTGCATCCTATTTAGGGCTATTGATATTTAACAAA 5 0.125 No Hit AGCACCTTCTCGATCTTATAAATGGCTAGCTGGTTGTCCGTGTATACCGT 5 0.125 No Hit CCTCCAACAGGGGATTTGCTTCTTGACTGAGTGAGATATACAGTGTTGTT 5 0.125 No Hit ATCCATTTCTTTAACCACTGCCTCACCCACTGCGTTAATTCTAGACTTCA 5 0.125 No Hit TATCATTTCATACAAAATTACCCCAAAACTGTAAATATTGCTCTCTGGAT 5 0.125 No Hit GTCAAGTTGTCTAACAGACTCAAATAAATCATCCAAAGAGAATCCTCTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.525 0.0 0.0 0.0 0.0 86-87 0.7 0.0 0.0 0.0 0.0 88-89 0.925 0.0 0.0 0.0 0.0 90-91 1.0875 0.0 0.0 0.0 0.0 92-93 1.3875000000000002 0.0 0.0 0.0 0.0 94-95 1.7625000000000002 0.0 0.0 0.0 0.0 96-97 2.1375 0.0 0.0 0.0 0.0 98-99 2.5875 0.0 0.0 0.0 0.0 100-101 2.95 0.0 0.0 0.0 0.0 102-103 3.2125 0.0 0.0 0.0 0.0 104-105 3.575 0.0 0.0 0.0 0.0 106-107 4.387499999999999 0.0 0.0 0.0 0.0 108-109 4.8375 0.0 0.0 0.0 0.0 110-111 5.375 0.0 0.0 0.0 0.0 112-113 5.949999999999999 0.0 0.0 0.0 0.0 114-115 6.6 0.0 0.0 0.0 0.0 116-117 7.375 0.0 0.0 0.0 0.0 118-119 8.1 0.0 0.0 0.0 0.0 120-121 8.8 0.0 0.0 0.0 0.0 122-123 9.8 0.0 0.0 0.0 0.0 124-125 10.6875 0.0 0.0 0.0 0.0 126-127 11.3625 0.0 0.0 0.0 0.0 128-129 12.05 0.0 0.0 0.0 0.0 130-131 12.675 0.0 0.0 0.0 0.0 132-133 13.55 0.0 0.0 0.0 0.0 134-135 14.375 0.0 0.0 0.0 0.0 136-137 15.05 0.0 0.0 0.0 0.0 138-139 15.862499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR28623254 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623254_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9725 37.0 37.0 37.0 37.0 37.0 2 36.1985 37.0 37.0 37.0 37.0 37.0 3 36.1635 37.0 37.0 37.0 37.0 37.0 4 36.2845 37.0 37.0 37.0 37.0 37.0 5 36.3545 37.0 37.0 37.0 37.0 37.0 6 36.329 37.0 37.0 37.0 37.0 37.0 7 36.257 37.0 37.0 37.0 37.0 37.0 8 36.337 37.0 37.0 37.0 37.0 37.0 9 36.282 37.0 37.0 37.0 37.0 37.0 10-14 36.123000000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.063599999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.0809 37.0 37.0 37.0 37.0 37.0 25-29 36.039 37.0 37.0 37.0 37.0 37.0 30-34 35.915499999999994 37.0 37.0 37.0 37.0 37.0 35-39 35.8847 37.0 37.0 37.0 37.0 37.0 40-44 35.887899999999995 37.0 37.0 37.0 37.0 37.0 45-49 35.880700000000004 37.0 37.0 37.0 37.0 37.0 50-54 35.7894 37.0 37.0 37.0 37.0 37.0 55-59 35.7427 37.0 37.0 37.0 37.0 37.0 60-64 35.70609999999999 37.0 37.0 37.0 37.0 37.0 65-69 35.7587 37.0 37.0 37.0 37.0 37.0 70-74 35.7439 37.0 37.0 37.0 37.0 37.0 75-79 35.742000000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.6603 37.0 37.0 37.0 37.0 37.0 85-89 35.5886 37.0 37.0 37.0 37.0 37.0 90-94 35.4994 37.0 37.0 37.0 37.0 37.0 95-99 35.612899999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.4965 37.0 37.0 37.0 37.0 37.0 105-109 35.4086 37.0 37.0 37.0 37.0 37.0 110-114 35.4654 37.0 37.0 37.0 37.0 37.0 115-119 35.4055 37.0 37.0 37.0 37.0 37.0 120-124 35.415 37.0 37.0 37.0 37.0 37.0 125-129 34.99 37.0 37.0 37.0 29.8 37.0 130-134 35.2074 37.0 37.0 37.0 32.2 37.0 135-139 35.0159 37.0 37.0 37.0 27.4 37.0 140-144 35.0385 37.0 37.0 37.0 27.4 37.0 145-149 35.0091 37.0 37.0 37.0 25.0 37.0 150-151 34.6465 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 7.0 14 9.0 15 6.0 16 6.0 17 4.0 18 4.0 19 7.0 20 4.0 21 8.0 22 11.0 23 16.0 24 15.0 25 10.0 26 8.0 27 14.0 28 16.0 29 22.0 30 18.0 31 31.0 32 45.0 33 91.0 34 181.0 35 578.0 36 2580.0 37 308.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.85 22.25 11.799999999999999 26.1 2 28.275 24.525 30.275000000000002 16.925 3 22.05 26.625 31.275 20.05 4 26.474999999999998 32.125 23.1 18.3 5 24.85 34.9 23.674999999999997 16.575 6 21.224999999999998 37.15 23.775 17.849999999999998 7 21.7 21.65 37.35 19.3 8 23.25 25.825 26.950000000000003 23.974999999999998 9 22.475 24.675 30.7 22.15 10-14 24.39 28.439999999999998 26.200000000000003 20.97 15-19 23.705000000000002 27.994999999999997 27.765 20.535 20-24 23.244999999999997 27.915 28.199999999999996 20.64 25-29 23.66 27.894999999999996 27.87 20.575 30-34 23.73 28.575 27.310000000000002 20.385 35-39 24.125 28.38 27.295 20.200000000000003 40-44 23.52 27.694999999999997 28.375 20.41 45-49 23.93 28.405 27.58 20.085 50-54 23.87 27.894999999999996 28.060000000000002 20.175 55-59 23.56 28.244999999999997 28.294999999999998 19.900000000000002 60-64 23.61 28.165000000000003 28.075 20.150000000000002 65-69 23.799999999999997 28.435 27.485 20.28 70-74 23.405 28.685 28.04 19.869999999999997 75-79 23.830000000000002 27.815 28.060000000000002 20.294999999999998 80-84 23.485 28.365000000000002 28.065 20.085 85-89 23.47 28.08 28.52 19.93 90-94 23.52 27.994999999999997 28.910000000000004 19.575 95-99 23.78 28.675 27.54 20.005 100-104 23.880000000000003 28.59 27.894999999999996 19.634999999999998 105-109 24.01 27.450000000000003 28.439999999999998 20.1 110-114 24.055 28.465 27.505000000000003 19.975 115-119 24.27 28.694999999999997 27.54 19.495 120-124 24.88 28.134999999999998 27.715 19.27 125-129 25.35 27.99 27.18 19.48 130-134 25.955000000000002 29.044999999999998 27.045 17.955 135-139 25.96 28.105000000000004 26.745 19.189999999999998 140-144 26.955000000000002 27.834999999999997 26.474999999999998 18.735 145-149 26.96 27.66 26.735 18.645 150-151 26.487500000000004 27.900000000000002 27.375 18.2375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 1.0 6 1.5 7 0.5 8 1.5 9 2.5 10 2.0 11 1.5 12 1.5 13 1.5 14 0.5 15 3.0 16 3.0 17 1.0 18 1.0 19 0.5 20 2.0 21 2.5 22 1.5 23 1.5 24 2.0 25 3.5 26 6.5 27 9.0 28 8.0 29 11.0 30 24.5 31 34.5 32 34.0 33 37.5 34 56.0 35 68.5 36 85.0 37 124.0 38 156.0 39 156.5 40 190.5 41 234.5 42 243.0 43 254.0 44 262.0 45 264.0 46 252.0 47 241.5 48 205.5 49 180.5 50 170.5 51 136.0 52 110.0 53 83.0 54 64.0 55 47.5 56 38.0 57 33.5 58 20.0 59 18.5 60 18.0 61 13.5 62 11.5 63 9.0 64 6.5 65 4.0 66 2.0 67 1.5 68 3.5 69 4.0 70 2.0 71 1.0 72 0.5 73 0.5 74 1.0 75 0.5 76 0.0 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 1.5 83 1.5 84 0.0 85 0.0 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 1.0 95 0.5 96 0.5 97 1.0 98 0.5 99 0.0 100 7.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 84.82303539292143 70.7 2 12.177564487102579 20.3 3 2.009598080383923 5.025 4 0.7498500299940012 2.5 5 0.11997600479904018 0.5 6 0.05998800239952009 0.3 7 0.029994001199760045 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.029994001199760045 0.5 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 20 0.5 No Hit AGATGACACAACTCCAAGTTCGCAATCGCAGTGAGTGCTGGAATACTCGG 7 0.17500000000000002 No Hit CCTGATCTTAAAACCATGCAGATCCATCATGATGCTCGACACCCAAAACT 6 0.15 No Hit CTCTCATTGGTTTATACTTCAATATAAGCCTTGGTAGGGATAGATAGCCA 6 0.15 No Hit TCTAGCCCATAATTAATTAACAGACATCATGAGCAGCAGCAGGTTCCAAT 5 0.125 No Hit ATTAAACTGTCAAATTGTAATTGAAAAAGATTTTCTTCGAGAGAAAGCAA 5 0.125 No Hit CAAGAATAATGGTTTTTGAATATGCTCCAAATGGAACTCTGTTTGAACAT 5 0.125 No Hit GGTGTGGTGGACCTGAAGTGCTTTTCTCTGAACTTCTAGGTAGTGCTGTG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.3125 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.5375 0.0 0.0 0.0 0.0 86-87 0.7 0.0 0.0 0.0 0.0 88-89 0.925 0.0 0.0 0.0 0.0 90-91 1.0875 0.0 0.0 0.0 0.0 92-93 1.3875000000000002 0.0 0.0 0.0 0.0 94-95 1.7625000000000002 0.0 0.0 0.0 0.0 96-97 2.1375 0.0 0.0 0.0 0.0 98-99 2.5875 0.0 0.0 0.0 0.0 100-101 2.95 0.0 0.0 0.0 0.0 102-103 3.2125 0.0 0.0 0.0 0.0 104-105 3.55 0.0 0.0 0.0 0.0 106-107 4.3375 0.0 0.0 0.0 0.0 108-109 4.75 0.0 0.0 0.0 0.0 110-111 5.275 0.0 0.0 0.0 0.0 112-113 5.8875 0.0 0.0 0.0 0.0 114-115 6.5375 0.0 0.0 0.0 0.0 116-117 7.3 0.0 0.0 0.0 0.0 118-119 8.0625 0.0 0.0 0.0 0.0 120-121 8.837499999999999 0.0 0.0 0.0 0.0 122-123 9.8125 0.0 0.0 0.0 0.0 124-125 10.6875 0.0 0.0 0.0 0.0 126-127 11.4 0.0 0.0 0.0 0.0 128-129 12.0875 0.0 0.0 0.0 0.0 130-131 12.725 0.0 0.0 0.0 0.0 132-133 13.575 0.0 0.0 0.0 0.0 134-135 14.3875 0.0 0.0 0.0 0.0 136-137 15.025 0.0 0.0 0.0 0.0 138-139 15.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAAGAG 10 0.006830828 145.0 4 >>END_MODULE Read 1539761 spots for SRR28623254.sra Written 1539761 spots for SRR28623254.sra Read 1539761 spots for SRR28623254.sra Written 1539761 spots for SRR28623254.sra Read 1539761 spots for SRR28623254.sra Written 1539761 spots for SRR28623254.sra Read 1539761 spots for SRR28623254.sra Written 1539761 spots for SRR28623254.sra Read 1539761 spots for SRR28623254.sra Written 1539761 spots for SRR28623254.sra Read 1539761 spots for SRR28623254.sra Written 1539761 spots for SRR28623254.sra Read 1539761 spots for SRR28623254.sra Written 1539761 spots for SRR28623254.sra Read 1539761 spots for SRR28623254.sra Written 1539761 spots for SRR28623254.sra Read 1539761 spots for SRR28623254.sra Written 1539761 spots for SRR28623254.sra Read 1539761 spots for SRR28623254.sra Written 1539761 spots for SRR28623254.sra Read 1539761 spots for SRR28623254.sra Written 1539761 spots for SRR28623254.sra Read 1539761 spots for SRR28623254.sra Written 1539761 spots for SRR28623254.sra Read 1539761 spots for SRR28623254.sra Written 1539761 spots for SRR28623254.sra Read 1539761 spots for SRR28623254.sra Written 1539761 spots for SRR28623254.sra Read 1539761 spots for SRR28623254.sra Written 1539761 spots for SRR28623254.sra Read 1539761 spots for SRR28623254.sra Written 1539761 spots for SRR28623254.sra Read 1539761 spots for SRR28623254.sra Written 1539761 spots for SRR28623254.sra Read 1539761 spots for SRR28623254.sra Written 1539761 spots for SRR28623254.sra Read 1539761 spots for SRR28623254.sra Written 1539761 spots for SRR28623254.sra Read 1539771 spots for SRR28623254.sra Written 1539771 spots for SRR28623254.sra SRR ids: ['SRR28623254.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qcmzssv4 SRR28623254.sra spots: 30795230 blocks: [[1, 1539761], [1539762, 3079522], [3079523, 4619283], [4619284, 6159044], [6159045, 7698805], [7698806, 9238566], [9238567, 10778327], [10778328, 12318088], [12318089, 13857849], [13857850, 15397610], [15397611, 16937371], [16937372, 18477132], [18477133, 20016893], [20016894, 21556654], [21556655, 23096415], [23096416, 24636176], [24636177, 26175937], [26175938, 27715698], [27715699, 29255459], [29255460, 30795230]] SRR28623254 file size 11370921 SRR28623254 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623254 SRR28623254_1.fastq SRR28623254_2.fastq Input file: SRR28623254_1.fastq Paired file: SRR28623254_2.fastq trimmed: SRR28623254-trimmed-pair1.fastq, SRR28623254-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:20:39 2025 >> started Tue Feb 11 12:21:27 2025 >> done (48.145s) 30795230 read pairs processed; of these: 22 ( 0.00%) short read pairs filtered out after trimming by size control 116329 ( 0.38%) empty read pairs filtered out after trimming by size control 30678879 (99.62%) read pairs available; of these: 6668585 (21.74%) trimmed read pairs available after processing 24010294 (78.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 1 0.00% 21 3 0.00% 22 3 0.00% 23 4 0.00% 24 4 0.00% 25 6 0.00% 26 6 0.00% 27 10 0.00% 28 4 0.00% 29 9 0.00% 30 11 0.00% 31 11 0.00% 32 16 0.00% 33 23 0.00% 34 25 0.00% 35 23 0.00% 36 20 0.00% 37 32 0.00% 38 28 0.00% 39 60 0.00% 40 69 0.00% 41 69 0.00% 42 74 0.00% 43 92 0.00% 44 97 0.00% 45 98 0.00% 46 123 0.00% 47 148 0.00% 48 182 0.00% 49 234 0.00% 50 271 0.00% 51 331 0.00% 52 347 0.00% 53 421 0.00% 54 418 0.00% 55 539 0.00% 56 597 0.00% 57 706 0.00% 58 839 0.00% 59 966 0.00% 60 1162 0.00% 61 1352 0.00% 62 1565 0.01% 63 1663 0.01% 64 1952 0.01% 65 2136 0.01% 66 2506 0.01% 67 2892 0.01% 68 3262 0.01% 69 3651 0.01% 70 4266 0.01% 71 4916 0.02% 72 5732 0.02% 73 6792 0.02% 74 7582 0.02% 75 8357 0.03% 76 9569 0.03% 77 10461 0.03% 78 11516 0.04% 79 12882 0.04% 80 14317 0.05% 81 16139 0.05% 82 18471 0.06% 83 20658 0.07% 84 22902 0.07% 85 25670 0.08% 86 27195 0.09% 87 29270 0.10% 88 31386 0.10% 89 33637 0.11% 90 36015 0.12% 91 38330 0.12% 92 41754 0.14% 93 45522 0.15% 94 48380 0.16% 95 51804 0.17% 96 55896 0.18% 97 57740 0.19% 98 60126 0.20% 99 62303 0.20% 100 64706 0.21% 101 66694 0.22% 102 69821 0.23% 103 72965 0.24% 104 76707 0.25% 105 80529 0.26% 106 83660 0.27% 107 84924 0.28% 108 87312 0.28% 109 89110 0.29% 110 90975 0.30% 111 92931 0.30% 112 95028 0.31% 113 97619 0.32% 114 100847 0.33% 115 104420 0.34% 116 106000 0.35% 117 107766 0.35% 118 108687 0.35% 119 111052 0.36% 120 112170 0.37% 121 113508 0.37% 122 114015 0.37% 123 115314 0.38% 124 118083 0.38% 125 119659 0.39% 126 122190 0.40% 127 124540 0.41% 128 124604 0.41% 129 126890 0.41% 130 127703 0.42% 131 127503 0.42% 132 128171 0.42% 133 129096 0.42% 134 129670 0.42% 135 130858 0.43% 136 132605 0.43% 137 133887 0.44% 138 134341 0.44% 139 136624 0.45% 140 136126 0.44% 141 136799 0.45% 142 139944 0.46% 143 137266 0.45% 144 138666 0.45% 145 139285 0.45% 146 137912 0.45% 147 139530 0.45% 148 140567 0.46% 149 140185 0.46% 150 140468 0.46% 151 24010294 78.26% 30678879 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=31 prefix-density=0.60 prefix-fanout=2.0 sequence=GAGTTTGGATAACTTGTGACATTAAGTGGTAACCTACTACCTGTTCCAGCCCATGTTCC criterion=fanout-score sequence-density=0.21 sequence-density-rank=17 fanout-score=16.41 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=16.4 sequence=GGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGAGTTATCTCGTATGCCGTCTTCTGCTTGAAAA criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=3.02 fanout-score-rank=20 prefix-density=0.60 prefix-fanout=2.6 sequence=GTGAACATAACCACAGGACTTACCAATACAAGTTTATCTGGCACGGTATACACGGACAACCAGCTAGCCATTTATAAGATTGA criterion=fanout-score sequence-density=0.04 sequence-density-rank=28 fanout-score=10.62 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=2.3 sequence=TTGACTTCTTTCCATGAAGAAATTGAAGAACTTCTTTACAGCTCCGTTGAGAACGACGAGCACTTATGTGTGCTAAAAGACCGCAACAAGCCAATTCTATTCACCATGGCGAGGCTGGACAGAGTTAAGAATTTAACTGGTCTTGTAGAATGGTATGGAAAGAATACCAAGCTGCGCGAATTAGCTAATCTTGTTGTAGTTGGTGGTGATAGAAGAAAGGAGTCTAAAGATATAGAAGAGCAAGCTGAGATGAAGAAAATGTACAGTCATATAGAGAAATACAAATTGAATGGCCAGTTCAGATGGATTTCTTCTCAGATGAACCGCGTGAGGAATGGAGAGCTCTACCGTTACATTTGTGATACCAAGGGAGCTTTCGTGCAGCCTGCTTTGTATGAGGCTTTTGGATTGACTGTTGTTGAGGCCATGACATGTGGTTTGCCAACCTTTGCTACTTGCAATGGTGGTCCTGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTG SRR28623254 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:22:09 Started mapping on | Feb 11 12:22:09 Finished on | Feb 11 12:26:24 Mapping speed, Million of reads per hour | 433.11 Number of input reads | 30678879 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 27554167 Uniquely mapped reads % | 89.81% Average mapped length | 288.22 Number of splices: Total | 19008494 Number of splices: Annotated (sjdb) | 18571347 Number of splices: GT/AG | 18698827 Number of splices: GC/AG | 226721 Number of splices: AT/AC | 19362 Number of splices: Non-canonical | 63584 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.04% Deletion average length | 2.83 Insertion rate per base | 0.03% Insertion average length | 2.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 594521 % of reads mapped to multiple loci | 1.94% Number of reads mapped to too many loci | 622051 % of reads mapped to too many loci | 2.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.58% % of reads unmapped: other | 0.64% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2530191 2530191 2530191 N_multimapping 594521 594521 594521 N_noFeature 953094 26999993 1162623 N_ambiguous 465924 3382 118718 UnstrandedReadsAssigned:26135149 PositiveStrandReadsAssigned:550792 NegativeStrandReadsAssigned:26272826 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR28623254 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623254-trimmed-pair1.fastq SRR28623254-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,678,879 reads, 27,041,935 reads pseudoaligned [quant] estimated average fragment length: 211.475 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,236 rounds 52401 SRR28623254.ke.tsv 34699 SRR28623254.se.tsv 87100 total ==> SRR28623254.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1807.53 625 13.7222 Potri.005G024800.1.v4.1 1035 824.525 92 4.42804 Potri.004G059700.1.v4.1 961 750.553 479 25.3269 Potri.007G009000.2.v4.1 1416 1205.53 0 0 Potri.003G141000.2.v4.1 2943 2732.53 292.151 4.24297 Potri.016G087400.1.v4.1 270 100.718 1882.61 741.789 Potri.015G069301.1.v4.1 564 357.922 0 0 Potri.010G195200.1.v4.1 1773 1562.53 47 1.19371 Potri.012G127500.1.v4.1 977 766.544 1105 57.2075 ==> SRR28623254.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3771 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 588 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 259 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR28623254 completed mapping pipeline successfully