Starting /dee2/code/volunteer_pipeline.sh SRR28623257 current disk space = 3051660996608 free memory = 1348727720 SRR28623257 SRAfilesize 8e3f2b8dd3be2fd575b16709b6b309a6 SRR28623257.sra SRR28623257.sra file validated SRR28623257 is paired end SRR28623257 is conventional basespace SRR28623257 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623257_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.45825 37.0 37.0 37.0 37.0 37.0 2 36.4645 37.0 37.0 37.0 37.0 37.0 3 36.613 37.0 37.0 37.0 37.0 37.0 4 36.6355 37.0 37.0 37.0 37.0 37.0 5 36.5735 37.0 37.0 37.0 37.0 37.0 6 36.646 37.0 37.0 37.0 37.0 37.0 7 36.5775 37.0 37.0 37.0 37.0 37.0 8 36.474 37.0 37.0 37.0 37.0 37.0 9 36.605 37.0 37.0 37.0 37.0 37.0 10-14 36.5997 37.0 37.0 37.0 37.0 37.0 15-19 36.527499999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.529599999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.488800000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.4901 37.0 37.0 37.0 37.0 37.0 35-39 36.4457 37.0 37.0 37.0 37.0 37.0 40-44 36.4111 37.0 37.0 37.0 37.0 37.0 45-49 36.3781 37.0 37.0 37.0 37.0 37.0 50-54 36.3121 37.0 37.0 37.0 37.0 37.0 55-59 36.3332 37.0 37.0 37.0 37.0 37.0 60-64 36.3692 37.0 37.0 37.0 37.0 37.0 65-69 36.3217 37.0 37.0 37.0 37.0 37.0 70-74 36.224900000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.1712 37.0 37.0 37.0 37.0 37.0 80-84 36.1049 37.0 37.0 37.0 37.0 37.0 85-89 36.2 37.0 37.0 37.0 37.0 37.0 90-94 36.0656 37.0 37.0 37.0 37.0 37.0 95-99 35.9798 37.0 37.0 37.0 37.0 37.0 100-104 36.0742 37.0 37.0 37.0 37.0 37.0 105-109 36.0378 37.0 37.0 37.0 37.0 37.0 110-114 35.910700000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.9512 37.0 37.0 37.0 37.0 37.0 120-124 35.77910000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.73479999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.8257 37.0 37.0 37.0 37.0 37.0 135-139 35.62769999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.4009 37.0 37.0 37.0 34.6 37.0 145-149 35.2845 37.0 37.0 37.0 34.6 37.0 150-151 35.025000000000006 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 6.0 25 4.0 26 6.0 27 11.0 28 15.0 29 19.0 30 27.0 31 38.0 32 49.0 33 98.0 34 145.0 35 364.0 36 2925.0 37 290.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.450439146800505 12.371392722710164 11.09159347553325 43.08657465495608 2 19.0 15.55 36.25 29.2 3 18.3 17.724999999999998 27.775 36.199999999999996 4 21.25 27.650000000000002 23.95 27.150000000000002 5 24.9 32.275 23.125 19.7 6 21.55 34.575 22.875 21.0 7 16.225 27.275 40.550000000000004 15.950000000000001 8 19.425 25.825 30.875000000000004 23.875 9 19.125 22.25 34.475 24.15 10-14 19.35 30.795 27.155 22.7 15-19 20.150000000000002 28.82 27.595 23.435 20-24 20.26 28.53 27.779999999999998 23.43 25-29 20.575 28.175 27.6 23.65 30-34 21.07 28.165000000000003 27.279999999999998 23.485 35-39 20.1 28.095 28.194999999999997 23.61 40-44 20.59 28.58 27.265 23.565 45-49 20.055 28.455000000000002 27.92 23.57 50-54 20.630000000000003 28.37 27.295 23.705000000000002 55-59 19.580000000000002 29.03 27.67 23.72 60-64 20.59 28.000000000000004 27.93 23.48 65-69 20.385 27.675 27.985 23.955000000000002 70-74 20.955 28.560000000000002 27.865000000000002 22.62 75-79 21.14 28.705000000000002 27.165 22.99 80-84 20.785 28.65 27.05 23.515 85-89 20.330000000000002 29.2 27.0 23.47 90-94 20.674999999999997 28.71 26.99 23.625 95-99 20.815 28.050000000000004 27.79 23.345 100-104 20.919999999999998 28.83 27.525 22.725 105-109 20.445 28.625 27.57 23.36 110-114 20.285 28.955 27.155 23.605 115-119 21.154999999999998 28.89 26.685 23.27 120-124 21.415 28.605000000000004 26.415 23.565 125-129 20.995 28.87 26.06 24.075 130-134 20.855 28.865000000000002 26.314999999999998 23.965 135-139 21.05 28.775000000000002 26.040000000000003 24.135 140-144 21.105 28.835 25.935000000000002 24.125 145-149 20.665 28.825 25.755 24.755 150-151 20.549999999999997 29.062500000000004 25.25 25.137500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 0.5 23 0.0 24 2.5 25 5.5 26 7.5 27 9.5 28 12.5 29 15.0 30 18.0 31 29.0 32 36.0 33 39.5 34 56.0 35 78.5 36 93.0 37 106.5 38 131.0 39 151.5 40 178.0 41 214.5 42 227.5 43 238.0 44 259.5 45 276.5 46 262.0 47 236.0 48 212.5 49 187.0 50 161.0 51 146.5 52 133.0 53 99.5 54 87.0 55 72.5 56 51.5 57 41.0 58 38.0 59 32.0 60 18.0 61 9.0 62 8.5 63 6.5 64 2.0 65 2.0 66 1.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.0 #Duplication Level Percentage of deduplicated Percentage of total 1 86.89655172413792 75.6 2 11.522988505747128 20.05 3 1.3505747126436782 3.5249999999999995 4 0.20114942528735633 0.7000000000000001 5 0.028735632183908046 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGCCTCTTTCAATTTCTGGTAGGCTGAAGATACATTTGAAGAAGGAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.2125 0.0 0.0 0.0 0.0 74-75 0.275 0.0 0.0 0.0 0.0 76-77 0.3125 0.0 0.0 0.0 0.0 78-79 0.375 0.0 0.0 0.0 0.0 80-81 0.5125 0.0 0.0 0.0 0.0 82-83 0.6499999999999999 0.0 0.0 0.0 0.0 84-85 0.825 0.0 0.0 0.0 0.0 86-87 0.925 0.0 0.0 0.0 0.0 88-89 1.075 0.0 0.0 0.0 0.0 90-91 1.1875 0.0 0.0 0.0 0.0 92-93 1.4125 0.0 0.0 0.0 0.0 94-95 1.675 0.0 0.0 0.0 0.0 96-97 1.9 0.0 0.0 0.0 0.0 98-99 2.2625 0.0 0.0 0.0 0.0 100-101 2.6 0.0 0.0 0.0 0.0 102-103 2.925 0.0 0.0 0.0 0.0 104-105 3.325 0.0 0.0 0.0 0.0 106-107 3.7125 0.0 0.0 0.0 0.0 108-109 4.199999999999999 0.0 0.0 0.0 0.0 110-111 4.8125 0.0 0.0 0.0 0.0 112-113 5.35 0.0 0.0 0.0 0.0 114-115 5.9375 0.0 0.0 0.0 0.0 116-117 6.625 0.0 0.0 0.0 0.0 118-119 7.25 0.0 0.0 0.0 0.0 120-121 7.9875 0.0 0.0 0.0 0.0 122-123 8.7125 0.0 0.0 0.0 0.0 124-125 9.662500000000001 0.0 0.0 0.0 0.0 126-127 10.4 0.0 0.0 0.0 0.0 128-129 11.350000000000001 0.0 0.0 0.0 0.0 130-131 12.1875 0.0 0.0 0.0 0.0 132-133 12.962499999999999 0.0 0.0 0.0 0.0 134-135 13.649999999999999 0.0 0.0 0.0 0.0 136-137 14.6875 0.0 0.0 0.0 0.0 138-139 15.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTTCAA 10 0.006830828 145.0 6 >>END_MODULE SRR28623257 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623257_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3125 37.0 37.0 37.0 37.0 37.0 2 36.4555 37.0 37.0 37.0 37.0 37.0 3 36.427 37.0 37.0 37.0 37.0 37.0 4 36.409 37.0 37.0 37.0 37.0 37.0 5 36.4765 37.0 37.0 37.0 37.0 37.0 6 36.456 37.0 37.0 37.0 37.0 37.0 7 36.453 37.0 37.0 37.0 37.0 37.0 8 36.419 37.0 37.0 37.0 37.0 37.0 9 36.359 37.0 37.0 37.0 37.0 37.0 10-14 36.3724 37.0 37.0 37.0 37.0 37.0 15-19 36.383599999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.3343 37.0 37.0 37.0 37.0 37.0 25-29 36.3079 37.0 37.0 37.0 37.0 37.0 30-34 36.2419 37.0 37.0 37.0 37.0 37.0 35-39 36.2645 37.0 37.0 37.0 37.0 37.0 40-44 36.142399999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.1971 37.0 37.0 37.0 37.0 37.0 50-54 36.201299999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.04449999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.088499999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.120200000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.0964 37.0 37.0 37.0 37.0 37.0 75-79 36.0999 37.0 37.0 37.0 37.0 37.0 80-84 36.028299999999994 37.0 37.0 37.0 37.0 37.0 85-89 35.955 37.0 37.0 37.0 37.0 37.0 90-94 35.9097 37.0 37.0 37.0 37.0 37.0 95-99 35.9717 37.0 37.0 37.0 37.0 37.0 100-104 35.827200000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.7875 37.0 37.0 37.0 37.0 37.0 110-114 35.823 37.0 37.0 37.0 37.0 37.0 115-119 35.7872 37.0 37.0 37.0 37.0 37.0 120-124 35.7586 37.0 37.0 37.0 37.0 37.0 125-129 35.320899999999995 37.0 37.0 37.0 32.2 37.0 130-134 35.5805 37.0 37.0 37.0 37.0 37.0 135-139 35.4542 37.0 37.0 37.0 37.0 37.0 140-144 35.431400000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.3682 37.0 37.0 37.0 34.6 37.0 150-151 35.08225 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 6.0 14 6.0 15 2.0 16 0.0 17 1.0 18 1.0 19 1.0 20 0.0 21 1.0 22 2.0 23 6.0 24 5.0 25 3.0 26 7.0 27 9.0 28 9.0 29 18.0 30 17.0 31 30.0 32 44.0 33 94.0 34 171.0 35 537.0 36 2709.0 37 320.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.95 19.5 14.625 28.925 2 26.125 26.125 31.075000000000003 16.675 3 21.25 28.425 31.275 19.05 4 25.3 32.025 24.0 18.675 5 26.1 34.675 23.425 15.8 6 20.875 39.85 21.3 17.974999999999998 7 20.65 22.575 37.45 19.325 8 22.05 24.95 29.299999999999997 23.7 9 21.7 24.675 30.575000000000003 23.05 10-14 23.74 29.42 25.755 21.085 15-19 23.43 28.915000000000003 27.255000000000003 20.4 20-24 23.39 28.465 27.6 20.544999999999998 25-29 23.44 28.64 27.425 20.495 30-34 23.145 28.225 27.800000000000004 20.830000000000002 35-39 23.605 28.475 27.384999999999998 20.535 40-44 22.830000000000002 27.925 28.549999999999997 20.695 45-49 23.630000000000003 27.439999999999998 28.455000000000002 20.474999999999998 50-54 23.294999999999998 28.205000000000002 27.875 20.625 55-59 23.244999999999997 27.54 28.244999999999997 20.97 60-64 23.44 27.68 28.189999999999998 20.69 65-69 23.225 27.665 28.435 20.674999999999997 70-74 24.104999999999997 27.229999999999997 28.37 20.294999999999998 75-79 22.865 27.284999999999997 28.499999999999996 21.349999999999998 80-84 23.49 28.01 27.48 21.02 85-89 23.985 27.894999999999996 27.779999999999998 20.34 90-94 23.66 27.544999999999998 28.42 20.375 95-99 24.535 27.46 27.865000000000002 20.14 100-104 24.295 27.694999999999997 27.71 20.3 105-109 23.955000000000002 27.88 27.72 20.445 110-114 24.41 28.605000000000004 26.76 20.225 115-119 24.77 28.68 26.655 19.895 120-124 24.82 28.050000000000004 27.05 20.080000000000002 125-129 25.3 28.07 26.590000000000003 20.04 130-134 25.53 28.610000000000003 26.33 19.53 135-139 25.3 28.73 26.235000000000003 19.735 140-144 26.1 28.349999999999998 25.679999999999996 19.869999999999997 145-149 26.02 27.96 26.1 19.919999999999998 150-151 26.9625 28.1125 25.6 19.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 2.0 23 2.5 24 4.0 25 5.0 26 2.0 27 5.0 28 12.0 29 14.0 30 17.5 31 23.0 32 27.5 33 37.5 34 53.5 35 73.0 36 92.5 37 109.0 38 135.0 39 158.0 40 189.5 41 221.0 42 246.5 43 265.0 44 283.0 45 273.5 46 251.0 47 228.0 48 208.0 49 204.5 50 173.5 51 136.0 52 113.0 53 97.0 54 74.0 55 59.5 56 45.5 57 35.5 58 33.0 59 26.0 60 17.5 61 11.0 62 7.0 63 4.5 64 3.0 65 1.5 66 1.5 67 1.5 68 0.0 69 0.0 70 1.0 71 1.0 72 0.0 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.5 79 1.0 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.9 #Duplication Level Percentage of deduplicated Percentage of total 1 86.93901035673187 75.55 2 11.306098964326813 19.650000000000002 3 1.524741081703107 3.975 4 0.20138089758342925 0.7000000000000001 5 0.028768699654775604 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCAGAACAAAGCAGACAACTGAGCAGCTGTACAAGCATGTAGATGGCGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.2875 0.0 0.0 0.0 0.0 78-79 0.35 0.0 0.0 0.0 0.0 80-81 0.48750000000000004 0.0 0.0 0.0 0.0 82-83 0.625 0.0 0.0 0.0 0.0 84-85 0.8 0.0 0.0 0.0 0.0 86-87 0.9 0.0 0.0 0.0 0.0 88-89 1.05 0.0 0.0 0.0 0.0 90-91 1.1625 0.0 0.0 0.0 0.0 92-93 1.3875 0.0 0.0 0.0 0.0 94-95 1.65 0.0 0.0 0.0 0.0 96-97 1.8875 0.0 0.0 0.0 0.0 98-99 2.2874999999999996 0.0 0.0 0.0 0.0 100-101 2.625 0.0 0.0 0.0 0.0 102-103 2.9749999999999996 0.0 0.0 0.0 0.0 104-105 3.4125 0.0 0.0 0.0 0.0 106-107 3.7875 0.0 0.0 0.0 0.0 108-109 4.35 0.0 0.0 0.0 0.0 110-111 4.975 0.0 0.0 0.0 0.0 112-113 5.525 0.0 0.0 0.0 0.0 114-115 6.112500000000001 0.0 0.0 0.0 0.0 116-117 6.824999999999999 0.0 0.0 0.0 0.0 118-119 7.4375 0.0 0.0 0.0 0.0 120-121 8.1625 0.0 0.0 0.0 0.0 122-123 8.8875 0.0 0.0 0.0 0.0 124-125 9.825 0.0 0.0 0.0 0.0 126-127 10.5625 0.0 0.0 0.0 0.0 128-129 11.5125 0.0 0.0 0.0 0.0 130-131 12.350000000000001 0.0 0.0 0.0 0.0 132-133 13.212499999999999 0.0 0.0 0.0 0.0 134-135 13.9375 0.0 0.0 0.0 0.0 136-137 15.0125 0.0 0.0 0.0 0.0 138-139 15.899999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGAGACT 10 0.006830828 145.0 5 TTTGAGA 10 0.006830828 145.0 3 AGGAAGG 10 0.006830828 145.0 2 TTGAGAC 10 0.006830828 145.0 4 GATTGCA 10 0.006830828 145.0 6 GACTGTC 10 0.006830828 145.0 8 AGACTGT 10 0.006830828 145.0 7 >>END_MODULE Read 1805155 spots for SRR28623257.sra Written 1805155 spots for SRR28623257.sra Read 1805155 spots for SRR28623257.sra Written 1805155 spots for SRR28623257.sra Read 1805155 spots for SRR28623257.sra Written 1805155 spots for SRR28623257.sra Read 1805155 spots for SRR28623257.sra Written 1805155 spots for SRR28623257.sra Read 1805155 spots for SRR28623257.sra Written 1805155 spots for SRR28623257.sra Read 1805155 spots for SRR28623257.sra Written 1805155 spots for SRR28623257.sra Read 1805155 spots for SRR28623257.sra Written 1805155 spots for SRR28623257.sra Read 1805155 spots for SRR28623257.sra Written 1805155 spots for SRR28623257.sra Read 1805155 spots for SRR28623257.sra Written 1805155 spots for SRR28623257.sra Read 1805155 spots for SRR28623257.sra Written 1805155 spots for SRR28623257.sra Read 1805155 spots for SRR28623257.sra Written 1805155 spots for SRR28623257.sra Read 1805169 spots for SRR28623257.sra Written 1805169 spots for SRR28623257.sra Read 1805155 spots for SRR28623257.sra Written 1805155 spots for SRR28623257.sra Read 1805155 spots for SRR28623257.sra Written 1805155 spots for SRR28623257.sra Read 1805155 spots for SRR28623257.sra Written 1805155 spots for SRR28623257.sra Read 1805155 spots for SRR28623257.sra Written 1805155 spots for SRR28623257.sra Read 1805155 spots for SRR28623257.sra Written 1805155 spots for SRR28623257.sra Read 1805155 spots for SRR28623257.sra Written 1805155 spots for SRR28623257.sra Read 1805155 spots for SRR28623257.sra Written 1805155 spots for SRR28623257.sra Read 1805155 spots for SRR28623257.sra Written 1805155 spots for SRR28623257.sra SRR ids: ['SRR28623257.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m8byled0 SRR28623257.sra spots: 36103114 blocks: [[1, 1805155], [1805156, 3610310], [3610311, 5415465], [5415466, 7220620], [7220621, 9025775], [9025776, 10830930], [10830931, 12636085], [12636086, 14441240], [14441241, 16246395], [16246396, 18051550], [18051551, 19856705], [19856706, 21661860], [21661861, 23467015], [23467016, 25272170], [25272171, 27077325], [27077326, 28882480], [28882481, 30687635], [30687636, 32492790], [32492791, 34297945], [34297946, 36103114]] SRR28623257 file size 13332672 SRR28623257 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623257 SRR28623257_1.fastq SRR28623257_2.fastq Input file: SRR28623257_1.fastq Paired file: SRR28623257_2.fastq trimmed: SRR28623257-trimmed-pair1.fastq, SRR28623257-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 11:38:24 2025 >> started Tue Feb 11 11:39:07 2025 >> done (43.276s) 36103114 read pairs processed; of these: 15 ( 0.00%) short read pairs filtered out after trimming by size control 16277 ( 0.05%) empty read pairs filtered out after trimming by size control 36086822 (99.95%) read pairs available; of these: 7119604 (19.73%) trimmed read pairs available after processing 28967218 (80.27%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 0 0.00% 20 4 0.00% 21 5 0.00% 22 4 0.00% 23 0 0.00% 24 1 0.00% 25 5 0.00% 26 3 0.00% 27 5 0.00% 28 5 0.00% 29 13 0.00% 30 2 0.00% 31 7 0.00% 32 11 0.00% 33 20 0.00% 34 21 0.00% 35 21 0.00% 36 13 0.00% 37 27 0.00% 38 45 0.00% 39 47 0.00% 40 55 0.00% 41 59 0.00% 42 76 0.00% 43 121 0.00% 44 114 0.00% 45 131 0.00% 46 149 0.00% 47 187 0.00% 48 198 0.00% 49 213 0.00% 50 276 0.00% 51 354 0.00% 52 354 0.00% 53 405 0.00% 54 460 0.00% 55 472 0.00% 56 595 0.00% 57 694 0.00% 58 756 0.00% 59 944 0.00% 60 1042 0.00% 61 1294 0.00% 62 1465 0.00% 63 1680 0.00% 64 1870 0.01% 65 2205 0.01% 66 2308 0.01% 67 2726 0.01% 68 3047 0.01% 69 3473 0.01% 70 3949 0.01% 71 4793 0.01% 72 5359 0.01% 73 6283 0.02% 74 6954 0.02% 75 7882 0.02% 76 9031 0.03% 77 9927 0.03% 78 10952 0.03% 79 12287 0.03% 80 13570 0.04% 81 15350 0.04% 82 17225 0.05% 83 19103 0.05% 84 21594 0.06% 85 23607 0.07% 86 25834 0.07% 87 28076 0.08% 88 30212 0.08% 89 32220 0.09% 90 34847 0.10% 91 37373 0.10% 92 40108 0.11% 93 43307 0.12% 94 46743 0.13% 95 49930 0.14% 96 53322 0.15% 97 56309 0.16% 98 58599 0.16% 99 60710 0.17% 100 63588 0.18% 101 65199 0.18% 102 69054 0.19% 103 72367 0.20% 104 75866 0.21% 105 79078 0.22% 106 82056 0.23% 107 85219 0.24% 108 87497 0.24% 109 90740 0.25% 110 92425 0.26% 111 95026 0.26% 112 97618 0.27% 113 98994 0.27% 114 102939 0.29% 115 106525 0.30% 116 108897 0.30% 117 111753 0.31% 118 116205 0.32% 119 117190 0.32% 120 119104 0.33% 121 119985 0.33% 122 121567 0.34% 123 123738 0.34% 124 126744 0.35% 125 127831 0.35% 126 131359 0.36% 127 133970 0.37% 128 135322 0.37% 129 138120 0.38% 130 140164 0.39% 131 140071 0.39% 132 142016 0.39% 133 143824 0.40% 134 143897 0.40% 135 145398 0.40% 136 146962 0.41% 137 149325 0.41% 138 151848 0.42% 139 154601 0.43% 140 153300 0.42% 141 157017 0.44% 142 156782 0.43% 143 156713 0.43% 144 157988 0.44% 145 157754 0.44% 146 159725 0.44% 147 160900 0.45% 148 163269 0.45% 149 162528 0.45% 150 166104 0.46% 151 28967218 80.27% 36086822 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=26 prefix-density=0.35 prefix-fanout=2.2 sequence=CACTTGCAGCCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=38 fanout-score=237.48 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=15.9 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.58 fanout-score-rank=32 prefix-density=0.54 prefix-fanout=2.5 sequence=TGCAAGTGCGGCAGCGGCTGTGGAGGATGCAAGATGTACCCTGACATGAGCTCCTCAGAGACGATCACCAACGAAACTCTGGTTCTTGGTGTGGCACCAGAGAAGGGTCACTTTGCGGGAGCTGCTGAGACGGTCGTGGGAGCCGAGAATGGCTGCAAGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=45 fanout-score=104.70 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=5.8 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACC SRR28623257 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 11:39:52 Started mapping on | Feb 11 11:39:52 Finished on | Feb 11 11:44:11 Mapping speed, Million of reads per hour | 501.59 Number of input reads | 36086822 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 33679731 Uniquely mapped reads % | 93.33% Average mapped length | 290.04 Number of splices: Total | 32018024 Number of splices: Annotated (sjdb) | 31302018 Number of splices: GT/AG | 31325149 Number of splices: GC/AG | 574624 Number of splices: AT/AC | 23391 Number of splices: Non-canonical | 94860 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.04% Deletion average length | 2.27 Insertion rate per base | 0.02% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1040561 % of reads mapped to multiple loci | 2.88% Number of reads mapped to too many loci | 265877 % of reads mapped to too many loci | 0.74% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.83% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1366530 1366530 1366530 N_multimapping 1040561 1040561 1040561 N_noFeature 1251667 33166378 1450823 N_ambiguous 523415 2251 207754 UnstrandedReadsAssigned:31904649 PositiveStrandReadsAssigned:511102 NegativeStrandReadsAssigned:32021154 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR28623257 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623257-trimmed-pair1.fastq SRR28623257-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,086,822 reads, 32,413,205 reads pseudoaligned [quant] estimated average fragment length: 216.313 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,053 rounds 52401 SRR28623257.ke.tsv 34699 SRR28623257.se.tsv 87100 total ==> SRR28623257.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1802.69 1186 18.6035 Potri.005G024800.1.v4.1 1035 819.687 465 16.0411 Potri.004G059700.1.v4.1 961 745.708 31 1.1755 Potri.007G009000.2.v4.1 1416 1200.69 0 0 Potri.003G141000.2.v4.1 2943 2727.69 1748.52 18.1262 Potri.016G087400.1.v4.1 270 97.0176 1994.45 581.303 Potri.015G069301.1.v4.1 564 352.652 0 0 Potri.010G195200.1.v4.1 1773 1557.69 12 0.217837 Potri.012G127500.1.v4.1 977 761.708 106 3.93502 ==> SRR28623257.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1301 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 472 Potri.001G212900.v4.1 52 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 17 SRR28623257 completed mapping pipeline successfully