Starting /dee2/code/volunteer_pipeline.sh SRR28623258 current disk space = 3051320320000 free memory = 1179073540 SRR28623258 SRAfilesize 1cd16fe1a3bdc69495e4549ae96b631f SRR28623258.sra SRR28623258.sra file validated SRR28623258 is paired end SRR28623258 is conventional basespace SRR28623258 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623258_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.44125 37.0 37.0 37.0 37.0 37.0 2 36.4765 37.0 37.0 37.0 37.0 37.0 3 36.523 37.0 37.0 37.0 37.0 37.0 4 36.6275 37.0 37.0 37.0 37.0 37.0 5 36.672 37.0 37.0 37.0 37.0 37.0 6 36.636 37.0 37.0 37.0 37.0 37.0 7 36.63 37.0 37.0 37.0 37.0 37.0 8 36.4355 37.0 37.0 37.0 37.0 37.0 9 36.5375 37.0 37.0 37.0 37.0 37.0 10-14 36.613800000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.5904 37.0 37.0 37.0 37.0 37.0 20-24 36.5395 37.0 37.0 37.0 37.0 37.0 25-29 36.506 37.0 37.0 37.0 37.0 37.0 30-34 36.495400000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.4286 37.0 37.0 37.0 37.0 37.0 40-44 36.4525 37.0 37.0 37.0 37.0 37.0 45-49 36.3912 37.0 37.0 37.0 37.0 37.0 50-54 36.390100000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.3196 37.0 37.0 37.0 37.0 37.0 60-64 36.3526 37.0 37.0 37.0 37.0 37.0 65-69 36.280899999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.2308 37.0 37.0 37.0 37.0 37.0 75-79 36.1958 37.0 37.0 37.0 37.0 37.0 80-84 36.1241 37.0 37.0 37.0 37.0 37.0 85-89 36.1668 37.0 37.0 37.0 37.0 37.0 90-94 36.1791 37.0 37.0 37.0 37.0 37.0 95-99 35.9807 37.0 37.0 37.0 37.0 37.0 100-104 35.967999999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.98460000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.860499999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.916000000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.727799999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.690999999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.8317 37.0 37.0 37.0 37.0 37.0 135-139 35.606 37.0 37.0 37.0 37.0 37.0 140-144 35.402300000000004 37.0 37.0 37.0 34.6 37.0 145-149 35.374500000000005 37.0 37.0 37.0 37.0 37.0 150-151 35.2215 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 2.0 22 0.0 23 2.0 24 2.0 25 4.0 26 10.0 27 8.0 28 12.0 29 23.0 30 34.0 31 39.0 32 55.0 33 74.0 34 136.0 35 398.0 36 2893.0 37 307.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.24279629165623 14.156852919067903 8.74467551991982 35.855675269356055 2 20.95 14.799999999999999 35.0 29.25 3 16.575 19.05 31.075000000000003 33.300000000000004 4 21.375 27.925 25.0 25.7 5 23.974999999999998 33.6 22.5 19.925 6 20.0 37.7 22.425 19.875 7 16.125 26.55 41.675000000000004 15.65 8 17.5 25.924999999999997 31.85 24.725 9 18.0 23.95 35.0 23.05 10-14 19.38 30.240000000000002 27.79 22.59 15-19 19.805 29.39 28.244999999999997 22.56 20-24 19.759999999999998 29.085 28.015 23.14 25-29 20.205000000000002 28.735 27.634999999999998 23.425 30-34 19.139999999999997 29.54 28.595 22.725 35-39 19.8 29.060000000000002 27.97 23.169999999999998 40-44 19.45 30.0 27.700000000000003 22.85 45-49 19.185 30.154999999999998 27.655 23.005 50-54 19.71 28.99 28.01 23.29 55-59 19.725 29.15 27.735 23.39 60-64 20.175 29.49 27.195000000000004 23.14 65-69 19.975 29.53 27.26 23.235 70-74 19.55 28.79 28.470000000000002 23.189999999999998 75-79 19.545 28.53 28.38 23.544999999999998 80-84 19.8 29.25 27.595 23.355 85-89 20.135 28.845 28.07 22.95 90-94 20.555 29.14 27.029999999999998 23.275000000000002 95-99 20.085 29.68 27.084999999999997 23.150000000000002 100-104 20.715 28.875 26.66 23.75 105-109 20.419999999999998 28.595 27.715 23.27 110-114 20.26 29.965000000000003 27.455000000000002 22.32 115-119 20.549999999999997 28.910000000000004 26.91 23.630000000000003 120-124 20.41 29.23 26.71 23.65 125-129 20.73 28.67 26.72 23.880000000000003 130-134 20.72 28.83 27.315 23.135 135-139 20.544999999999998 28.610000000000003 26.97 23.875 140-144 21.08 28.395 26.935 23.59 145-149 20.77 27.750000000000004 27.615000000000002 23.865 150-151 21.4875 27.5875 26.5625 24.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 1.5 20 2.0 21 0.5 22 0.5 23 4.5 24 5.5 25 3.0 26 4.5 27 7.5 28 13.0 29 22.5 30 30.0 31 31.5 32 37.0 33 53.5 34 67.0 35 79.5 36 112.0 37 137.5 38 153.5 39 181.5 40 199.0 41 228.5 42 262.5 43 279.0 44 276.0 45 258.5 46 249.5 47 236.5 48 211.0 49 169.5 50 134.5 51 115.0 52 97.5 53 86.0 54 71.0 55 48.5 56 33.0 57 24.0 58 17.0 59 11.0 60 10.0 61 9.0 62 5.0 63 4.0 64 3.0 65 2.5 66 3.0 67 2.0 68 1.0 69 2.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.675 #Duplication Level Percentage of deduplicated Percentage of total 1 84.13504631012847 70.39999999999999 2 12.847325963549446 21.5 3 2.5395876904690766 6.375 4 0.358530026889752 1.2 5 0.089632506722438 0.375 6 0.029877502240812665 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCCTTATTTGCAGATCACAAACTCTGAAAAAGCTAGAGATAAAACTTAA 6 0.15 No Hit CAGTTGGGAGGGAATTAAACTTCCTCATGAACACAACAGAAAGCCAAAAG 5 0.125 No Hit CTCGACGACCACATTATAGAACTTCTGGATATCAAACAGCATTCTGTCAT 5 0.125 No Hit CCCACCCATTCCTCCTAAAAGCTAATATTAACAGTGCCTAAGCAAAGATA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.5625 0.0 0.0 0.0 0.0 88-89 0.6375 0.0 0.0 0.0 0.0 90-91 0.775 0.0 0.0 0.0 0.0 92-93 0.8625 0.0 0.0 0.0 0.0 94-95 1.0625 0.0 0.0 0.0 0.0 96-97 1.3125 0.0 0.0 0.0 0.0 98-99 1.525 0.0 0.0 0.0 0.0 100-101 1.675 0.0 0.0 0.0 0.0 102-103 1.8625 0.0 0.0 0.0 0.0 104-105 2.2 0.0 0.0 0.0 0.0 106-107 2.425 0.0 0.0 0.0 0.0 108-109 2.725 0.0 0.0 0.0 0.0 110-111 3.0375 0.0 0.0 0.0 0.0 112-113 3.425 0.0 0.0 0.0 0.0 114-115 3.9 0.0 0.0 0.0 0.0 116-117 4.3625 0.0 0.0 0.0 0.0 118-119 4.7625 0.0 0.0 0.0 0.0 120-121 5.2125 0.0 0.0 0.0 0.0 122-123 5.6875 0.0 0.0 0.0 0.0 124-125 6.2875 0.0 0.0 0.0 0.0 126-127 6.800000000000001 0.0 0.0 0.0 0.0 128-129 7.362500000000001 0.0 0.0 0.0 0.0 130-131 8.1 0.0 0.0 0.0 0.0 132-133 8.6625 0.0 0.0 0.0 0.0 134-135 9.55 0.0 0.0 0.0 0.0 136-137 10.325 0.0 0.0 0.0 0.0 138-139 10.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTATTTC 10 0.006830828 145.0 1 >>END_MODULE SRR28623258 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623258_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.4085 37.0 37.0 37.0 37.0 37.0 2 36.0305 37.0 37.0 37.0 37.0 37.0 3 36.094 37.0 37.0 37.0 37.0 37.0 4 35.9445 37.0 37.0 37.0 37.0 37.0 5 36.107 37.0 37.0 37.0 37.0 37.0 6 36.1075 37.0 37.0 37.0 37.0 37.0 7 36.074 37.0 37.0 37.0 37.0 37.0 8 35.996 37.0 37.0 37.0 37.0 37.0 9 36.0735 37.0 37.0 37.0 37.0 37.0 10-14 35.976699999999994 37.0 37.0 37.0 37.0 37.0 15-19 35.9747 37.0 37.0 37.0 37.0 37.0 20-24 35.951499999999996 37.0 37.0 37.0 37.0 37.0 25-29 35.874399999999994 37.0 37.0 37.0 37.0 37.0 30-34 35.7669 37.0 37.0 37.0 37.0 37.0 35-39 35.838 37.0 37.0 37.0 37.0 37.0 40-44 35.800599999999996 37.0 37.0 37.0 37.0 37.0 45-49 35.7977 37.0 37.0 37.0 37.0 37.0 50-54 35.761100000000006 37.0 37.0 37.0 37.0 37.0 55-59 35.5495 37.0 37.0 37.0 37.0 37.0 60-64 35.5838 37.0 37.0 37.0 37.0 37.0 65-69 35.6193 37.0 37.0 37.0 37.0 37.0 70-74 35.6454 37.0 37.0 37.0 37.0 37.0 75-79 35.643299999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.519600000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.5053 37.0 37.0 37.0 37.0 37.0 90-94 35.42569999999999 37.0 37.0 37.0 34.6 37.0 95-99 35.3445 37.0 37.0 37.0 34.6 37.0 100-104 35.297200000000004 37.0 37.0 37.0 32.2 37.0 105-109 35.26559999999999 37.0 37.0 37.0 32.2 37.0 110-114 35.3355 37.0 37.0 37.0 34.6 37.0 115-119 35.3078 37.0 37.0 37.0 34.6 37.0 120-124 35.2235 37.0 37.0 37.0 32.2 37.0 125-129 34.6858 37.0 37.0 37.0 25.0 37.0 130-134 35.050399999999996 37.0 37.0 37.0 25.0 37.0 135-139 34.870599999999996 37.0 37.0 37.0 25.0 37.0 140-144 34.9052 37.0 37.0 37.0 25.0 37.0 145-149 34.79699999999999 37.0 37.0 37.0 25.0 37.0 150-151 34.31225 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 9.0 15 7.0 16 7.0 17 3.0 18 4.0 19 2.0 20 1.0 21 8.0 22 12.0 23 7.0 24 8.0 25 10.0 26 13.0 27 16.0 28 17.0 29 27.0 30 28.0 31 49.0 32 67.0 33 115.0 34 275.0 35 810.0 36 2295.0 37 208.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.7 22.55 11.575000000000001 22.175 2 31.900000000000002 24.2 28.249999999999996 15.65 3 23.625 28.449999999999996 30.349999999999998 17.575 4 25.525 33.275 23.549999999999997 17.65 5 23.974999999999998 35.85 23.549999999999997 16.625 6 20.974999999999998 37.875 23.775 17.375 7 21.6 19.35 39.550000000000004 19.5 8 22.8 25.374999999999996 28.075 23.75 9 22.8 26.174999999999997 29.299999999999997 21.725 10-14 25.074999999999996 29.01 26.174999999999997 19.74 15-19 23.84 27.325 28.53 20.305 20-24 23.655 28.875 27.474999999999998 19.994999999999997 25-29 23.61 28.349999999999998 27.6 20.44 30-34 23.705000000000002 28.32 28.134999999999998 19.84 35-39 24.099999999999998 28.585 27.495000000000005 19.82 40-44 23.095 28.060000000000002 28.444999999999997 20.4 45-49 23.345 28.470000000000002 27.92 20.265 50-54 23.119999999999997 28.425 28.299999999999997 20.155 55-59 23.105 27.634999999999998 28.470000000000002 20.79 60-64 22.685 28.970000000000002 27.994999999999997 20.349999999999998 65-69 23.330000000000002 28.605000000000004 27.71 20.355 70-74 23.28 28.575 28.050000000000004 20.095 75-79 22.900000000000002 28.705000000000002 28.544999999999998 19.85 80-84 24.005000000000003 27.825 28.185 19.985 85-89 23.96 28.360000000000003 28.325 19.355 90-94 22.845 28.835 28.09 20.23 95-99 23.365 28.549999999999997 28.17 19.915 100-104 24.115000000000002 28.985 27.275 19.625 105-109 24.58 28.199999999999996 28.075 19.145 110-114 24.33 28.325 27.800000000000004 19.545 115-119 23.805 29.03 28.005000000000003 19.16 120-124 23.93 28.53 28.325 19.215 125-129 24.805 28.115000000000002 27.975 19.105 130-134 25.27 27.529999999999998 27.915 19.285 135-139 25.569999999999997 28.345 27.134999999999998 18.95 140-144 25.124999999999996 28.410000000000004 27.894999999999996 18.57 145-149 26.090000000000003 27.92 27.284999999999997 18.705 150-151 26.687499999999996 28.212500000000002 26.8125 18.2875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 1.5 14 2.5 15 1.0 16 1.0 17 1.5 18 1.0 19 1.0 20 2.0 21 2.5 22 2.0 23 1.5 24 1.0 25 2.5 26 4.0 27 6.5 28 12.5 29 18.5 30 21.5 31 24.5 32 36.5 33 48.5 34 62.0 35 72.0 36 89.5 37 120.0 38 140.5 39 163.0 40 188.5 41 224.5 42 246.5 43 272.0 44 300.5 45 301.0 46 264.0 47 237.5 48 230.5 49 185.0 50 154.0 51 128.5 52 92.5 53 69.0 54 57.5 55 48.5 56 32.0 57 24.0 58 20.5 59 13.5 60 12.0 61 8.5 62 5.0 63 4.0 64 2.0 65 3.0 66 2.5 67 2.0 68 2.0 69 1.0 70 3.0 71 3.5 72 2.0 73 1.5 74 0.5 75 0.5 76 1.5 77 1.5 78 0.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 1.0 98 1.0 99 0.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.475 #Duplication Level Percentage of deduplicated Percentage of total 1 85.3211009174312 72.075 2 11.77863273157739 19.900000000000002 3 2.3971589227582126 6.075 4 0.3551346552234389 1.2 5 0.08878366380585972 0.375 6 0.029594554601953243 0.15 7 0.0 0.0 8 0.0 0.0 9 0.029594554601953243 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit AGGAGATTGGGGCATCCTCAAAGTCATCTTCTGTTTTCATCCCTCATGGA 6 0.15 No Hit GAAAACTATCTTCACCGTATTGGACGAAGTGGACGGTTTGGAAGAAAGGG 5 0.125 No Hit GGAGTTGCTGTCTACTTTCGACGCTCCGGCTTGGAGGTGTTGTTTTTGTT 5 0.125 No Hit GGAGGGCCTGCGGATCGACCACTGGATTATGATTTCGGATTCCCAGTCTG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.3875 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.6125 0.0 0.0 0.0 0.0 88-89 0.6875 0.0 0.0 0.0 0.0 90-91 0.825 0.0 0.0 0.0 0.0 92-93 0.9125000000000001 0.0 0.0 0.0 0.0 94-95 1.1124999999999998 0.0 0.0 0.0 0.0 96-97 1.3624999999999998 0.0 0.0 0.0 0.0 98-99 1.575 0.0 0.0 0.0 0.0 100-101 1.725 0.0 0.0 0.0 0.0 102-103 1.925 0.0 0.0 0.0 0.0 104-105 2.2875 0.0 0.0 0.0 0.0 106-107 2.5125 0.0 0.0 0.0 0.0 108-109 2.8 0.0 0.0 0.0 0.0 110-111 3.125 0.0 0.0 0.0 0.0 112-113 3.525 0.0 0.0 0.0 0.0 114-115 3.9875 0.0 0.0 0.0 0.0 116-117 4.4375 0.0 0.0 0.0 0.0 118-119 4.85 0.0 0.0 0.0 0.0 120-121 5.300000000000001 0.0 0.0 0.0 0.0 122-123 5.7375 0.0 0.0 0.0 0.0 124-125 6.3375 0.0 0.0 0.0 0.0 126-127 6.8125 0.0 0.0 0.0 0.0 128-129 7.362500000000001 0.0 0.0 0.0 0.0 130-131 8.0625 0.0 0.0 0.0 0.0 132-133 8.5875 0.0 0.0 0.0 0.0 134-135 9.462499999999999 0.0 0.0 0.0 0.0 136-137 10.25 0.0 0.0 0.0 0.0 138-139 10.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTGGTG 10 0.006830828 145.0 7 ACAACTG 10 0.006830828 145.0 6 >>END_MODULE Read 1850774 spots for SRR28623258.sra Written 1850774 spots for SRR28623258.sra Read 1850774 spots for SRR28623258.sra Written 1850774 spots for SRR28623258.sra Read 1850774 spots for SRR28623258.sra Written 1850774 spots for SRR28623258.sra Read 1850774 spots for SRR28623258.sra Written 1850774 spots for SRR28623258.sra Read 1850774 spots for SRR28623258.sra Written 1850774 spots for SRR28623258.sra Read 1850774 spots for SRR28623258.sra Written 1850774 spots for SRR28623258.sra Read 1850774 spots for SRR28623258.sra Written 1850774 spots for SRR28623258.sra Read 1850774 spots for SRR28623258.sra Written 1850774 spots for SRR28623258.sra Read 1850774 spots for SRR28623258.sra Written 1850774 spots for SRR28623258.sra Read 1850774 spots for SRR28623258.sra Written 1850774 spots for SRR28623258.sra Read 1850777 spots for SRR28623258.sra Written 1850777 spots for SRR28623258.sra Read 1850774 spots for SRR28623258.sra Written 1850774 spots for SRR28623258.sra Read 1850774 spots for SRR28623258.sra Written 1850774 spots for SRR28623258.sra Read 1850774 spots for SRR28623258.sra Written 1850774 spots for SRR28623258.sra Read 1850774 spots for SRR28623258.sra Written 1850774 spots for SRR28623258.sra Read 1850774 spots for SRR28623258.sra Written 1850774 spots for SRR28623258.sra Read 1850774 spots for SRR28623258.sra Written 1850774 spots for SRR28623258.sra Read 1850774 spots for SRR28623258.sra Written 1850774 spots for SRR28623258.sra Read 1850774 spots for SRR28623258.sra Written 1850774 spots for SRR28623258.sra Read 1850774 spots for SRR28623258.sra Written 1850774 spots for SRR28623258.sra SRR ids: ['SRR28623258.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_web9khap SRR28623258.sra spots: 37015483 blocks: [[1, 1850774], [1850775, 3701548], [3701549, 5552322], [5552323, 7403096], [7403097, 9253870], [9253871, 11104644], [11104645, 12955418], [12955419, 14806192], [14806193, 16656966], [16656967, 18507740], [18507741, 20358514], [20358515, 22209288], [22209289, 24060062], [24060063, 25910836], [25910837, 27761610], [27761611, 29612384], [29612385, 31463158], [31463159, 33313932], [33313933, 35164706], [35164707, 37015483]] SRR28623258 file size 13669872 SRR28623258 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623258 SRR28623258_1.fastq SRR28623258_2.fastq Input file: SRR28623258_1.fastq Paired file: SRR28623258_2.fastq trimmed: SRR28623258-trimmed-pair1.fastq, SRR28623258-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 11:58:07 2025 >> started Tue Feb 11 11:58:52 2025 >> done (45.601s) 37015483 read pairs processed; of these: 19 ( 0.00%) short read pairs filtered out after trimming by size control 16854 ( 0.05%) empty read pairs filtered out after trimming by size control 36998610 (99.95%) read pairs available; of these: 5726596 (15.48%) trimmed read pairs available after processing 31272014 (84.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 5 0.00% 21 4 0.00% 22 11 0.00% 23 9 0.00% 24 3 0.00% 25 9 0.00% 26 8 0.00% 27 11 0.00% 28 7 0.00% 29 11 0.00% 30 13 0.00% 31 13 0.00% 32 18 0.00% 33 25 0.00% 34 15 0.00% 35 28 0.00% 36 38 0.00% 37 39 0.00% 38 33 0.00% 39 64 0.00% 40 60 0.00% 41 62 0.00% 42 64 0.00% 43 85 0.00% 44 89 0.00% 45 117 0.00% 46 127 0.00% 47 137 0.00% 48 162 0.00% 49 165 0.00% 50 236 0.00% 51 221 0.00% 52 293 0.00% 53 314 0.00% 54 351 0.00% 55 373 0.00% 56 403 0.00% 57 543 0.00% 58 583 0.00% 59 674 0.00% 60 797 0.00% 61 960 0.00% 62 1062 0.00% 63 1300 0.00% 64 1436 0.00% 65 1616 0.00% 66 1836 0.00% 67 1944 0.01% 68 2317 0.01% 69 2621 0.01% 70 3185 0.01% 71 3607 0.01% 72 4114 0.01% 73 4735 0.01% 74 5200 0.01% 75 5846 0.02% 76 6673 0.02% 77 7253 0.02% 78 8065 0.02% 79 8944 0.02% 80 10268 0.03% 81 11438 0.03% 82 12943 0.03% 83 14246 0.04% 84 16141 0.04% 85 17619 0.05% 86 18849 0.05% 87 20350 0.06% 88 21387 0.06% 89 23370 0.06% 90 25000 0.07% 91 27158 0.07% 92 29503 0.08% 93 32315 0.09% 94 34506 0.09% 95 37007 0.10% 96 38962 0.11% 97 40789 0.11% 98 42207 0.11% 99 44414 0.12% 100 46673 0.13% 101 48381 0.13% 102 51762 0.14% 103 54956 0.15% 104 56985 0.15% 105 59627 0.16% 106 61968 0.17% 107 64147 0.17% 108 65910 0.18% 109 67906 0.18% 110 69048 0.19% 111 71608 0.19% 112 74667 0.20% 113 77389 0.21% 114 79315 0.21% 115 82873 0.22% 116 85332 0.23% 117 87417 0.24% 118 88803 0.24% 119 90332 0.24% 120 92129 0.25% 121 93766 0.25% 122 96438 0.26% 123 98945 0.27% 124 102014 0.28% 125 103355 0.28% 126 106409 0.29% 127 108417 0.29% 128 110147 0.30% 129 110972 0.30% 130 113439 0.31% 131 113507 0.31% 132 116021 0.31% 133 118946 0.32% 134 119869 0.32% 135 123717 0.33% 136 125004 0.34% 137 126064 0.34% 138 128736 0.35% 139 129692 0.35% 140 128961 0.35% 141 131142 0.35% 142 131598 0.36% 143 134105 0.36% 144 137040 0.37% 145 138325 0.37% 146 138803 0.38% 147 140408 0.38% 148 141051 0.38% 149 141819 0.38% 150 143249 0.39% 151 31272014 84.52% 36998610 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=12.88 fanout-score-rank=19 prefix-density=0.12 prefix-fanout=12.9 sequence=GGATCGGAAGAGCACACGTCTGAACTCCAGTCACTTGTCGGTATCTCGTATGCCGTCTTCTGCTTG criterion=fanout-score sequence-density=0.06 sequence-density-rank=16 fanout-score=468.12 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=34.6 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=14.87 fanout-score-rank=16 prefix-density=0.16 prefix-fanout=14.9 sequence=GAGAGAGAGAGTTAAGACAATGGCCTCGAAGAAATCTGCAATCGTATTACCTGGTTCAAAGGTGTTGAAGCACATAGTTTTTGTACGGTTTAATGATGGGATCACTGATGAACAAATTGAGAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=21 fanout-score=510.17 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=33.4 sequence=AAGAAGAAGATG SRR28623258 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 11:59:40 Started mapping on | Feb 11 11:59:40 Finished on | Feb 11 12:03:29 Mapping speed, Million of reads per hour | 581.64 Number of input reads | 36998610 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 34482758 Uniquely mapped reads % | 93.20% Average mapped length | 292.16 Number of splices: Total | 30860710 Number of splices: Annotated (sjdb) | 30143576 Number of splices: GT/AG | 30337658 Number of splices: GC/AG | 402044 Number of splices: AT/AC | 26605 Number of splices: Non-canonical | 94403 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.96 Insertion rate per base | 0.03% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 961503 % of reads mapped to multiple loci | 2.60% Number of reads mapped to too many loci | 147302 % of reads mapped to too many loci | 0.40% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.58% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1554349 1554349 1554349 N_multimapping 961503 961503 961503 N_noFeature 1306603 34061772 1501389 N_ambiguous 425398 2675 197318 UnstrandedReadsAssigned:32750757 PositiveStrandReadsAssigned:418311 NegativeStrandReadsAssigned:32784051 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623258 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623258-trimmed-pair1.fastq SRR28623258-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,998,610 reads, 33,261,013 reads pseudoaligned [quant] estimated average fragment length: 227.479 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,183 rounds 52401 SRR28623258.ke.tsv 34699 SRR28623258.se.tsv 87100 total ==> SRR28623258.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.52 1197 20.1789 Potri.005G024800.1.v4.1 1035 808.521 404 15.0909 Potri.004G059700.1.v4.1 961 734.537 22 0.904555 Potri.007G009000.2.v4.1 1416 1189.52 0 0 Potri.003G141000.2.v4.1 2943 2716.52 1016.12 11.2968 Potri.016G087400.1.v4.1 270 92.5166 2779.94 907.491 Potri.015G069301.1.v4.1 564 342.048 0 0 Potri.010G195200.1.v4.1 1773 1546.52 45 0.878785 Potri.012G127500.1.v4.1 977 750.527 6952 279.75 ==> SRR28623258.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2412 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 436 Potri.001G212900.v4.1 85 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR28623258 completed mapping pipeline successfully