Starting /dee2/code/volunteer_pipeline.sh SRR28623261 current disk space = 3050581393408 free memory = 1580069896 SRR28623261 SRAfilesize 10f66fcde4120fb889759fb52bd09307 SRR28623261.sra SRR28623261.sra file validated SRR28623261 is paired end SRR28623261 is conventional basespace SRR28623261 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623261_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3305 37.0 37.0 37.0 37.0 37.0 2 36.4355 37.0 37.0 37.0 37.0 37.0 3 36.606 37.0 37.0 37.0 37.0 37.0 4 36.564 37.0 37.0 37.0 37.0 37.0 5 36.6015 37.0 37.0 37.0 37.0 37.0 6 36.6845 37.0 37.0 37.0 37.0 37.0 7 36.536 37.0 37.0 37.0 37.0 37.0 8 36.437 37.0 37.0 37.0 37.0 37.0 9 36.6355 37.0 37.0 37.0 37.0 37.0 10-14 36.5352 37.0 37.0 37.0 37.0 37.0 15-19 36.542899999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.52720000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.4502 37.0 37.0 37.0 37.0 37.0 30-34 36.46079999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.4097 37.0 37.0 37.0 37.0 37.0 40-44 36.41 37.0 37.0 37.0 37.0 37.0 45-49 36.3842 37.0 37.0 37.0 37.0 37.0 50-54 36.3106 37.0 37.0 37.0 37.0 37.0 55-59 36.3147 37.0 37.0 37.0 37.0 37.0 60-64 36.2904 37.0 37.0 37.0 37.0 37.0 65-69 36.295 37.0 37.0 37.0 37.0 37.0 70-74 36.1726 37.0 37.0 37.0 37.0 37.0 75-79 36.156 37.0 37.0 37.0 37.0 37.0 80-84 36.0697 37.0 37.0 37.0 37.0 37.0 85-89 36.07469999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.039100000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.9065 37.0 37.0 37.0 37.0 37.0 100-104 35.9902 37.0 37.0 37.0 37.0 37.0 105-109 35.9043 37.0 37.0 37.0 37.0 37.0 110-114 35.8468 37.0 37.0 37.0 37.0 37.0 115-119 35.8864 37.0 37.0 37.0 37.0 37.0 120-124 35.7229 37.0 37.0 37.0 37.0 37.0 125-129 35.688199999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.702 37.0 37.0 37.0 37.0 37.0 135-139 35.549099999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.2701 37.0 37.0 37.0 37.0 37.0 145-149 35.214099999999995 37.0 37.0 37.0 32.2 37.0 150-151 34.89875 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 0.0 23 2.0 24 5.0 25 5.0 26 3.0 27 11.0 28 17.0 29 22.0 30 31.0 31 42.0 32 64.0 33 88.0 34 158.0 35 401.0 36 2908.0 37 241.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.214643931795386 13.891675025075227 7.973921765295888 39.9197592778335 2 17.925 15.6 38.25 28.225 3 18.0 18.2 28.000000000000004 35.8 4 21.85 26.075 24.125 27.950000000000003 5 25.05 33.2 24.9 16.85 6 20.474999999999998 34.225 22.7 22.6 7 15.325 27.275 40.9 16.5 8 17.075000000000003 27.375 33.1 22.45 9 18.775 23.5 36.025 21.7 10-14 19.425 30.585 27.445000000000004 22.545 15-19 18.755 28.860000000000003 28.38 24.005000000000003 20-24 19.41 28.79 28.675 23.125 25-29 19.744999999999997 29.785 27.46 23.01 30-34 19.74 28.64 27.565 24.055 35-39 19.885 28.49 27.700000000000003 23.925 40-44 19.39 29.244999999999997 27.894999999999996 23.47 45-49 19.43 29.385 27.66 23.525 50-54 19.905 28.565 28.055000000000003 23.474999999999998 55-59 19.575 28.005000000000003 28.660000000000004 23.76 60-64 19.215 28.625 28.225 23.935000000000002 65-69 19.96 28.375 28.205000000000002 23.46 70-74 20.555 28.95 27.11 23.385 75-79 19.46 29.525000000000002 27.255000000000003 23.76 80-84 20.135 28.565 27.785 23.515 85-89 20.04 28.050000000000004 28.68 23.23 90-94 20.51 28.375 27.045 24.07 95-99 20.225 29.205 27.634999999999998 22.935 100-104 20.155 29.445 27.150000000000002 23.25 105-109 20.555 29.465000000000003 26.979999999999997 23.0 110-114 20.315 29.154999999999998 27.200000000000003 23.330000000000002 115-119 20.035 29.244999999999997 27.235 23.485 120-124 20.599999999999998 29.265 26.669999999999998 23.465 125-129 20.355 28.29 27.77 23.585 130-134 20.61 28.99 27.029999999999998 23.369999999999997 135-139 20.95 28.53 26.855 23.665 140-144 21.265 28.205000000000002 26.685 23.845 145-149 21.375 28.205000000000002 26.6 23.82 150-151 22.275 28.125 26.25 23.35 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 2.5 24 3.0 25 2.0 26 3.5 27 3.5 28 13.0 29 25.0 30 28.5 31 34.5 32 38.0 33 47.5 34 57.5 35 78.0 36 100.5 37 117.0 38 147.0 39 171.5 40 198.5 41 231.5 42 250.5 43 255.5 44 269.5 45 268.0 46 260.0 47 252.5 48 221.5 49 192.5 50 170.5 51 126.0 52 94.0 53 89.5 54 64.0 55 44.0 56 37.0 57 20.5 58 13.0 59 19.0 60 15.0 61 8.0 62 5.0 63 2.5 64 3.0 65 3.0 66 2.5 67 2.0 68 1.0 69 1.0 70 1.0 71 0.5 72 1.0 73 1.0 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.5 #Duplication Level Percentage of deduplicated Percentage of total 1 86.79190751445087 75.075 2 11.329479768786127 19.6 3 1.5317919075144508 3.975 4 0.26011560693641617 0.8999999999999999 5 0.028901734104046246 0.125 6 0.028901734104046246 0.15 7 0.028901734104046246 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGCTCAGAGCTTCCTCTGCTTTAAAGATGATCAAGCTGCGCTCAGGCAG 7 0.17500000000000002 No Hit TTTTTTTTTTCTTTTTAATTTTGGTACAATAAAAAGCTCTTCAAATATGT 6 0.15 No Hit GGTGATTTGGCCACCAAGAGCCAAGCCAAAAGTGACAGCAGGGTTAACAT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.8125 0.0 0.0 0.0 0.0 92-93 0.9375 0.0 0.0 0.0 0.0 94-95 1.1875 0.0 0.0 0.0 0.0 96-97 1.3875000000000002 0.0 0.0 0.0 0.0 98-99 1.5375 0.0 0.0 0.0 0.0 100-101 1.725 0.0 0.0 0.0 0.0 102-103 2.1500000000000004 0.0 0.0 0.0 0.0 104-105 2.3375 0.0 0.0 0.0 0.0 106-107 2.675 0.0 0.0 0.0 0.0 108-109 3.0125 0.0 0.0 0.0 0.0 110-111 3.425 0.0 0.0 0.0 0.0 112-113 3.9125 0.0 0.0 0.0 0.0 114-115 4.425000000000001 0.0 0.0 0.0 0.0 116-117 4.975 0.0 0.0 0.0 0.0 118-119 5.425000000000001 0.0 0.0 0.0 0.0 120-121 5.8125 0.0 0.0 0.0 0.0 122-123 6.300000000000001 0.0 0.0 0.0 0.0 124-125 6.7875 0.0 0.0 0.0 0.0 126-127 7.2125 0.0 0.0 0.0 0.0 128-129 7.675 0.0 0.0 0.0 0.0 130-131 8.55 0.0 0.0 0.0 0.0 132-133 9.05 0.0 0.0 0.0 0.0 134-135 9.662500000000001 0.0 0.0 0.0 0.0 136-137 10.625 0.0 0.0 0.0 0.0 138-139 11.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGAGTA 10 0.006830828 145.0 2 >>END_MODULE SRR28623261 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623261_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.7825 37.0 37.0 37.0 37.0 37.0 2 36.1595 37.0 37.0 37.0 37.0 37.0 3 36.2245 37.0 37.0 37.0 37.0 37.0 4 36.212 37.0 37.0 37.0 37.0 37.0 5 36.316 37.0 37.0 37.0 37.0 37.0 6 36.1995 37.0 37.0 37.0 37.0 37.0 7 36.2085 37.0 37.0 37.0 37.0 37.0 8 36.178 37.0 37.0 37.0 37.0 37.0 9 36.102 37.0 37.0 37.0 37.0 37.0 10-14 36.1219 37.0 37.0 37.0 37.0 37.0 15-19 36.134100000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.0877 37.0 37.0 37.0 37.0 37.0 25-29 36.0216 37.0 37.0 37.0 37.0 37.0 30-34 35.93820000000001 37.0 37.0 37.0 37.0 37.0 35-39 35.94 37.0 37.0 37.0 37.0 37.0 40-44 35.8956 37.0 37.0 37.0 37.0 37.0 45-49 35.871700000000004 37.0 37.0 37.0 37.0 37.0 50-54 35.8232 37.0 37.0 37.0 37.0 37.0 55-59 35.653 37.0 37.0 37.0 37.0 37.0 60-64 35.6981 37.0 37.0 37.0 37.0 37.0 65-69 35.7007 37.0 37.0 37.0 37.0 37.0 70-74 35.7256 37.0 37.0 37.0 37.0 37.0 75-79 35.7596 37.0 37.0 37.0 37.0 37.0 80-84 35.6178 37.0 37.0 37.0 37.0 37.0 85-89 35.5461 37.0 37.0 37.0 37.0 37.0 90-94 35.548899999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.5788 37.0 37.0 37.0 37.0 37.0 100-104 35.333999999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.323299999999996 37.0 37.0 37.0 34.6 37.0 110-114 35.487700000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.3817 37.0 37.0 37.0 37.0 37.0 120-124 35.4197 37.0 37.0 37.0 37.0 37.0 125-129 34.9799 37.0 37.0 37.0 27.4 37.0 130-134 35.1786 37.0 37.0 37.0 27.4 37.0 135-139 35.001 37.0 37.0 37.0 25.0 37.0 140-144 35.1188 37.0 37.0 37.0 27.4 37.0 145-149 35.014199999999995 37.0 37.0 37.0 27.4 37.0 150-151 34.702 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 12.0 15 9.0 16 7.0 17 2.0 18 3.0 19 4.0 20 2.0 21 6.0 22 4.0 23 14.0 24 10.0 25 9.0 26 13.0 27 8.0 28 19.0 29 19.0 30 29.0 31 36.0 32 67.0 33 109.0 34 210.0 35 656.0 36 2482.0 37 269.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.475 22.45 12.15 23.925 2 27.025 25.55 30.349999999999998 17.075000000000003 3 22.675 28.575 30.9 17.849999999999998 4 25.775 33.175 22.825 18.224999999999998 5 26.575 36.325 22.45 14.649999999999999 6 21.575 38.0 23.825 16.6 7 20.974999999999998 21.125 39.050000000000004 18.85 8 21.15 26.8 28.375 23.674999999999997 9 22.85 25.174999999999997 29.4 22.575 10-14 24.58 28.88 26.88 19.66 15-19 24.145 28.799999999999997 27.495000000000005 19.56 20-24 23.36 28.52 27.900000000000002 20.22 25-29 23.39 28.275 28.299999999999997 20.035 30-34 22.975 28.249999999999996 28.025 20.75 35-39 23.26 28.71 27.894999999999996 20.135 40-44 23.775 28.134999999999998 28.22 19.869999999999997 45-49 23.06 27.889999999999997 29.225 19.825 50-54 22.5 28.765 28.360000000000003 20.375 55-59 23.375 28.345 28.22 20.06 60-64 23.265 27.939999999999998 28.96 19.835 65-69 22.785 28.43 29.099999999999998 19.685 70-74 23.655 28.525 28.055000000000003 19.765 75-79 22.515 28.435 28.725 20.325 80-84 22.705000000000002 28.634999999999998 28.849999999999998 19.81 85-89 23.72 28.815 27.985 19.48 90-94 24.015 27.67 28.505000000000003 19.81 95-99 23.535 28.59 28.125 19.75 100-104 23.82 29.14 27.544999999999998 19.495 105-109 23.275000000000002 28.935 28.134999999999998 19.655 110-114 23.849999999999998 28.425 27.71 20.015 115-119 24.735 29.28 26.745 19.24 120-124 25.275 28.515 27.235 18.975 125-129 24.685000000000002 29.5 26.69 19.125 130-134 25.25 28.225 27.560000000000002 18.965 135-139 25.619999999999997 28.595 26.755000000000003 19.03 140-144 25.6 28.17 27.339999999999996 18.89 145-149 26.27 27.950000000000003 26.99 18.790000000000003 150-151 26.224999999999998 28.425 26.6625 18.6875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 1.0 6 0.5 7 1.0 8 2.0 9 1.0 10 1.0 11 2.5 12 1.5 13 0.0 14 0.0 15 1.0 16 1.5 17 1.0 18 1.5 19 1.5 20 1.0 21 1.5 22 2.5 23 3.5 24 3.5 25 3.5 26 5.0 27 9.5 28 17.5 29 20.5 30 25.5 31 32.0 32 33.5 33 40.5 34 61.0 35 91.0 36 106.0 37 117.5 38 141.5 39 182.0 40 204.0 41 225.0 42 263.5 43 258.5 44 271.5 45 274.5 46 262.0 47 255.0 48 218.0 49 187.5 50 150.0 51 118.5 52 91.0 53 73.0 54 55.5 55 34.5 56 25.0 57 17.5 58 13.5 59 13.0 60 13.5 61 9.5 62 6.0 63 5.0 64 4.0 65 1.0 66 1.0 67 1.5 68 1.0 69 2.0 70 2.5 71 2.0 72 1.0 73 0.5 74 0.5 75 0.5 76 1.0 77 1.5 78 1.0 79 0.5 80 0.5 81 0.5 82 1.0 83 1.5 84 1.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.5 94 0.5 95 0.5 96 1.0 97 1.0 98 0.5 99 0.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 86.90372940156115 75.14999999999999 2 11.274934952298352 19.5 3 1.4455044810638913 3.75 4 0.26019080659150046 0.8999999999999999 5 0.028910089621277828 0.125 6 0.028910089621277828 0.15 7 0.028910089621277828 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.028910089621277828 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 10 0.25 No Hit CTTTTATTGATCGCTCTAAAGATTATGCTGATCCATAATCGGAGATAATC 7 0.17500000000000002 No Hit AATTAATTAATTACGCAATAACTCAGTAATAAACTATTTGCAGTATAAGC 6 0.15 No Hit CTTGCTGAATTCATCTCAACTTTGCTCTTTGTTTTTGCTGGTGTTGGTTC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.8374999999999999 0.0 0.0 0.0 0.0 92-93 0.9624999999999999 0.0 0.0 0.0 0.0 94-95 1.2125 0.0 0.0 0.0 0.0 96-97 1.4125 0.0 0.0 0.0 0.0 98-99 1.5875 0.0 0.0 0.0 0.0 100-101 1.8125 0.0 0.0 0.0 0.0 102-103 2.25 0.0 0.0 0.0 0.0 104-105 2.4375 0.0 0.0 0.0 0.0 106-107 2.8 0.0 0.0 0.0 0.0 108-109 3.0999999999999996 0.0 0.0 0.0 0.0 110-111 3.5 0.0 0.0 0.0 0.0 112-113 4.0 0.0 0.0 0.0 0.0 114-115 4.525 0.0 0.0 0.0 0.0 116-117 5.075 0.0 0.0 0.0 0.0 118-119 5.5375 0.0 0.0 0.0 0.0 120-121 5.9125 0.0 0.0 0.0 0.0 122-123 6.4 0.0 0.0 0.0 0.0 124-125 6.85 0.0 0.0 0.0 0.0 126-127 7.300000000000001 0.0 0.0 0.0 0.0 128-129 7.775 0.0 0.0 0.0 0.0 130-131 8.625 0.0 0.0 0.0 0.0 132-133 9.125 0.0 0.0 0.0 0.0 134-135 9.725 0.0 0.0 0.0 0.0 136-137 10.725 0.0 0.0 0.0 0.0 138-139 11.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCACAGA 10 0.006830828 145.0 9 >>END_MODULE Read 1581046 spots for SRR28623261.sra Written 1581046 spots for SRR28623261.sra Read 1581046 spots for SRR28623261.sra Written 1581046 spots for SRR28623261.sra Read 1581046 spots for SRR28623261.sra Written 1581046 spots for SRR28623261.sra Read 1581046 spots for SRR28623261.sra Written 1581046 spots for SRR28623261.sra Read 1581046 spots for SRR28623261.sra Written 1581046 spots for SRR28623261.sra Read 1581046 spots for SRR28623261.sra Written 1581046 spots for SRR28623261.sra Read 1581046 spots for SRR28623261.sra Written 1581046 spots for SRR28623261.sra Read 1581046 spots for SRR28623261.sra Written 1581046 spots for SRR28623261.sra Read 1581046 spots for SRR28623261.sra Written 1581046 spots for SRR28623261.sra Read 1581046 spots for SRR28623261.sra Written 1581046 spots for SRR28623261.sra Read 1581046 spots for SRR28623261.sra Written 1581046 spots for SRR28623261.sra Read 1581056 spots for SRR28623261.sra Written 1581056 spots for SRR28623261.sra Read 1581046 spots for SRR28623261.sra Written 1581046 spots for SRR28623261.sra Read 1581046 spots for SRR28623261.sra Written 1581046 spots for SRR28623261.sra Read 1581046 spots for SRR28623261.sra Written 1581046 spots for SRR28623261.sra Read 1581046 spots for SRR28623261.sra Written 1581046 spots for SRR28623261.sra Read 1581046 spots for SRR28623261.sra Written 1581046 spots for SRR28623261.sra Read 1581046 spots for SRR28623261.sra Written 1581046 spots for SRR28623261.sra Read 1581046 spots for SRR28623261.sra Written 1581046 spots for SRR28623261.sra Read 1581046 spots for SRR28623261.sra Written 1581046 spots for SRR28623261.sra SRR ids: ['SRR28623261.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g116yfg2 SRR28623261.sra spots: 31620930 blocks: [[1, 1581046], [1581047, 3162092], [3162093, 4743138], [4743139, 6324184], [6324185, 7905230], [7905231, 9486276], [9486277, 11067322], [11067323, 12648368], [12648369, 14229414], [14229415, 15810460], [15810461, 17391506], [17391507, 18972552], [18972553, 20553598], [20553599, 22134644], [22134645, 23715690], [23715691, 25296736], [25296737, 26877782], [26877783, 28458828], [28458829, 30039874], [30039875, 31620930]] SRR28623261 file size 11676081 SRR28623261 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623261 SRR28623261_1.fastq SRR28623261_2.fastq Input file: SRR28623261_1.fastq Paired file: SRR28623261_2.fastq trimmed: SRR28623261-trimmed-pair1.fastq, SRR28623261-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 13:06:36 2025 >> started Tue Feb 11 13:07:12 2025 >> done (35.957s) 31620930 read pairs processed; of these: 37 ( 0.00%) short read pairs filtered out after trimming by size control 13763 ( 0.04%) empty read pairs filtered out after trimming by size control 31607130 (99.96%) read pairs available; of these: 5204677 (16.47%) trimmed read pairs available after processing 26402453 (83.53%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 5 0.00% 21 4 0.00% 22 7 0.00% 23 7 0.00% 24 6 0.00% 25 6 0.00% 26 9 0.00% 27 3 0.00% 28 14 0.00% 29 9 0.00% 30 14 0.00% 31 15 0.00% 32 17 0.00% 33 33 0.00% 34 20 0.00% 35 32 0.00% 36 26 0.00% 37 30 0.00% 38 30 0.00% 39 51 0.00% 40 56 0.00% 41 65 0.00% 42 76 0.00% 43 65 0.00% 44 73 0.00% 45 96 0.00% 46 93 0.00% 47 112 0.00% 48 131 0.00% 49 144 0.00% 50 178 0.00% 51 235 0.00% 52 215 0.00% 53 317 0.00% 54 294 0.00% 55 334 0.00% 56 390 0.00% 57 453 0.00% 58 504 0.00% 59 551 0.00% 60 715 0.00% 61 767 0.00% 62 891 0.00% 63 998 0.00% 64 1300 0.00% 65 1310 0.00% 66 1453 0.00% 67 1697 0.01% 68 1963 0.01% 69 2238 0.01% 70 2487 0.01% 71 2991 0.01% 72 3244 0.01% 73 3882 0.01% 74 4479 0.01% 75 5052 0.02% 76 5662 0.02% 77 6340 0.02% 78 7051 0.02% 79 7679 0.02% 80 8713 0.03% 81 9679 0.03% 82 10957 0.03% 83 12253 0.04% 84 13701 0.04% 85 14999 0.05% 86 16596 0.05% 87 17942 0.06% 88 19737 0.06% 89 21245 0.07% 90 22620 0.07% 91 24488 0.08% 92 26758 0.08% 93 28832 0.09% 94 31389 0.10% 95 33312 0.11% 96 35921 0.11% 97 37922 0.12% 98 39618 0.13% 99 41930 0.13% 100 43952 0.14% 101 45779 0.14% 102 48150 0.15% 103 50606 0.16% 104 52685 0.17% 105 55470 0.18% 106 58555 0.19% 107 60771 0.19% 108 62588 0.20% 109 63657 0.20% 110 65500 0.21% 111 67659 0.21% 112 70049 0.22% 113 71377 0.23% 114 73565 0.23% 115 76954 0.24% 116 78724 0.25% 117 81584 0.26% 118 83410 0.26% 119 84131 0.27% 120 86897 0.27% 121 88427 0.28% 122 89120 0.28% 123 91541 0.29% 124 93459 0.30% 125 94460 0.30% 126 97277 0.31% 127 99525 0.31% 128 100765 0.32% 129 103243 0.33% 130 104571 0.33% 131 105115 0.33% 132 105931 0.34% 133 107165 0.34% 134 107882 0.34% 135 109650 0.35% 136 111558 0.35% 137 112219 0.36% 138 114643 0.36% 139 116057 0.37% 140 116044 0.37% 141 118012 0.37% 142 118303 0.37% 143 118898 0.38% 144 120832 0.38% 145 121350 0.38% 146 121726 0.39% 147 122372 0.39% 148 124406 0.39% 149 125355 0.40% 150 127170 0.40% 151 26402453 83.53% 31607130 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=13.83 fanout-score-rank=15 prefix-density=0.12 prefix-fanout=13.8 sequence=GGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGGTCCAATCTCGT criterion=fanout-score sequence-density=0.07 sequence-density-rank=25 fanout-score=433.43 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=32.0 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=3.03 fanout-score-rank=28 prefix-density=0.19 prefix-fanout=2.6 sequence=GGGATGGAGAAGCTGGTTTCAGAGGTTGATCTTGTCAAGTCCTTTGAATGGGGGCA criterion=fanout-score sequence-density=0.09 sequence-density-rank=13 fanout-score=359.88 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=34.4 sequence=AAGAAGAAGAAA SRR28623261 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 13:07:56 Started mapping on | Feb 11 13:07:56 Finished on | Feb 11 13:11:17 Mapping speed, Million of reads per hour | 566.10 Number of input reads | 31607130 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 29564996 Uniquely mapped reads % | 93.54% Average mapped length | 291.76 Number of splices: Total | 26621616 Number of splices: Annotated (sjdb) | 25933833 Number of splices: GT/AG | 26127795 Number of splices: GC/AG | 386763 Number of splices: AT/AC | 27159 Number of splices: Non-canonical | 79899 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 3.04 Insertion rate per base | 0.03% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 776562 % of reads mapped to multiple loci | 2.46% Number of reads mapped to too many loci | 189020 % of reads mapped to too many loci | 0.60% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.16% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1265572 1265572 1265572 N_multimapping 776562 776562 776562 N_noFeature 1376902 29174862 1575170 N_ambiguous 362353 2739 168645 UnstrandedReadsAssigned:27825741 PositiveStrandReadsAssigned:387395 NegativeStrandReadsAssigned:27821181 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623261 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623261-trimmed-pair1.fastq SRR28623261-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,607,130 reads, 28,252,758 reads pseudoaligned [quant] estimated average fragment length: 225.716 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,118 rounds 52401 SRR28623261.ke.tsv 34699 SRR28623261.se.tsv 87100 total ==> SRR28623261.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.28 1389 27.6379 Potri.005G024800.1.v4.1 1035 810.284 626 27.567 Potri.004G059700.1.v4.1 961 736.306 110 5.33072 Potri.007G009000.2.v4.1 1416 1191.28 1 0.0299527 Potri.003G141000.2.v4.1 2943 2718.28 880.175 11.5538 Potri.016G087400.1.v4.1 270 94.0313 2164.54 821.383 Potri.015G069301.1.v4.1 564 344.031 0 0 Potri.010G195200.1.v4.1 1773 1548.28 58 1.33669 Potri.012G127500.1.v4.1 977 752.306 11206 531.505 ==> SRR28623261.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2431 Potri.001G233950.v4.1 5 Potri.001G122700.v4.1 683 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 12 SRR28623261 completed mapping pipeline successfully