Starting /dee2/code/volunteer_pipeline.sh SRR28623256 current disk space = 3051503673344 free memory = 1442776628 SRR28623256 SRAfilesize 5024e0f96369c0da059946c008652489 SRR28623256.sra SRR28623256.sra file validated SRR28623256 is paired end SRR28623256 is conventional basespace SRR28623256 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623256_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.36425 37.0 37.0 37.0 37.0 37.0 2 36.409 37.0 37.0 37.0 37.0 37.0 3 36.6315 37.0 37.0 37.0 37.0 37.0 4 36.6645 37.0 37.0 37.0 37.0 37.0 5 36.6885 37.0 37.0 37.0 37.0 37.0 6 36.7135 37.0 37.0 37.0 37.0 37.0 7 36.567 37.0 37.0 37.0 37.0 37.0 8 36.447 37.0 37.0 37.0 37.0 37.0 9 36.622 37.0 37.0 37.0 37.0 37.0 10-14 36.616699999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.5804 37.0 37.0 37.0 37.0 37.0 20-24 36.5621 37.0 37.0 37.0 37.0 37.0 25-29 36.509299999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.525800000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.4696 37.0 37.0 37.0 37.0 37.0 40-44 36.4036 37.0 37.0 37.0 37.0 37.0 45-49 36.270300000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.27569999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.069100000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.14790000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.1208 37.0 37.0 37.0 37.0 37.0 70-74 36.0924 37.0 37.0 37.0 37.0 37.0 75-79 36.1659 37.0 37.0 37.0 37.0 37.0 80-84 36.1274 37.0 37.0 37.0 37.0 37.0 85-89 36.1603 37.0 37.0 37.0 37.0 37.0 90-94 36.1597 37.0 37.0 37.0 37.0 37.0 95-99 35.9656 37.0 37.0 37.0 37.0 37.0 100-104 36.0319 37.0 37.0 37.0 37.0 37.0 105-109 36.007999999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.9346 37.0 37.0 37.0 37.0 37.0 115-119 35.915800000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.7994 37.0 37.0 37.0 37.0 37.0 125-129 35.7109 37.0 37.0 37.0 37.0 37.0 130-134 35.866499999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.7246 37.0 37.0 37.0 37.0 37.0 140-144 35.4269 37.0 37.0 37.0 37.0 37.0 145-149 35.423500000000004 37.0 37.0 37.0 34.6 37.0 150-151 35.127250000000004 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 2.0 22 1.0 23 0.0 24 1.0 25 6.0 26 6.0 27 9.0 28 15.0 29 18.0 30 24.0 31 44.0 32 65.0 33 100.0 34 134.0 35 360.0 36 2947.0 37 267.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.26587998995732 10.017574692442881 15.817223198594025 46.899322119005774 2 19.900000000000002 15.7 35.949999999999996 28.449999999999996 3 17.349999999999998 17.474999999999998 28.249999999999996 36.925000000000004 4 23.125 26.224999999999998 23.1 27.55 5 25.7 31.874999999999996 24.0 18.425 6 21.75 35.05 22.725 20.474999999999998 7 15.625 28.799999999999997 37.775 17.8 8 18.375 27.6 30.175 23.849999999999998 9 19.425 24.224999999999998 33.4 22.95 10-14 20.035 30.61 26.695 22.66 15-19 19.38 28.13 28.605000000000004 23.885 20-24 19.759999999999998 28.255000000000003 27.735 24.25 25-29 20.43 28.68 27.185 23.705000000000002 30-34 19.64 28.945 27.500000000000004 23.915 35-39 20.54 28.444999999999997 27.68 23.335 40-44 20.44 28.410000000000004 27.700000000000003 23.45 45-49 20.8 28.235 27.505000000000003 23.46 50-54 21.005 28.845 26.69 23.46 55-59 20.185 28.134999999999998 28.12 23.56 60-64 20.47 28.255000000000003 27.82 23.455000000000002 65-69 21.015 28.060000000000002 27.284999999999997 23.64 70-74 20.75 28.87 27.54 22.84 75-79 21.255 27.755000000000003 27.389999999999997 23.599999999999998 80-84 21.315 28.799999999999997 26.77 23.115 85-89 21.62 28.83 27.04 22.509999999999998 90-94 21.795 28.335 26.590000000000003 23.28 95-99 21.09 28.185 27.450000000000003 23.275000000000002 100-104 21.23 27.345000000000002 27.97 23.455000000000002 105-109 22.055 28.035 26.555 23.355 110-114 21.73 29.38 26.25 22.64 115-119 22.195 28.535 26.355 22.915 120-124 21.395 28.634999999999998 26.634999999999998 23.335 125-129 21.935 28.02 26.665 23.380000000000003 130-134 22.095000000000002 27.810000000000002 26.55 23.544999999999998 135-139 22.23 27.63 26.3 23.84 140-144 22.78 27.105 26.490000000000002 23.625 145-149 22.43 27.52 27.310000000000002 22.74 150-151 22.287499999999998 28.1 26.5625 23.05 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 3.0 23 6.0 24 5.5 25 4.5 26 5.0 27 9.0 28 13.5 29 16.0 30 22.0 31 28.5 32 30.0 33 36.0 34 48.0 35 79.0 36 101.5 37 102.0 38 136.5 39 162.5 40 176.0 41 202.5 42 225.0 43 224.0 44 228.5 45 260.5 46 261.0 47 260.0 48 236.5 49 199.5 50 194.0 51 162.5 52 117.0 53 90.0 54 73.5 55 55.0 56 40.5 57 35.0 58 29.5 59 27.5 60 21.0 61 8.5 62 6.5 63 6.0 64 3.0 65 5.0 66 7.5 67 7.0 68 6.5 69 6.5 70 5.5 71 3.5 72 1.5 73 1.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.42500000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.75 #Duplication Level Percentage of deduplicated Percentage of total 1 84.3202416918429 69.77499999999999 2 12.024169184290031 19.900000000000002 3 3.0211480362537766 7.5 4 0.4833836858006042 1.6 5 0.09063444108761329 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.060422960725075525 0.8500000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGCTTGGTATCGCGTAT 18 0.44999999999999996 TruSeq Adapter, Index 11 (97% over 37bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGCTTGGTATCTCGTAT 16 0.4 TruSeq Adapter, Index 11 (97% over 37bp) GCCCAGTGGGTCGAAGCTTCCACCTGGGTAGATTGGGTCAGTTACCTCAC 5 0.125 No Hit GTCTTCACGAGCTGGCGGCTGGTTTAGGAGAATGGGCCGTTGAGGCCGAG 5 0.125 No Hit CTCAGCAAGCCCGAGTGGGTCAAACCCATTATCACCTGGAAGGCTGCCAT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.025 0.0 2 0.0 0.0 0.0 0.025 0.0 3 0.0 0.0 0.0 0.025 0.0 4 0.0 0.0 0.0 0.025 0.0 5 0.0 0.0 0.0 0.025 0.0 6 0.0 0.0 0.0 0.025 0.0 7 0.0 0.0 0.0 0.025 0.0 8 0.0 0.0 0.0 0.025 0.0 9 0.0 0.0 0.0 0.025 0.0 10-11 0.0 0.0 0.0 0.025 0.0 12-13 0.0 0.0 0.0 0.025 0.0 14-15 0.0 0.0 0.0 0.025 0.0 16-17 0.0 0.0 0.0 0.025 0.0 18-19 0.0 0.0 0.0 0.025 0.0 20-21 0.0 0.0 0.0 0.025 0.0 22-23 0.0 0.0 0.0 0.025 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.025 0.0 0.0 0.025 0.0 66-67 0.05 0.0 0.0 0.025 0.0 68-69 0.05 0.0 0.0 0.025 0.0 70-71 0.05 0.0 0.0 0.025 0.0 72-73 0.0875 0.0 0.0 0.025 0.0 74-75 0.16249999999999998 0.0 0.0 0.025 0.0 76-77 0.1875 0.0 0.0 0.025 0.0 78-79 0.225 0.0 0.0 0.025 0.0 80-81 0.2625 0.0 0.0 0.025 0.0 82-83 0.3125 0.0 0.0 0.025 0.0 84-85 0.4 0.0 0.0 0.025 0.0 86-87 0.5125 0.0 0.0 0.025 0.0 88-89 0.5625 0.0 0.0 0.025 0.0 90-91 0.6875 0.0 0.0 0.025 0.0 92-93 0.95 0.0 0.0 0.025 0.0 94-95 1.0625 0.0 0.0 0.025 0.0 96-97 1.35 0.0 0.0 0.025 0.0 98-99 1.6875 0.0 0.0 0.025 0.0 100-101 1.95 0.0 0.0 0.025 0.0 102-103 2.2375 0.0 0.0 0.025 0.0 104-105 2.4875 0.0 0.0 0.025 0.0 106-107 2.8 0.0 0.0 0.025 0.0 108-109 3.35 0.0 0.0 0.025 0.0 110-111 3.75 0.0 0.0 0.025 0.0 112-113 4.0625 0.0 0.0 0.025 0.0 114-115 4.475 0.0 0.0 0.025 0.0 116-117 4.7875 0.0 0.0 0.025 0.0 118-119 5.2625 0.0 0.0 0.025 0.0 120-121 5.925000000000001 0.0 0.0 0.025 0.0 122-123 6.425 0.0 0.0 0.025 0.0 124-125 6.8125 0.0 0.0 0.025 0.0 126-127 7.3375 0.0 0.0 0.025 0.0 128-129 7.975 0.0 0.0 0.025 0.0 130-131 8.3375 0.0 0.0 0.025 0.0 132-133 8.825 0.0 0.0 0.025 0.0 134-135 9.425 0.0 0.0 0.025 0.0 136-137 10.0625 0.0 0.0 0.025 0.0 138-139 10.7875 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTTTGA 10 0.006830828 145.0 1 GTTTTCC 10 0.006830828 145.0 4 TTGAAGA 10 0.006830828 145.0 4 CGTTTTC 10 0.006830828 145.0 3 GAAGGGT 15 1.1411342E-4 145.0 9 AGAAGGG 20 3.5877043E-4 108.75 8 >>END_MODULE SRR28623256 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623256_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.2595 37.0 37.0 37.0 25.0 37.0 2 36.053 37.0 37.0 37.0 37.0 37.0 3 35.9815 37.0 37.0 37.0 37.0 37.0 4 35.971 37.0 37.0 37.0 37.0 37.0 5 36.1265 37.0 37.0 37.0 37.0 37.0 6 36.0195 37.0 37.0 37.0 37.0 37.0 7 35.949 37.0 37.0 37.0 37.0 37.0 8 35.901 37.0 37.0 37.0 37.0 37.0 9 35.878 37.0 37.0 37.0 37.0 37.0 10-14 35.7435 37.0 37.0 37.0 37.0 37.0 15-19 35.738 37.0 37.0 37.0 37.0 37.0 20-24 35.6963 37.0 37.0 37.0 37.0 37.0 25-29 35.561699999999995 37.0 37.0 37.0 37.0 37.0 30-34 35.4134 37.0 37.0 37.0 34.6 37.0 35-39 35.5022 37.0 37.0 37.0 37.0 37.0 40-44 35.39960000000001 37.0 37.0 37.0 37.0 37.0 45-49 35.428700000000006 37.0 37.0 37.0 37.0 37.0 50-54 35.3888 37.0 37.0 37.0 37.0 37.0 55-59 35.247 37.0 37.0 37.0 37.0 37.0 60-64 35.201 37.0 37.0 37.0 34.6 37.0 65-69 35.253 37.0 37.0 37.0 37.0 37.0 70-74 35.2975 37.0 37.0 37.0 37.0 37.0 75-79 35.29709999999999 37.0 37.0 37.0 37.0 37.0 80-84 35.1293 37.0 37.0 37.0 29.8 37.0 85-89 35.0749 37.0 37.0 37.0 27.4 37.0 90-94 35.1305 37.0 37.0 37.0 29.8 37.0 95-99 35.1242 37.0 37.0 37.0 29.8 37.0 100-104 35.089299999999994 37.0 37.0 37.0 29.8 37.0 105-109 34.9936 37.0 37.0 37.0 27.4 37.0 110-114 35.0647 37.0 37.0 37.0 25.0 37.0 115-119 35.0726 37.0 37.0 37.0 27.4 37.0 120-124 35.0734 37.0 37.0 37.0 27.4 37.0 125-129 34.359899999999996 37.0 37.0 37.0 25.0 37.0 130-134 34.8094 37.0 37.0 37.0 25.0 37.0 135-139 34.602199999999996 37.0 37.0 37.0 25.0 37.0 140-144 34.71 37.0 37.0 37.0 25.0 37.0 145-149 34.6426 37.0 37.0 37.0 25.0 37.0 150-151 34.25025 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 15.0 15 14.0 16 11.0 17 7.0 18 8.0 19 4.0 20 8.0 21 5.0 22 11.0 23 10.0 24 24.0 25 10.0 26 22.0 27 16.0 28 16.0 29 27.0 30 44.0 31 51.0 32 93.0 33 123.0 34 253.0 35 785.0 36 2275.0 37 164.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.2 17.0 21.925 31.874999999999996 2 28.975 23.075000000000003 30.0 17.95 3 23.275000000000002 25.624999999999996 29.599999999999998 21.5 4 24.65 30.85 25.074999999999996 19.425 5 27.250000000000004 33.125 22.725 16.900000000000002 6 21.725 36.675000000000004 23.875 17.724999999999998 7 21.55 20.599999999999998 39.275 18.575 8 23.549999999999997 25.2 26.625 24.625 9 23.974999999999998 24.75 29.599999999999998 21.675 10-14 24.94 28.439999999999998 25.785000000000004 20.835 15-19 24.005000000000003 27.389999999999997 27.975 20.630000000000003 20-24 24.09 28.24 27.22 20.45 25-29 23.919999999999998 28.42 27.38 20.28 30-34 24.07 28.194999999999997 27.33 20.405 35-39 23.235 27.944999999999997 28.415000000000003 20.405 40-44 23.455000000000002 28.544999999999998 27.125 20.875 45-49 23.06 27.855 28.449999999999996 20.635 50-54 23.01 28.485 28.185 20.32 55-59 23.335 28.084999999999997 27.884999999999998 20.695 60-64 23.485 28.389999999999997 27.450000000000003 20.674999999999997 65-69 22.86 28.139999999999997 28.265 20.735 70-74 23.75 28.29 27.644999999999996 20.315 75-79 22.57 28.645 28.105000000000004 20.68 80-84 23.73 28.310000000000002 27.98 19.98 85-89 24.0 27.365000000000002 27.544999999999998 21.09 90-94 23.49 28.53 27.6 20.380000000000003 95-99 24.224999999999998 28.365000000000002 27.175 20.235 100-104 24.285 28.185 27.66 19.869999999999997 105-109 24.45 27.779999999999998 27.125 20.645 110-114 24.635 27.639999999999997 27.685 20.04 115-119 24.85 27.744999999999997 27.134999999999998 20.27 120-124 25.174999999999997 28.139999999999997 27.22 19.465 125-129 25.385 28.205000000000002 26.779999999999998 19.63 130-134 26.1 27.935 26.884999999999998 19.08 135-139 26.115 27.534999999999997 27.345000000000002 19.005 140-144 26.345000000000002 27.105 27.095000000000002 19.455 145-149 26.61 27.48 26.6 19.31 150-151 26.825 27.55 27.250000000000004 18.375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.5 4 1.5 5 1.5 6 1.5 7 3.0 8 3.5 9 2.5 10 3.5 11 3.0 12 1.5 13 0.5 14 1.0 15 1.0 16 0.5 17 0.5 18 0.5 19 1.5 20 2.0 21 1.0 22 0.0 23 0.5 24 1.5 25 5.5 26 10.5 27 10.5 28 13.0 29 15.5 30 15.5 31 26.0 32 41.0 33 45.5 34 52.5 35 65.0 36 83.0 37 107.5 38 133.5 39 160.0 40 174.0 41 201.5 42 220.0 43 248.5 44 272.5 45 270.5 46 268.0 47 256.5 48 241.0 49 198.0 50 163.0 51 128.0 52 99.0 53 87.5 54 63.5 55 52.5 56 48.5 57 32.5 58 22.5 59 25.0 60 17.0 61 9.5 62 11.5 63 7.5 64 4.0 65 3.0 66 3.5 67 3.5 68 2.5 69 2.0 70 2.0 71 1.5 72 0.5 73 1.0 74 1.0 75 1.0 76 4.0 77 4.0 78 2.5 79 1.5 80 1.0 81 1.5 82 0.5 83 1.5 84 1.5 85 0.0 86 0.5 87 1.0 88 1.0 89 2.0 90 2.0 91 0.5 92 0.0 93 0.0 94 1.0 95 1.0 96 0.0 97 0.0 98 0.5 99 1.5 100 5.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.8 #Duplication Level Percentage of deduplicated Percentage of total 1 85.84905660377359 72.8 2 11.232311320754718 19.05 3 2.4174528301886795 6.15 4 0.41273584905660377 1.4000000000000001 5 0.0589622641509434 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0294811320754717 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 14 0.35000000000000003 No Hit CAAAAATCAAACAACGAAGAAAGAAAGAAAAGAGAAAGAATGGCCACCGT 5 0.125 No Hit CTCACCTGGCCACATCTTCCCAACAAGCCAAAACCCCTTCCTTCTCTGGT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.5125 0.0 0.0 0.0 0.0 88-89 0.5625 0.0 0.0 0.0 0.0 90-91 0.6875 0.0 0.0 0.0 0.0 92-93 0.95 0.0 0.0 0.0 0.0 94-95 1.0625 0.0 0.0 0.0 0.0 96-97 1.35 0.0 0.0 0.0 0.0 98-99 1.6875 0.0 0.0 0.0 0.0 100-101 1.95 0.0 0.0 0.0 0.0 102-103 2.2375 0.0 0.0 0.0 0.0 104-105 2.4875 0.0 0.0 0.0 0.0 106-107 2.8125 0.0 0.0 0.0 0.0 108-109 3.375 0.0 0.0 0.0 0.0 110-111 3.775 0.0 0.0 0.0 0.0 112-113 4.0875 0.0 0.0 0.0 0.0 114-115 4.5 0.0 0.0 0.0 0.0 116-117 4.824999999999999 0.0 0.0 0.0 0.0 118-119 5.3125 0.0 0.0 0.0 0.0 120-121 5.949999999999999 0.0 0.0 0.0 0.0 122-123 6.45 0.0 0.0 0.0 0.0 124-125 6.875 0.0 0.0 0.0 0.0 126-127 7.4125 0.0 0.0 0.0 0.0 128-129 8.0625 0.0 0.0 0.0 0.0 130-131 8.425 0.0 0.0 0.0 0.0 132-133 8.9375 0.0 0.0 0.0 0.0 134-135 9.5625 0.0 0.0 0.0 0.0 136-137 10.149999999999999 0.0 0.0 0.0 0.0 138-139 10.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGTCTG 10 0.006830828 145.0 2 TGATTAT 10 0.006830828 145.0 7 TCTGATT 10 0.006830828 145.0 5 GATTATG 10 0.006830828 145.0 8 GTTGTCT 10 0.006830828 145.0 1 >>END_MODULE Read 1804076 spots for SRR28623256.sra Written 1804076 spots for SRR28623256.sra Read 1804076 spots for SRR28623256.sra Written 1804076 spots for SRR28623256.sra Read 1804076 spots for SRR28623256.sra Written 1804076 spots for SRR28623256.sra Read 1804076 spots for SRR28623256.sra Written 1804076 spots for SRR28623256.sra Read 1804076 spots for SRR28623256.sra Written 1804076 spots for SRR28623256.sra Read 1804076 spots for SRR28623256.sra Written 1804076 spots for SRR28623256.sra Read 1804081 spots for SRR28623256.sra Written 1804081 spots for SRR28623256.sra Read 1804076 spots for SRR28623256.sra Written 1804076 spots for SRR28623256.sra Read 1804076 spots for SRR28623256.sra Written 1804076 spots for SRR28623256.sra Read 1804076 spots for SRR28623256.sra Written 1804076 spots for SRR28623256.sra Read 1804076 spots for SRR28623256.sra Written 1804076 spots for SRR28623256.sra Read 1804076 spots for SRR28623256.sra Written 1804076 spots for SRR28623256.sra Read 1804076 spots for SRR28623256.sra Written 1804076 spots for SRR28623256.sra Read 1804076 spots for SRR28623256.sra Written 1804076 spots for SRR28623256.sra Read 1804076 spots for SRR28623256.sra Written 1804076 spots for SRR28623256.sra Read 1804076 spots for SRR28623256.sra Written 1804076 spots for SRR28623256.sra Read 1804076 spots for SRR28623256.sra Written 1804076 spots for SRR28623256.sra Read 1804076 spots for SRR28623256.sra Written 1804076 spots for SRR28623256.sra Read 1804076 spots for SRR28623256.sra Written 1804076 spots for SRR28623256.sra Read 1804076 spots for SRR28623256.sra Written 1804076 spots for SRR28623256.sra SRR ids: ['SRR28623256.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uemdeywl SRR28623256.sra spots: 36081525 blocks: [[1, 1804076], [1804077, 3608152], [3608153, 5412228], [5412229, 7216304], [7216305, 9020380], [9020381, 10824456], [10824457, 12628532], [12628533, 14432608], [14432609, 16236684], [16236685, 18040760], [18040761, 19844836], [19844837, 21648912], [21648913, 23452988], [23452989, 25257064], [25257065, 27061140], [27061141, 28865216], [28865217, 30669292], [30669293, 32473368], [32473369, 34277444], [34277445, 36081525]] SRR28623256 file size 13324703 SRR28623256 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623256 SRR28623256_1.fastq SRR28623256_2.fastq Input file: SRR28623256_1.fastq Paired file: SRR28623256_2.fastq trimmed: SRR28623256-trimmed-pair1.fastq, SRR28623256-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 11:45:32 2025 >> started Tue Feb 11 11:46:16 2025 >> done (43.944s) 36081525 read pairs processed; of these: 47 ( 0.00%) short read pairs filtered out after trimming by size control 417427 ( 1.16%) empty read pairs filtered out after trimming by size control 35664051 (98.84%) read pairs available; of these: 5099193 (14.30%) trimmed read pairs available after processing 30564858 (85.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 2 0.00% 21 5 0.00% 22 9 0.00% 23 6 0.00% 24 5 0.00% 25 10 0.00% 26 12 0.00% 27 9 0.00% 28 16 0.00% 29 16 0.00% 30 18 0.00% 31 25 0.00% 32 22 0.00% 33 22 0.00% 34 27 0.00% 35 27 0.00% 36 37 0.00% 37 39 0.00% 38 68 0.00% 39 70 0.00% 40 67 0.00% 41 82 0.00% 42 94 0.00% 43 129 0.00% 44 112 0.00% 45 109 0.00% 46 137 0.00% 47 172 0.00% 48 172 0.00% 49 215 0.00% 50 222 0.00% 51 251 0.00% 52 291 0.00% 53 328 0.00% 54 353 0.00% 55 419 0.00% 56 420 0.00% 57 472 0.00% 58 571 0.00% 59 639 0.00% 60 781 0.00% 61 864 0.00% 62 1025 0.00% 63 1260 0.00% 64 1545 0.00% 65 1501 0.00% 66 1644 0.00% 67 1926 0.01% 68 2186 0.01% 69 2453 0.01% 70 2861 0.01% 71 3096 0.01% 72 3691 0.01% 73 4257 0.01% 74 4944 0.01% 75 5426 0.02% 76 6043 0.02% 77 6619 0.02% 78 7382 0.02% 79 8276 0.02% 80 9257 0.03% 81 10279 0.03% 82 11477 0.03% 83 13034 0.04% 84 14613 0.04% 85 16076 0.05% 86 17376 0.05% 87 18723 0.05% 88 19889 0.06% 89 21554 0.06% 90 22689 0.06% 91 24842 0.07% 92 26834 0.08% 93 28935 0.08% 94 31422 0.09% 95 33799 0.09% 96 36011 0.10% 97 36999 0.10% 98 38748 0.11% 99 40058 0.11% 100 42034 0.12% 101 44454 0.12% 102 46210 0.13% 103 48615 0.14% 104 51210 0.14% 105 53769 0.15% 106 55902 0.16% 107 57696 0.16% 108 59233 0.17% 109 61307 0.17% 110 62292 0.17% 111 63924 0.18% 112 66045 0.19% 113 68058 0.19% 114 70822 0.20% 115 73609 0.21% 116 76343 0.21% 117 77901 0.22% 118 79738 0.22% 119 81291 0.23% 120 81951 0.23% 121 83940 0.24% 122 84309 0.24% 123 87434 0.25% 124 89885 0.25% 125 91479 0.26% 126 94193 0.26% 127 96155 0.27% 128 97873 0.27% 129 99076 0.28% 130 101200 0.28% 131 101566 0.28% 132 102645 0.29% 133 104445 0.29% 134 105606 0.30% 135 106348 0.30% 136 109742 0.31% 137 111704 0.31% 138 114058 0.32% 139 115371 0.32% 140 115578 0.32% 141 115832 0.32% 142 117290 0.33% 143 118234 0.33% 144 118948 0.33% 145 120897 0.34% 146 122625 0.34% 147 122979 0.34% 148 126153 0.35% 149 127146 0.36% 150 127978 0.36% 151 30564858 85.70% 35664051 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=22 prefix-density=0.50 prefix-fanout=2.0 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=58.19 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=2.1 sequence=TGAATGGTGCACATTACGGGTCCATGGCACAAAATCAGAGGATAACAATATCCATTCAAGACTATGCAACAATATAATTTGATTATCCTTAGAAAGTGCTTCTCCTTACACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCAC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=18 prefix-density=0.56 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=66.13 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.5 sequence=CAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACC SRR28623256 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 11:47:57 Started mapping on | Feb 11 11:47:57 Finished on | Feb 11 11:51:35 Mapping speed, Million of reads per hour | 588.95 Number of input reads | 35664051 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 33041042 Uniquely mapped reads % | 92.65% Average mapped length | 292.91 Number of splices: Total | 29771601 Number of splices: Annotated (sjdb) | 29073054 Number of splices: GT/AG | 29151631 Number of splices: GC/AG | 516572 Number of splices: AT/AC | 21495 Number of splices: Non-canonical | 81903 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.83 Insertion rate per base | 0.03% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1004717 % of reads mapped to multiple loci | 2.82% Number of reads mapped to too many loci | 223866 % of reads mapped to too many loci | 0.63% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.58% % of reads unmapped: other | 0.33% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1618292 1618292 1618292 N_multimapping 1004717 1004717 1004717 N_noFeature 1284297 32660842 1452135 N_ambiguous 423536 1938 209905 UnstrandedReadsAssigned:31333209 PositiveStrandReadsAssigned:378262 NegativeStrandReadsAssigned:31379002 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623256 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623256-trimmed-pair1.fastq SRR28623256-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,664,051 reads, 32,172,742 reads pseudoaligned [quant] estimated average fragment length: 234.874 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,086 rounds 52401 SRR28623256.ke.tsv 34699 SRR28623256.se.tsv 87100 total ==> SRR28623256.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.13 1260 23.5186 Potri.005G024800.1.v4.1 1035 801.126 305 12.6784 Potri.004G059700.1.v4.1 961 727.158 98 4.4881 Potri.007G009000.2.v4.1 1416 1182.13 0 0 Potri.003G141000.2.v4.1 2943 2709.13 958.726 11.785 Potri.016G087400.1.v4.1 270 90.9157 1554.7 569.473 Potri.015G069301.1.v4.1 564 335.8 0 0 Potri.010G195200.1.v4.1 1773 1539.13 0 0 Potri.012G127500.1.v4.1 977 743.132 1095 49.0697 ==> SRR28623256.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 122 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 451 Potri.001G212900.v4.1 134 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR28623256 completed mapping pipeline successfully