Starting /dee2/code/volunteer_pipeline.sh SRR28623260 current disk space = 3051206639616 free memory = 1503622488 SRR28623260 SRAfilesize 46eafd750e8b80bd8ad609c030f62844 SRR28623260.sra SRR28623260.sra file validated SRR28623260 is paired end SRR28623260 is conventional basespace SRR28623260 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623260_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.504 37.0 37.0 37.0 37.0 37.0 2 36.495 37.0 37.0 37.0 37.0 37.0 3 36.6335 37.0 37.0 37.0 37.0 37.0 4 36.6685 37.0 37.0 37.0 37.0 37.0 5 36.6435 37.0 37.0 37.0 37.0 37.0 6 36.6875 37.0 37.0 37.0 37.0 37.0 7 36.7385 37.0 37.0 37.0 37.0 37.0 8 36.498 37.0 37.0 37.0 37.0 37.0 9 36.615 37.0 37.0 37.0 37.0 37.0 10-14 36.6125 37.0 37.0 37.0 37.0 37.0 15-19 36.5589 37.0 37.0 37.0 37.0 37.0 20-24 36.600699999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.552899999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.4945 37.0 37.0 37.0 37.0 37.0 35-39 36.443000000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.4191 37.0 37.0 37.0 37.0 37.0 45-49 36.363699999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.312400000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.2769 37.0 37.0 37.0 37.0 37.0 60-64 36.25019999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.287699999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.2115 37.0 37.0 37.0 37.0 37.0 75-79 36.1717 37.0 37.0 37.0 37.0 37.0 80-84 36.125 37.0 37.0 37.0 37.0 37.0 85-89 36.1158 37.0 37.0 37.0 37.0 37.0 90-94 36.074799999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.9392 37.0 37.0 37.0 37.0 37.0 100-104 35.988 37.0 37.0 37.0 37.0 37.0 105-109 36.0018 37.0 37.0 37.0 37.0 37.0 110-114 35.9605 37.0 37.0 37.0 37.0 37.0 115-119 35.8916 37.0 37.0 37.0 37.0 37.0 120-124 35.7301 37.0 37.0 37.0 37.0 37.0 125-129 35.6201 37.0 37.0 37.0 37.0 37.0 130-134 35.7701 37.0 37.0 37.0 37.0 37.0 135-139 35.4976 37.0 37.0 37.0 37.0 37.0 140-144 35.2205 37.0 37.0 37.0 29.8 37.0 145-149 35.125299999999996 37.0 37.0 37.0 25.0 37.0 150-151 34.922 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 0.0 22 4.0 23 2.0 24 1.0 25 4.0 26 11.0 27 17.0 28 10.0 29 16.0 30 29.0 31 28.0 32 67.0 33 91.0 34 150.0 35 399.0 36 2892.0 37 278.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.72016048144433 14.292878635907725 9.829488465396189 44.15747241725175 2 16.825000000000003 14.7 39.75 28.725 3 17.724999999999998 17.75 28.675 35.85 4 22.325 25.424999999999997 24.025 28.225 5 22.775000000000002 32.824999999999996 26.5 17.9 6 20.925 36.275 23.599999999999998 19.2 7 15.049999999999999 30.725 38.775 15.45 8 18.224999999999998 29.125 31.65 21.0 9 17.75 24.099999999999998 35.825 22.325 10-14 18.875 31.740000000000002 27.779999999999998 21.605 15-19 18.509999999999998 29.595 28.134999999999998 23.76 20-24 19.63 29.735 27.805000000000003 22.830000000000002 25-29 19.189999999999998 30.264999999999997 27.46 23.085 30-34 18.865000000000002 30.330000000000002 27.605 23.200000000000003 35-39 18.63 30.014999999999997 27.435 23.919999999999998 40-44 19.05 30.395 27.595 22.96 45-49 19.189999999999998 30.185000000000002 27.485 23.14 50-54 19.06 30.125 27.389999999999997 23.425 55-59 18.98 29.325000000000003 28.565 23.13 60-64 19.105 29.42 27.785 23.69 65-69 19.165 30.325000000000003 27.224999999999998 23.285 70-74 19.470000000000002 29.98 27.155 23.395 75-79 18.98 29.404999999999998 28.1 23.515 80-84 19.919999999999998 29.585 27.015 23.48 85-89 19.36 30.214999999999996 27.12 23.305 90-94 19.580000000000002 30.475 27.265 22.68 95-99 19.744999999999997 29.39 27.155 23.71 100-104 20.16 30.635 26.090000000000003 23.115 105-109 19.794999999999998 29.515 27.525 23.165 110-114 19.86 29.38 26.840000000000003 23.919999999999998 115-119 19.985 29.01 27.155 23.849999999999998 120-124 20.11 29.2 26.71 23.98 125-129 19.994999999999997 29.59 25.985000000000003 24.43 130-134 20.630000000000003 29.285 26.305 23.78 135-139 20.125 29.74 25.515 24.62 140-144 20.715 28.355000000000004 26.465 24.465 145-149 20.805 29.715000000000003 24.64 24.84 150-151 21.637500000000003 28.599999999999998 26.4125 23.35 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 1.0 19 2.5 20 3.0 21 2.0 22 4.5 23 5.0 24 4.0 25 3.5 26 6.0 27 15.0 28 19.0 29 26.0 30 35.5 31 46.5 32 66.5 33 83.5 34 101.0 35 110.0 36 126.0 37 146.5 38 163.0 39 191.0 40 195.0 41 203.0 42 224.0 43 240.5 44 240.5 45 244.5 46 245.5 47 212.5 48 178.5 49 156.5 50 144.5 51 115.5 52 89.5 53 82.5 54 68.5 55 48.0 56 30.5 57 25.0 58 24.5 59 17.0 60 10.0 61 6.5 62 8.5 63 10.0 64 5.0 65 2.5 66 2.0 67 1.5 68 1.0 69 0.5 70 1.5 71 1.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 85.00296384113811 71.7 2 12.122110254890337 20.45 3 2.400711321873148 6.075 4 0.26674570243034973 0.8999999999999999 5 0.2074688796680498 0.8750000000000001 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATGAAATACAATATATGGAGAGAGAAAAAAGGCAGATGCGAAACAATAAT 5 0.125 No Hit GGGGGTCTTGCATAGCTACGTCATCAATAGCAATGGATTTTTCAGTGGCT 5 0.125 No Hit CTGCAATACTAGGTTCTTTTTTGCAAACCTTAGGAAGTCCAGTGAAGCAG 5 0.125 No Hit GGGTGAAGGAGGCAAAGGAAGACTGGAGGGGGATTCTGCTGGAGAAAATG 5 0.125 No Hit CTCAACTGCAGGTTCAGCTTCAGGTTCTGCGGCTGGATCATCAGCGGGTG 5 0.125 No Hit CACCAAACTCCAAAGGGAAAGACTAAAACAAAGGCCCCATATAAAACCTC 5 0.125 No Hit CTCAGAAATAACACGGAAGAAGAAATACAAGGAAAATACTCATCTCAGAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.4 0.0 0.0 0.0 0.0 82-83 0.475 0.0 0.0 0.0 0.0 84-85 0.625 0.0 0.0 0.0 0.0 86-87 0.7 0.0 0.0 0.0 0.0 88-89 0.9624999999999999 0.0 0.0 0.0 0.0 90-91 1.2 0.0 0.0 0.0 0.0 92-93 1.475 0.0 0.0 0.0 0.0 94-95 1.8375 0.0 0.0 0.0 0.0 96-97 2.2125000000000004 0.0 0.0 0.0 0.0 98-99 2.7125 0.0 0.0 0.0 0.0 100-101 3.275 0.0 0.0 0.0 0.0 102-103 3.6375 0.0 0.0 0.0 0.0 104-105 4.05 0.0 0.0 0.0 0.0 106-107 4.65 0.0 0.0 0.0 0.0 108-109 4.987500000000001 0.0 0.0 0.0 0.0 110-111 5.6875 0.0 0.0 0.0 0.0 112-113 6.325 0.0 0.0 0.0 0.0 114-115 6.8375 0.0 0.0 0.0 0.0 116-117 7.2625 0.0 0.0 0.0 0.0 118-119 7.975 0.0 0.0 0.0 0.0 120-121 8.7375 0.0 0.0 0.0 0.0 122-123 9.5875 0.0 0.0 0.0 0.0 124-125 10.212499999999999 0.0 0.0 0.0 0.0 126-127 10.9375 0.0 0.0 0.0 0.0 128-129 11.7875 0.0 0.0 0.0 0.0 130-131 12.4375 0.0 0.0 0.0 0.0 132-133 13.399999999999999 0.0 0.0 0.0 0.0 134-135 14.1375 0.0 0.0 0.0 0.0 136-137 15.037500000000001 0.0 0.0 0.0 0.0 138-139 16.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGTTGTT 10 0.006830828 145.0 9 >>END_MODULE SRR28623260 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623260_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.916 37.0 37.0 37.0 37.0 37.0 2 36.379 37.0 37.0 37.0 37.0 37.0 3 36.356 37.0 37.0 37.0 37.0 37.0 4 36.3605 37.0 37.0 37.0 37.0 37.0 5 36.333 37.0 37.0 37.0 37.0 37.0 6 36.3525 37.0 37.0 37.0 37.0 37.0 7 36.171 37.0 37.0 37.0 37.0 37.0 8 36.3485 37.0 37.0 37.0 37.0 37.0 9 36.2895 37.0 37.0 37.0 37.0 37.0 10-14 36.188300000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.1867 37.0 37.0 37.0 37.0 37.0 20-24 36.2304 37.0 37.0 37.0 37.0 37.0 25-29 36.1453 37.0 37.0 37.0 37.0 37.0 30-34 36.1164 37.0 37.0 37.0 37.0 37.0 35-39 36.117000000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.0554 37.0 37.0 37.0 37.0 37.0 45-49 36.033699999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.040499999999994 37.0 37.0 37.0 37.0 37.0 55-59 35.9089 37.0 37.0 37.0 37.0 37.0 60-64 35.8896 37.0 37.0 37.0 37.0 37.0 65-69 35.897999999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.846000000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.9116 37.0 37.0 37.0 37.0 37.0 80-84 35.8581 37.0 37.0 37.0 37.0 37.0 85-89 35.725 37.0 37.0 37.0 37.0 37.0 90-94 35.7141 37.0 37.0 37.0 37.0 37.0 95-99 35.7065 37.0 37.0 37.0 37.0 37.0 100-104 35.62179999999999 37.0 37.0 37.0 37.0 37.0 105-109 35.5261 37.0 37.0 37.0 37.0 37.0 110-114 35.5928 37.0 37.0 37.0 37.0 37.0 115-119 35.546 37.0 37.0 37.0 37.0 37.0 120-124 35.504599999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.0584 37.0 37.0 37.0 27.4 37.0 130-134 35.2515 37.0 37.0 37.0 29.8 37.0 135-139 35.1168 37.0 37.0 37.0 29.8 37.0 140-144 35.1424 37.0 37.0 37.0 27.4 37.0 145-149 35.038799999999995 37.0 37.0 37.0 25.0 37.0 150-151 34.654250000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 3.0 15 2.0 16 1.0 17 0.0 18 2.0 19 0.0 20 0.0 21 4.0 22 1.0 23 4.0 24 6.0 25 11.0 26 12.0 27 10.0 28 21.0 29 22.0 30 33.0 31 40.0 32 61.0 33 129.0 34 248.0 35 705.0 36 2459.0 37 224.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.4 21.099999999999998 14.325 28.175 2 27.200000000000003 23.575 32.550000000000004 16.675 3 20.7 29.075 32.15 18.075 4 25.5 33.475 23.674999999999997 17.349999999999998 5 26.25 34.300000000000004 24.349999999999998 15.1 6 22.2 36.475 23.7 17.625 7 21.525 20.9 38.95 18.625 8 21.075 24.675 30.9 23.35 9 24.0 24.025 30.875000000000004 21.099999999999998 10-14 24.125 29.54 26.740000000000002 19.595000000000002 15-19 23.745 27.525 29.044999999999998 19.685 20-24 23.474999999999998 28.58 27.57 20.375 25-29 23.64 27.91 28.465 19.985 30-34 22.845 28.849999999999998 28.215 20.09 35-39 23.525 28.565 28.299999999999997 19.61 40-44 23.16 28.13 29.294999999999998 19.415 45-49 23.375 28.225 28.43 19.97 50-54 23.73 28.499999999999996 27.925 19.845 55-59 23.315 28.625 28.59 19.470000000000002 60-64 23.23 28.144999999999996 28.99 19.634999999999998 65-69 23.794999999999998 28.205000000000002 28.82 19.18 70-74 23.369999999999997 28.315 29.075 19.24 75-79 23.265 28.215 28.794999999999998 19.725 80-84 24.08 27.985 28.665000000000003 19.27 85-89 23.35 27.639999999999997 29.465000000000003 19.545 90-94 23.580000000000002 27.87 29.244999999999997 19.305 95-99 23.565 28.425 28.694999999999997 19.314999999999998 100-104 24.279999999999998 27.365000000000002 29.025000000000002 19.33 105-109 24.235 28.235 28.09 19.439999999999998 110-114 24.725 28.15 28.355000000000004 18.77 115-119 24.635 28.12 28.165000000000003 19.08 120-124 24.98 28.499999999999996 28.16 18.360000000000003 125-129 25.525 28.82 27.334999999999997 18.32 130-134 26.545 27.860000000000003 27.375 18.22 135-139 26.82 27.61 27.735 17.835 140-144 26.25 28.105000000000004 27.79 17.854999999999997 145-149 26.905 28.075 27.474999999999998 17.544999999999998 150-151 27.474999999999998 27.187499999999996 27.3875 17.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 1.5 18 4.0 19 3.5 20 2.0 21 1.5 22 1.0 23 1.5 24 3.0 25 4.0 26 5.0 27 7.0 28 8.5 29 17.0 30 27.5 31 36.5 32 50.0 33 56.0 34 70.0 35 89.5 36 106.5 37 136.5 38 162.0 39 189.5 40 222.0 41 238.0 42 240.0 43 247.5 44 260.5 45 254.5 46 235.0 47 218.0 48 207.0 49 187.0 50 159.0 51 130.0 52 91.0 53 66.0 54 60.0 55 46.0 56 30.5 57 22.5 58 17.5 59 17.5 60 12.0 61 5.5 62 7.0 63 10.0 64 8.0 65 4.5 66 3.0 67 2.0 68 2.5 69 1.5 70 0.0 71 0.0 72 0.5 73 1.5 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.975 #Duplication Level Percentage of deduplicated Percentage of total 1 85.70167696381289 72.82499999999999 2 11.532803765813474 19.6 3 2.3242130038246547 5.925 4 0.264783759929391 0.8999999999999999 5 0.176522506619594 0.75 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCAGACCTCAATGAGCTTCAACAACACTCGTCACCAGGCTACCAAAATC 5 0.125 No Hit GGGCGGTAGTGCCATGAAGGAGAATCCCATTTCTATTCATGTATTTTTGT 5 0.125 No Hit CCTGGTGTGCTTTCCATGGCTAATGCCGGTCCTGGGACTAATGGATCTCA 5 0.125 No Hit AAGCTCGGAAGTGCCCAGTGAGCTCAAAAAGTTTTGACGAATTATCATTC 5 0.125 No Hit GCTCACCGGATGCTGCTGCAGGTGGCAGATCCTCCAAATCCACCCATAGA 5 0.125 No Hit GTTTCAGTGGCATCCCTTCAGTATCACTTCTAGCTCAAATATTGATTATC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.4 0.0 0.0 0.0 0.0 82-83 0.475 0.0 0.0 0.0 0.0 84-85 0.625 0.0 0.0 0.0 0.0 86-87 0.6875 0.0 0.0 0.0 0.0 88-89 0.9375 0.0 0.0 0.0 0.0 90-91 1.175 0.0 0.0 0.0 0.0 92-93 1.425 0.0 0.0 0.0 0.0 94-95 1.775 0.0 0.0 0.0 0.0 96-97 2.1375 0.0 0.0 0.0 0.0 98-99 2.6375 0.0 0.0 0.0 0.0 100-101 3.2 0.0 0.0 0.0 0.0 102-103 3.575 0.0 0.0 0.0 0.0 104-105 4.025 0.0 0.0 0.0 0.0 106-107 4.625 0.0 0.0 0.0 0.0 108-109 4.9625 0.0 0.0 0.0 0.0 110-111 5.6875 0.0 0.0 0.0 0.0 112-113 6.35 0.0 0.0 0.0 0.0 114-115 6.875 0.0 0.0 0.0 0.0 116-117 7.3125 0.0 0.0 0.0 0.0 118-119 8.037500000000001 0.0 0.0 0.0 0.0 120-121 8.8 0.0 0.0 0.0 0.0 122-123 9.675 0.0 0.0 0.0 0.0 124-125 10.337499999999999 0.0 0.0 0.0 0.0 126-127 11.0875 0.0 0.0 0.0 0.0 128-129 11.9375 0.0 0.0 0.0 0.0 130-131 12.6 0.0 0.0 0.0 0.0 132-133 13.575 0.0 0.0 0.0 0.0 134-135 14.325 0.0 0.0 0.0 0.0 136-137 15.25 0.0 0.0 0.0 0.0 138-139 16.325000000000003 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATCCGT 10 0.006830828 145.0 3 >>END_MODULE Read 1306525 spots for SRR28623260.sra Written 1306525 spots for SRR28623260.sra Read 1306525 spots for SRR28623260.sra Written 1306525 spots for SRR28623260.sra Read 1306525 spots for SRR28623260.sra Written 1306525 spots for SRR28623260.sra Read 1306525 spots for SRR28623260.sra Written 1306525 spots for SRR28623260.sra Read 1306525 spots for SRR28623260.sra Written 1306525 spots for SRR28623260.sra Read 1306525 spots for SRR28623260.sra Written 1306525 spots for SRR28623260.sra Read 1306525 spots for SRR28623260.sra Written 1306525 spots for SRR28623260.sra Read 1306525 spots for SRR28623260.sra Written 1306525 spots for SRR28623260.sra Read 1306525 spots for SRR28623260.sra Written 1306525 spots for SRR28623260.sra Read 1306525 spots for SRR28623260.sra Written 1306525 spots for SRR28623260.sra Read 1306525 spots for SRR28623260.sra Written 1306525 spots for SRR28623260.sra Read 1306525 spots for SRR28623260.sra Written 1306525 spots for SRR28623260.sra Read 1306525 spots for SRR28623260.sra Written 1306525 spots for SRR28623260.sra Read 1306525 spots for SRR28623260.sra Written 1306525 spots for SRR28623260.sra Read 1306525 spots for SRR28623260.sra Written 1306525 spots for SRR28623260.sra Read 1306525 spots for SRR28623260.sra Written 1306525 spots for SRR28623260.sra Read 1306525 spots for SRR28623260.sra Written 1306525 spots for SRR28623260.sra Read 1306543 spots for SRR28623260.sra Written 1306543 spots for SRR28623260.sra Read 1306525 spots for SRR28623260.sra Written 1306525 spots for SRR28623260.sra Read 1306525 spots for SRR28623260.sra Written 1306525 spots for SRR28623260.sra SRR ids: ['SRR28623260.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__4rqspj_ SRR28623260.sra spots: 26130518 blocks: [[1, 1306525], [1306526, 2613050], [2613051, 3919575], [3919576, 5226100], [5226101, 6532625], [6532626, 7839150], [7839151, 9145675], [9145676, 10452200], [10452201, 11758725], [11758726, 13065250], [13065251, 14371775], [14371776, 15678300], [15678301, 16984825], [16984826, 18291350], [18291351, 19597875], [19597876, 20904400], [20904401, 22210925], [22210926, 23517450], [23517451, 24823975], [24823976, 26130518]] SRR28623260 file size 9646861 SRR28623260 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623260 SRR28623260_1.fastq SRR28623260_2.fastq Input file: SRR28623260_1.fastq Paired file: SRR28623260_2.fastq trimmed: SRR28623260-trimmed-pair1.fastq, SRR28623260-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:05:32 2025 >> started Tue Feb 11 12:06:13 2025 >> done (41.385s) 26130518 read pairs processed; of these: 18 ( 0.00%) short read pairs filtered out after trimming by size control 23338 ( 0.09%) empty read pairs filtered out after trimming by size control 26107162 (99.91%) read pairs available; of these: 5435227 (20.82%) trimmed read pairs available after processing 20671935 (79.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 1 0.00% 21 2 0.00% 22 3 0.00% 23 5 0.00% 24 7 0.00% 25 6 0.00% 26 2 0.00% 27 8 0.00% 28 7 0.00% 29 3 0.00% 30 10 0.00% 31 5 0.00% 32 15 0.00% 33 14 0.00% 34 18 0.00% 35 17 0.00% 36 23 0.00% 37 32 0.00% 38 32 0.00% 39 44 0.00% 40 54 0.00% 41 39 0.00% 42 60 0.00% 43 70 0.00% 44 68 0.00% 45 92 0.00% 46 107 0.00% 47 106 0.00% 48 133 0.00% 49 166 0.00% 50 209 0.00% 51 217 0.00% 52 258 0.00% 53 319 0.00% 54 332 0.00% 55 347 0.00% 56 447 0.00% 57 543 0.00% 58 633 0.00% 59 671 0.00% 60 806 0.00% 61 995 0.00% 62 1123 0.00% 63 1288 0.00% 64 1509 0.01% 65 1636 0.01% 66 1903 0.01% 67 2117 0.01% 68 2435 0.01% 69 2707 0.01% 70 3182 0.01% 71 3592 0.01% 72 4317 0.02% 73 4967 0.02% 74 5587 0.02% 75 6287 0.02% 76 7143 0.03% 77 7846 0.03% 78 8680 0.03% 79 9768 0.04% 80 10840 0.04% 81 12225 0.05% 82 14057 0.05% 83 15480 0.06% 84 17210 0.07% 85 19398 0.07% 86 20522 0.08% 87 22529 0.09% 88 23673 0.09% 89 25262 0.10% 90 27222 0.10% 91 29197 0.11% 92 31270 0.12% 93 33968 0.13% 94 37368 0.14% 95 39776 0.15% 96 42252 0.16% 97 44010 0.17% 98 45710 0.18% 99 47418 0.18% 100 49356 0.19% 101 51068 0.20% 102 54237 0.21% 103 56841 0.22% 104 59498 0.23% 105 62298 0.24% 106 65584 0.25% 107 67315 0.26% 108 68470 0.26% 109 70630 0.27% 110 71347 0.27% 111 73412 0.28% 112 75351 0.29% 113 76870 0.29% 114 79806 0.31% 115 83019 0.32% 116 84544 0.32% 117 87143 0.33% 118 88986 0.34% 119 89783 0.34% 120 90646 0.35% 121 92165 0.35% 122 93040 0.36% 123 94212 0.36% 124 96524 0.37% 125 97771 0.37% 126 100203 0.38% 127 102830 0.39% 128 103964 0.40% 129 104979 0.40% 130 106428 0.41% 131 105858 0.41% 132 107039 0.41% 133 107589 0.41% 134 108249 0.41% 135 110237 0.42% 136 110850 0.42% 137 113046 0.43% 138 114655 0.44% 139 115796 0.44% 140 116117 0.44% 141 115531 0.44% 142 117521 0.45% 143 116269 0.45% 144 116925 0.45% 145 117765 0.45% 146 117954 0.45% 147 119287 0.46% 148 121005 0.46% 149 120722 0.46% 150 122086 0.47% 151 20671935 79.18% 26107162 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=3.21 fanout-score-rank=25 prefix-density=0.19 prefix-fanout=2.6 sequence=GGCTTCTCCCATTTGAGGGGCTTGACAAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=425.85 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=26.2 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAG criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=4.36 fanout-score-rank=23 prefix-density=0.19 prefix-fanout=3.2 sequence=GTTGTCAAGCCCCTCAAATGGGAGAAGCC criterion=fanout-score sequence-density=0.08 sequence-density-rank=15 fanout-score=274.38 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=24.7 sequence=AAGAAGAAGAAA SRR28623260 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:06:56 Started mapping on | Feb 11 12:06:57 Finished on | Feb 11 12:10:23 Mapping speed, Million of reads per hour | 456.24 Number of input reads | 26107162 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 24079442 Uniquely mapped reads % | 92.23% Average mapped length | 289.11 Number of splices: Total | 18516497 Number of splices: Annotated (sjdb) | 18028426 Number of splices: GT/AG | 18198706 Number of splices: GC/AG | 236968 Number of splices: AT/AC | 18656 Number of splices: Non-canonical | 62167 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.04% Deletion average length | 2.85 Insertion rate per base | 0.03% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 558065 % of reads mapped to multiple loci | 2.14% Number of reads mapped to too many loci | 315016 % of reads mapped to too many loci | 1.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.12% % of reads unmapped: other | 0.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1469655 1469655 1469655 N_multimapping 558065 558065 558065 N_noFeature 1070569 23685651 1244715 N_ambiguous 342639 2580 121102 UnstrandedReadsAssigned:22666234 PositiveStrandReadsAssigned:391211 NegativeStrandReadsAssigned:22713625 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR28623260 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623260-trimmed-pair1.fastq SRR28623260-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,107,162 reads, 23,114,085 reads pseudoaligned [quant] estimated average fragment length: 209.807 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,103 rounds 52401 SRR28623260.ke.tsv 34699 SRR28623260.se.tsv 87100 total ==> SRR28623260.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1809.19 1478 37.683 Potri.005G024800.1.v4.1 1035 826.193 549 30.6511 Potri.004G059700.1.v4.1 961 752.202 67 4.10862 Potri.007G009000.2.v4.1 1416 1207.19 0 0 Potri.003G141000.2.v4.1 2943 2734.19 418.209 7.05537 Potri.016G087400.1.v4.1 270 99.4402 2046.77 949.429 Potri.015G069301.1.v4.1 564 358.623 0 0 Potri.010G195200.1.v4.1 1773 1564.19 158 4.65932 Potri.012G127500.1.v4.1 977 768.197 2472 148.433 ==> SRR28623260.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2504 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 570 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 20 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 17 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR28623260 completed mapping pipeline successfully