Starting /dee2/code/volunteer_pipeline.sh SRR28623259 current disk space = 3051071635456 free memory = 1470574744 SRR28623259 SRAfilesize 1b94c01df25ea27e9708f3198fc73f49 SRR28623259.sra SRR28623259.sra file validated SRR28623259 is paired end SRR28623259 is conventional basespace SRR28623259 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623259_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.37825 37.0 37.0 37.0 37.0 37.0 2 36.319 37.0 37.0 37.0 37.0 37.0 3 36.427 37.0 37.0 37.0 37.0 37.0 4 36.652 37.0 37.0 37.0 37.0 37.0 5 36.667 37.0 37.0 37.0 37.0 37.0 6 36.6455 37.0 37.0 37.0 37.0 37.0 7 36.564 37.0 37.0 37.0 37.0 37.0 8 36.347 37.0 37.0 37.0 37.0 37.0 9 36.5175 37.0 37.0 37.0 37.0 37.0 10-14 36.577 37.0 37.0 37.0 37.0 37.0 15-19 36.5452 37.0 37.0 37.0 37.0 37.0 20-24 36.5399 37.0 37.0 37.0 37.0 37.0 25-29 36.5314 37.0 37.0 37.0 37.0 37.0 30-34 36.511399999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.499 37.0 37.0 37.0 37.0 37.0 40-44 36.4178 37.0 37.0 37.0 37.0 37.0 45-49 36.335300000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.341899999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.255700000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.276300000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.263 37.0 37.0 37.0 37.0 37.0 70-74 36.2187 37.0 37.0 37.0 37.0 37.0 75-79 36.1492 37.0 37.0 37.0 37.0 37.0 80-84 36.0715 37.0 37.0 37.0 37.0 37.0 85-89 36.1037 37.0 37.0 37.0 37.0 37.0 90-94 36.084999999999994 37.0 37.0 37.0 37.0 37.0 95-99 35.971999999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.96660000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.972899999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.92229999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.8726 37.0 37.0 37.0 37.0 37.0 120-124 35.744899999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.6864 37.0 37.0 37.0 37.0 37.0 130-134 35.78060000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.6179 37.0 37.0 37.0 37.0 37.0 140-144 35.3866 37.0 37.0 37.0 34.6 37.0 145-149 35.3325 37.0 37.0 37.0 37.0 37.0 150-151 35.25625 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 2.0 23 6.0 24 5.0 25 3.0 26 6.0 27 7.0 28 11.0 29 17.0 30 35.0 31 34.0 32 65.0 33 84.0 34 144.0 35 369.0 36 2961.0 37 250.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.7229882175984 13.737778891952871 7.370268237653548 34.16896465279519 2 20.150000000000002 15.174999999999999 36.199999999999996 28.475 3 18.125 19.375 28.575 33.925 4 21.175 28.675 25.25 24.9 5 23.799999999999997 32.574999999999996 23.674999999999997 19.950000000000003 6 20.275000000000002 37.425000000000004 22.475 19.825 7 14.2 28.749999999999996 41.025 16.025 8 18.15 27.075 31.924999999999997 22.85 9 18.85 23.775 33.074999999999996 24.3 10-14 19.509999999999998 30.64 26.68 23.169999999999998 15-19 19.465 29.325000000000003 28.185 23.025000000000002 20-24 19.82 29.035 28.305000000000003 22.84 25-29 19.855 28.675 27.655 23.815 30-34 19.59 29.225 27.71 23.474999999999998 35-39 19.74 29.145 27.74 23.375 40-44 19.595000000000002 29.345 27.700000000000003 23.36 45-49 19.75 29.23 27.99 23.03 50-54 19.985 29.57 27.275 23.169999999999998 55-59 19.81 29.415000000000003 27.224999999999998 23.549999999999997 60-64 20.175 28.63 27.950000000000003 23.244999999999997 65-69 19.73 29.26 27.88 23.13 70-74 19.915 29.154999999999998 27.955000000000002 22.975 75-79 20.335 29.375 27.400000000000002 22.89 80-84 20.395 28.04 28.4 23.165 85-89 20.095 29.15 27.38 23.375 90-94 20.005 28.565 27.694999999999997 23.735 95-99 19.685 29.330000000000002 27.985 23.0 100-104 19.845 29.310000000000002 27.36 23.485 105-109 20.755000000000003 28.235 27.905 23.105 110-114 20.84 29.665000000000003 27.13 22.365 115-119 20.825 29.62 26.465 23.09 120-124 19.645000000000003 28.99 27.41 23.955000000000002 125-129 20.424999999999997 28.494999999999997 27.025 24.055 130-134 20.305 29.13 27.084999999999997 23.48 135-139 20.45 29.015 26.479999999999997 24.055 140-144 20.685000000000002 29.39 26.36 23.565 145-149 21.145 28.88 25.35 24.625 150-151 20.1625 29.4125 26.687499999999996 23.7375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 1.0 3 2.0 4 1.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 0.5 20 1.5 21 1.5 22 1.0 23 2.0 24 3.0 25 3.0 26 6.5 27 11.0 28 17.5 29 21.5 30 22.5 31 30.0 32 34.0 33 48.0 34 66.5 35 80.5 36 103.5 37 123.0 38 146.0 39 179.0 40 200.0 41 220.0 42 257.0 43 278.5 44 283.0 45 256.5 46 234.0 47 237.5 48 227.0 49 179.5 50 146.5 51 132.0 52 98.5 53 73.5 54 55.0 55 51.0 56 38.0 57 27.5 58 22.5 59 14.0 60 12.0 61 12.0 62 8.5 63 7.5 64 7.0 65 2.5 66 1.0 67 1.0 68 0.5 69 0.5 70 0.5 71 1.5 72 1.5 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.75 #Duplication Level Percentage of deduplicated Percentage of total 1 87.26224783861672 75.7 2 10.605187319884726 18.4 3 1.7867435158501441 4.65 4 0.2881844380403458 1.0 5 0.05763688760806917 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGTACCGAGTGTCCTGTCTGTGTCCTCTATCTCTGTCACTCTGCCTGTA 5 0.125 No Hit GAGATGATGGCTTTCTGTTTTCTGGTGATGGAGATCTGGCATCTGGAAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.3375 0.0 0.0 0.0 0.0 82-83 0.4125 0.0 0.0 0.0 0.0 84-85 0.5 0.0 0.0 0.0 0.0 86-87 0.55 0.0 0.0 0.0 0.0 88-89 0.625 0.0 0.0 0.0 0.0 90-91 0.7125 0.0 0.0 0.0 0.0 92-93 0.8625 0.0 0.0 0.0 0.0 94-95 0.95 0.0 0.0 0.0 0.0 96-97 1.0875 0.0 0.0 0.0 0.0 98-99 1.2 0.0 0.0 0.0 0.0 100-101 1.3375 0.0 0.0 0.0 0.0 102-103 1.575 0.0 0.0 0.0 0.0 104-105 1.8 0.0 0.0 0.0 0.0 106-107 2.2625 0.0 0.0 0.0 0.0 108-109 2.5999999999999996 0.0 0.0 0.0 0.0 110-111 3.075 0.0 0.0 0.0 0.0 112-113 3.3875 0.0 0.0 0.0 0.0 114-115 3.725 0.0 0.0 0.0 0.0 116-117 4.15 0.0 0.0 0.0 0.0 118-119 4.5375 0.0 0.0 0.0 0.0 120-121 4.975 0.0 0.0 0.0 0.0 122-123 5.6 0.0 0.0 0.0 0.0 124-125 6.1625 0.0 0.0 0.0 0.0 126-127 6.7125 0.0 0.0 0.0 0.0 128-129 7.300000000000001 0.0 0.0 0.0 0.0 130-131 7.6625 0.0 0.0 0.0 0.0 132-133 8.425 0.0 0.0 0.0 0.0 134-135 9.15 0.0 0.0 0.0 0.0 136-137 9.8375 0.0 0.0 0.0 0.0 138-139 10.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCCCAT 10 0.006830828 145.0 9 >>END_MODULE SRR28623259 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623259_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.5485 37.0 37.0 37.0 37.0 37.0 2 36.1445 37.0 37.0 37.0 37.0 37.0 3 36.252 37.0 37.0 37.0 37.0 37.0 4 36.1505 37.0 37.0 37.0 37.0 37.0 5 36.2355 37.0 37.0 37.0 37.0 37.0 6 36.287 37.0 37.0 37.0 37.0 37.0 7 36.3185 37.0 37.0 37.0 37.0 37.0 8 36.151 37.0 37.0 37.0 37.0 37.0 9 35.976 37.0 37.0 37.0 37.0 37.0 10-14 36.027100000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.0698 37.0 37.0 37.0 37.0 37.0 20-24 36.0464 37.0 37.0 37.0 37.0 37.0 25-29 36.0422 37.0 37.0 37.0 37.0 37.0 30-34 35.890100000000004 37.0 37.0 37.0 37.0 37.0 35-39 35.967 37.0 37.0 37.0 37.0 37.0 40-44 35.8431 37.0 37.0 37.0 37.0 37.0 45-49 35.8912 37.0 37.0 37.0 37.0 37.0 50-54 35.871300000000005 37.0 37.0 37.0 37.0 37.0 55-59 35.6959 37.0 37.0 37.0 37.0 37.0 60-64 35.731 37.0 37.0 37.0 37.0 37.0 65-69 35.7174 37.0 37.0 37.0 37.0 37.0 70-74 35.756899999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.749900000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.650999999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.6428 37.0 37.0 37.0 37.0 37.0 90-94 35.4987 37.0 37.0 37.0 37.0 37.0 95-99 35.558800000000005 37.0 37.0 37.0 34.6 37.0 100-104 35.4816 37.0 37.0 37.0 37.0 37.0 105-109 35.4293 37.0 37.0 37.0 37.0 37.0 110-114 35.4591 37.0 37.0 37.0 37.0 37.0 115-119 35.4312 37.0 37.0 37.0 37.0 37.0 120-124 35.4567 37.0 37.0 37.0 34.6 37.0 125-129 34.858 37.0 37.0 37.0 32.2 37.0 130-134 35.294 37.0 37.0 37.0 34.6 37.0 135-139 35.0417 37.0 37.0 37.0 25.0 37.0 140-144 35.0968 37.0 37.0 37.0 25.0 37.0 145-149 35.02 37.0 37.0 37.0 27.4 37.0 150-151 34.62375 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 6.0 14 6.0 15 4.0 16 1.0 17 3.0 18 1.0 19 4.0 20 7.0 21 4.0 22 7.0 23 5.0 24 6.0 25 14.0 26 7.0 27 13.0 28 11.0 29 17.0 30 40.0 31 58.0 32 78.0 33 134.0 34 206.0 35 678.0 36 2440.0 37 250.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.575 23.275000000000002 9.725 20.424999999999997 2 28.875 24.9 28.749999999999996 17.474999999999998 3 21.975 27.125 32.574999999999996 18.325 4 25.124999999999996 33.4 23.65 17.825 5 25.424999999999997 37.2 22.675 14.7 6 19.925 38.975 23.525 17.575 7 21.099999999999998 22.275 38.224999999999994 18.4 8 21.65 25.374999999999996 27.950000000000003 25.025 9 22.45 24.3 30.25 23.0 10-14 23.485 29.425 26.91 20.18 15-19 23.055 28.175 28.965000000000003 19.805 20-24 23.919999999999998 28.16 28.035 19.885 25-29 23.645 27.93 27.994999999999997 20.43 30-34 23.599999999999998 27.884999999999998 28.720000000000002 19.794999999999998 35-39 23.745 28.625 28.035 19.595000000000002 40-44 23.055 27.975 28.355000000000004 20.615 45-49 23.3 28.025 28.585 20.09 50-54 23.345 27.639999999999997 28.405 20.61 55-59 23.485 28.310000000000002 28.375 19.830000000000002 60-64 23.599999999999998 27.775 28.78 19.845 65-69 22.93 28.095 29.29 19.685 70-74 23.53 27.779999999999998 28.84 19.85 75-79 23.044999999999998 27.63 29.475 19.85 80-84 23.72 27.834999999999997 28.410000000000004 20.035 85-89 23.875 27.71 28.65 19.765 90-94 23.044999999999998 28.105000000000004 28.610000000000003 20.24 95-99 24.195 27.839999999999996 28.095 19.869999999999997 100-104 23.735 28.22 28.144999999999996 19.900000000000002 105-109 23.34 29.054999999999996 27.415 20.19 110-114 23.695 28.18 27.955000000000002 20.169999999999998 115-119 24.055 28.144999999999996 27.76 20.04 120-124 24.26 28.535 27.32 19.885 125-129 25.105 28.18 27.474999999999998 19.24 130-134 25.124999999999996 28.939999999999998 27.165 18.77 135-139 24.610000000000003 28.494999999999997 27.775 19.12 140-144 25.415 27.87 27.13 19.585 145-149 25.180000000000003 29.225 26.700000000000003 18.895 150-151 26.275 27.8625 27.150000000000002 18.712500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.5 17 0.5 18 0.5 19 1.5 20 1.5 21 0.5 22 1.0 23 3.5 24 4.0 25 4.0 26 7.0 27 12.0 28 16.0 29 15.0 30 14.0 31 27.0 32 40.0 33 46.0 34 55.0 35 60.0 36 83.5 37 118.5 38 155.0 39 187.5 40 204.0 41 241.5 42 284.0 43 288.0 44 273.5 45 273.0 46 257.0 47 235.5 48 208.0 49 183.5 50 156.5 51 116.5 52 96.5 53 70.5 54 51.0 55 41.0 56 29.0 57 24.5 58 23.0 59 17.5 60 12.5 61 10.0 62 6.0 63 5.0 64 4.5 65 2.0 66 1.5 67 2.0 68 1.5 69 0.5 70 2.0 71 2.5 72 1.5 73 1.5 74 1.0 75 0.5 76 0.5 77 0.5 78 1.0 79 1.0 80 0.5 81 0.0 82 0.0 83 0.5 84 1.0 85 1.0 86 1.0 87 0.5 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 1.0 98 1.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.425 #Duplication Level Percentage of deduplicated Percentage of total 1 88.10408921933085 77.025 2 9.894195024306548 17.299999999999997 3 1.658564483843294 4.35 4 0.25736345438947666 0.8999999999999999 5 0.028595939376608523 0.125 6 0.057191878753217046 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCGTGATCCAGATTACCAAATTGACAGAGAAAAGAAAGATGGAAAAGAG 6 0.15 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit GGGGATTGGAGAAATATCTCCCGCAATTATGTGACTACTAGGACGCCAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.3625 0.0 0.0 0.0 0.0 82-83 0.4375 0.0 0.0 0.0 0.0 84-85 0.525 0.0 0.0 0.0 0.0 86-87 0.575 0.0 0.0 0.0 0.0 88-89 0.65 0.0 0.0 0.0 0.0 90-91 0.75 0.0 0.0 0.0 0.0 92-93 0.9125000000000001 0.0 0.0 0.0 0.0 94-95 1.0 0.0 0.0 0.0 0.0 96-97 1.1375000000000002 0.0 0.0 0.0 0.0 98-99 1.25 0.0 0.0 0.0 0.0 100-101 1.4 0.0 0.0 0.0 0.0 102-103 1.6625 0.0 0.0 0.0 0.0 104-105 1.9 0.0 0.0 0.0 0.0 106-107 2.3125 0.0 0.0 0.0 0.0 108-109 2.6500000000000004 0.0 0.0 0.0 0.0 110-111 3.1624999999999996 0.0 0.0 0.0 0.0 112-113 3.5375 0.0 0.0 0.0 0.0 114-115 3.8875 0.0 0.0 0.0 0.0 116-117 4.3375 0.0 0.0 0.0 0.0 118-119 4.7625 0.0 0.0 0.0 0.0 120-121 5.199999999999999 0.0 0.0 0.0 0.0 122-123 5.8125 0.0 0.0 0.0 0.0 124-125 6.362500000000001 0.0 0.0 0.0 0.0 126-127 6.9125 0.0 0.0 0.0 0.0 128-129 7.5 0.0 0.0 0.0 0.0 130-131 7.9 0.0 0.0 0.0 0.0 132-133 8.725000000000001 0.0 0.0 0.0 0.0 134-135 9.425 0.0 0.0 0.0 0.0 136-137 10.125 0.0 0.0 0.0 0.0 138-139 10.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCACTG 10 0.006830828 145.0 3 >>END_MODULE Read 2600532 spots for SRR28623259.sra Written 2600532 spots for SRR28623259.sra Read 2600532 spots for SRR28623259.sra Written 2600532 spots for SRR28623259.sra Read 2600532 spots for SRR28623259.sra Written 2600532 spots for SRR28623259.sra Read 2600532 spots for SRR28623259.sra Written 2600532 spots for SRR28623259.sra Read 2600532 spots for SRR28623259.sra Written 2600532 spots for SRR28623259.sra Read 2600532 spots for SRR28623259.sra Written 2600532 spots for SRR28623259.sra Read 2600532 spots for SRR28623259.sra Written 2600532 spots for SRR28623259.sra Read 2600532 spots for SRR28623259.sra Written 2600532 spots for SRR28623259.sra Read 2600532 spots for SRR28623259.sra Written 2600532 spots for SRR28623259.sra Read 2600532 spots for SRR28623259.sra Written 2600532 spots for SRR28623259.sra Read 2600532 spots for SRR28623259.sra Written 2600532 spots for SRR28623259.sra Read 2600532 spots for SRR28623259.sra Written 2600532 spots for SRR28623259.sra Read 2600532 spots for SRR28623259.sra Written 2600532 spots for SRR28623259.sra Read 2600532 spots for SRR28623259.sra Written 2600532 spots for SRR28623259.sra Read 2600532 spots for SRR28623259.sra Written 2600532 spots for SRR28623259.sra Read 2600532 spots for SRR28623259.sra Written 2600532 spots for SRR28623259.sra Read 2600548 spots for SRR28623259.sra Written 2600548 spots for SRR28623259.sra Read 2600532 spots for SRR28623259.sra Written 2600532 spots for SRR28623259.sra Read 2600532 spots for SRR28623259.sra Written 2600532 spots for SRR28623259.sra Read 2600532 spots for SRR28623259.sra Written 2600532 spots for SRR28623259.sra SRR ids: ['SRR28623259.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_edwi7zcx SRR28623259.sra spots: 52010656 blocks: [[1, 2600532], [2600533, 5201064], [5201065, 7801596], [7801597, 10402128], [10402129, 13002660], [13002661, 15603192], [15603193, 18203724], [18203725, 20804256], [20804257, 23404788], [23404789, 26005320], [26005321, 28605852], [28605853, 31206384], [31206385, 33806916], [33806917, 36407448], [36407449, 39007980], [39007981, 41608512], [41608513, 44209044], [44209045, 46809576], [46809577, 49410108], [49410109, 52010656]] SRR28623259 file size 19212054 SRR28623259 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623259 SRR28623259_1.fastq SRR28623259_2.fastq Input file: SRR28623259_1.fastq Paired file: SRR28623259_2.fastq trimmed: SRR28623259-trimmed-pair1.fastq, SRR28623259-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:18:27 2025 >> started Tue Feb 11 12:19:35 2025 >> done (67.517s) 52010656 read pairs processed; of these: 55 ( 0.00%) short read pairs filtered out after trimming by size control 31717 ( 0.06%) empty read pairs filtered out after trimming by size control 51978884 (99.94%) read pairs available; of these: 6956782 (13.38%) trimmed read pairs available after processing 45022102 (86.62%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 13 0.00% 20 2 0.00% 21 8 0.00% 22 9 0.00% 23 10 0.00% 24 12 0.00% 25 13 0.00% 26 15 0.00% 27 10 0.00% 28 11 0.00% 29 21 0.00% 30 16 0.00% 31 19 0.00% 32 25 0.00% 33 20 0.00% 34 49 0.00% 35 27 0.00% 36 44 0.00% 37 43 0.00% 38 54 0.00% 39 65 0.00% 40 44 0.00% 41 59 0.00% 42 78 0.00% 43 107 0.00% 44 97 0.00% 45 127 0.00% 46 122 0.00% 47 150 0.00% 48 189 0.00% 49 316 0.00% 50 231 0.00% 51 300 0.00% 52 366 0.00% 53 355 0.00% 54 388 0.00% 55 472 0.00% 56 530 0.00% 57 665 0.00% 58 756 0.00% 59 842 0.00% 60 1097 0.00% 61 1143 0.00% 62 1287 0.00% 63 1503 0.00% 64 1698 0.00% 65 1910 0.00% 66 2171 0.00% 67 2589 0.00% 68 2851 0.01% 69 3352 0.01% 70 3988 0.01% 71 4319 0.01% 72 5294 0.01% 73 5880 0.01% 74 6550 0.01% 75 7323 0.01% 76 8427 0.02% 77 9206 0.02% 78 10518 0.02% 79 11274 0.02% 80 12567 0.02% 81 14507 0.03% 82 16284 0.03% 83 17733 0.03% 84 19811 0.04% 85 21679 0.04% 86 22954 0.04% 87 24920 0.05% 88 26635 0.05% 89 28541 0.05% 90 30818 0.06% 91 33064 0.06% 92 35903 0.07% 93 38904 0.07% 94 41768 0.08% 95 44071 0.08% 96 46930 0.09% 97 48805 0.09% 98 50855 0.10% 99 53327 0.10% 100 56033 0.11% 101 58317 0.11% 102 61906 0.12% 103 64869 0.12% 104 68279 0.13% 105 70770 0.14% 106 73600 0.14% 107 76278 0.15% 108 78608 0.15% 109 80220 0.15% 110 82083 0.16% 111 85304 0.16% 112 89267 0.17% 113 91887 0.18% 114 96515 0.19% 115 99217 0.19% 116 101029 0.19% 117 104404 0.20% 118 106387 0.20% 119 107229 0.21% 120 111503 0.21% 121 113944 0.22% 122 115991 0.22% 123 119361 0.23% 124 123218 0.24% 125 125350 0.24% 126 128390 0.25% 127 131194 0.25% 128 132406 0.25% 129 135024 0.26% 130 136656 0.26% 131 138380 0.27% 132 141881 0.27% 133 144479 0.28% 134 146432 0.28% 135 149359 0.29% 136 151803 0.29% 137 152944 0.29% 138 157145 0.30% 139 157951 0.30% 140 159628 0.31% 141 161479 0.31% 142 163049 0.31% 143 165448 0.32% 144 168713 0.32% 145 170254 0.33% 146 171106 0.33% 147 173863 0.33% 148 174776 0.34% 149 175139 0.34% 150 178574 0.34% 151 45022102 86.62% 51978884 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=9.12 fanout-score-rank=21 prefix-density=0.27 prefix-fanout=4.5 sequence=CTTCTTGTCAAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=13 fanout-score=472.56 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=34.1 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=13.80 fanout-score-rank=15 prefix-density=0.21 prefix-fanout=7.0 sequence=TTTGACAAGAAG criterion=fanout-score sequence-density=0.08 sequence-density-rank=12 fanout-score=376.86 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=34.2 sequence=AAGAAGAAGAAA SRR28623259 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:20:23 Started mapping on | Feb 11 12:20:23 Finished on | Feb 11 12:27:29 Mapping speed, Million of reads per hour | 439.26 Number of input reads | 51978884 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 48274182 Uniquely mapped reads % | 92.87% Average mapped length | 293.28 Number of splices: Total | 42896705 Number of splices: Annotated (sjdb) | 41847448 Number of splices: GT/AG | 42128887 Number of splices: GC/AG | 599352 Number of splices: AT/AC | 41474 Number of splices: Non-canonical | 126992 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.98 Insertion rate per base | 0.03% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1217464 % of reads mapped to multiple loci | 2.34% Number of reads mapped to too many loci | 225415 % of reads mapped to too many loci | 0.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.14% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2487238 2487238 2487238 N_multimapping 1217464 1217464 1217464 N_noFeature 2224067 47667930 2521872 N_ambiguous 584741 4065 273581 UnstrandedReadsAssigned:45465374 PositiveStrandReadsAssigned:602187 NegativeStrandReadsAssigned:45478729 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623259 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623259-trimmed-pair1.fastq SRR28623259-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 51,978,884 reads, 46,032,704 reads pseudoaligned [quant] estimated average fragment length: 239.462 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,153 rounds 52401 SRR28623259.ke.tsv 34699 SRR28623259.se.tsv 87100 total ==> SRR28623259.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1779.54 2592 34.3155 Potri.005G024800.1.v4.1 1035 796.538 1508 44.6023 Potri.004G059700.1.v4.1 961 722.559 57 1.85851 Potri.007G009000.2.v4.1 1416 1177.54 0 0 Potri.003G141000.2.v4.1 2943 2704.54 1602.53 13.9597 Potri.016G087400.1.v4.1 270 90.6049 3222.33 837.878 Potri.015G069301.1.v4.1 564 333.255 0 0 Potri.010G195200.1.v4.1 1773 1534.54 159.721 2.45215 Potri.012G127500.1.v4.1 977 738.549 10825 345.312 ==> SRR28623259.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1866 Potri.001G233950.v4.1 5 Potri.001G122700.v4.1 804 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR28623259 completed mapping pipeline successfully