Starting /dee2/code/volunteer_pipeline.sh SRR28623262 current disk space = 3051261767680 free memory = 1182522132 SRR28623262 SRAfilesize bd3ca4521721a49fcbe2952abeee8a0e SRR28623262.sra SRR28623262.sra file validated SRR28623262 is paired end SRR28623262 is conventional basespace SRR28623262 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623262_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.353 37.0 37.0 37.0 37.0 37.0 2 36.48 37.0 37.0 37.0 37.0 37.0 3 36.607 37.0 37.0 37.0 37.0 37.0 4 36.606 37.0 37.0 37.0 37.0 37.0 5 36.5965 37.0 37.0 37.0 37.0 37.0 6 36.7085 37.0 37.0 37.0 37.0 37.0 7 36.633 37.0 37.0 37.0 37.0 37.0 8 36.53 37.0 37.0 37.0 37.0 37.0 9 36.57 37.0 37.0 37.0 37.0 37.0 10-14 36.6059 37.0 37.0 37.0 37.0 37.0 15-19 36.5841 37.0 37.0 37.0 37.0 37.0 20-24 36.5086 37.0 37.0 37.0 37.0 37.0 25-29 36.4672 37.0 37.0 37.0 37.0 37.0 30-34 36.479 37.0 37.0 37.0 37.0 37.0 35-39 36.447599999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.4233 37.0 37.0 37.0 37.0 37.0 45-49 36.3404 37.0 37.0 37.0 37.0 37.0 50-54 36.281600000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.2919 37.0 37.0 37.0 37.0 37.0 60-64 36.3113 37.0 37.0 37.0 37.0 37.0 65-69 36.287600000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.176100000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.15409999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.1307 37.0 37.0 37.0 37.0 37.0 85-89 36.1615 37.0 37.0 37.0 37.0 37.0 90-94 36.0976 37.0 37.0 37.0 37.0 37.0 95-99 35.9413 37.0 37.0 37.0 37.0 37.0 100-104 35.9859 37.0 37.0 37.0 37.0 37.0 105-109 36.014500000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.9702 37.0 37.0 37.0 37.0 37.0 115-119 35.9086 37.0 37.0 37.0 37.0 37.0 120-124 35.828199999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.6888 37.0 37.0 37.0 37.0 37.0 130-134 35.8655 37.0 37.0 37.0 37.0 37.0 135-139 35.7251 37.0 37.0 37.0 37.0 37.0 140-144 35.44029999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.388 37.0 37.0 37.0 32.2 37.0 150-151 35.127750000000006 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 1.0 22 0.0 23 1.0 24 4.0 25 3.0 26 8.0 27 7.0 28 21.0 29 24.0 30 33.0 31 37.0 32 49.0 33 82.0 34 152.0 35 310.0 36 2958.0 37 309.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.743718592964825 13.190954773869345 9.271356783919597 38.79396984924623 2 20.375 15.625 37.325 26.674999999999997 3 18.5 17.849999999999998 28.050000000000004 35.6 4 22.925 26.724999999999998 22.675 27.675 5 24.375 32.95 23.525 19.15 6 22.475 34.575 21.975 20.974999999999998 7 15.55 28.65 39.175 16.625 8 18.675 25.4 32.25 23.674999999999997 9 17.974999999999998 23.400000000000002 34.449999999999996 24.175 10-14 20.235 31.0 26.26 22.505 15-19 19.81 28.825 28.575 22.79 20-24 20.62 28.389999999999997 27.205000000000002 23.785 25-29 20.0 28.575 28.044999999999998 23.380000000000003 30-34 20.265 28.64 27.68 23.415 35-39 20.625 28.694999999999997 27.155 23.525 40-44 21.025 28.249999999999996 27.450000000000003 23.275000000000002 45-49 20.595 27.750000000000004 27.905 23.75 50-54 20.335 28.825 26.99 23.849999999999998 55-59 20.325 28.565 27.500000000000004 23.61 60-64 20.05 28.54 27.445000000000004 23.965 65-69 21.13 28.155 27.38 23.335 70-74 20.93 27.815 27.205000000000002 24.05 75-79 20.955 28.105000000000004 27.38 23.56 80-84 19.61 28.4 27.63 24.36 85-89 21.060000000000002 28.77 27.389999999999997 22.78 90-94 21.14 28.665000000000003 26.815 23.380000000000003 95-99 20.45 28.375 27.48 23.695 100-104 21.0 28.555000000000003 27.425 23.02 105-109 21.349999999999998 28.315 26.415 23.919999999999998 110-114 21.675 28.535 27.250000000000004 22.54 115-119 21.4 28.389999999999997 26.740000000000002 23.47 120-124 21.654999999999998 28.265 26.419999999999998 23.66 125-129 21.285 28.51 26.41 23.794999999999998 130-134 21.72 27.935 26.66 23.685000000000002 135-139 22.25 28.07 25.88 23.799999999999997 140-144 21.855 28.46 25.82 23.865 145-149 21.925 27.865000000000002 26.1 24.11 150-151 22.1875 28.525 25.874999999999996 23.4125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 1.0 23 2.0 24 2.5 25 2.5 26 7.5 27 9.0 28 13.0 29 25.5 30 23.0 31 22.5 32 29.0 33 44.5 34 60.5 35 67.0 36 88.5 37 118.0 38 128.0 39 141.0 40 186.5 41 201.5 42 211.5 43 248.0 44 252.5 45 247.0 46 259.5 47 241.0 48 214.5 49 210.5 50 187.5 51 155.0 52 125.5 53 106.0 54 80.0 55 64.0 56 59.0 57 43.5 58 32.0 59 29.5 60 22.0 61 11.5 62 8.5 63 2.5 64 1.5 65 1.5 66 1.0 67 1.5 68 2.0 69 2.0 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.05 #Duplication Level Percentage of deduplicated Percentage of total 1 85.65549676660787 72.85000000000001 2 11.610817166372723 19.75 3 2.263374485596708 5.775 4 0.4409171075837742 1.5 5 0.029394473838918283 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGAATTTGAAAGCCAAGCGTTGACTTATCGCTATCAACACCATCTTTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.3125 0.0 0.0 0.0 0.0 82-83 0.36250000000000004 0.0 0.0 0.0 0.0 84-85 0.48750000000000004 0.0 0.0 0.0 0.0 86-87 0.6 0.0 0.0 0.0 0.0 88-89 0.75 0.0 0.0 0.0 0.0 90-91 0.9875 0.0 0.0 0.0 0.0 92-93 1.2375 0.0 0.0 0.0 0.0 94-95 1.4375 0.0 0.0 0.0 0.0 96-97 1.7 0.0 0.0 0.0 0.0 98-99 1.9375 0.0 0.0 0.0 0.0 100-101 2.0875 0.0 0.0 0.0 0.0 102-103 2.4 0.0 0.0 0.0 0.0 104-105 2.9625 0.0 0.0 0.0 0.0 106-107 3.275 0.0 0.0 0.0 0.0 108-109 3.5625 0.0 0.0 0.0 0.0 110-111 3.9375 0.0 0.0 0.0 0.0 112-113 4.525 0.0 0.0 0.0 0.0 114-115 4.9625 0.0 0.0 0.0 0.0 116-117 5.5 0.0 0.0 0.0 0.0 118-119 6.0875 0.0 0.0 0.0 0.0 120-121 6.8375 0.0 0.0 0.0 0.0 122-123 7.825 0.0 0.0 0.0 0.0 124-125 8.7 0.0 0.0 0.0 0.0 126-127 9.587499999999999 0.0 0.0 0.0 0.0 128-129 10.2125 0.0 0.0 0.0 0.0 130-131 10.8875 0.0 0.0 0.0 0.0 132-133 11.575 0.0 0.0 0.0 0.0 134-135 12.425 0.0 0.0 0.0 0.0 136-137 13.2 0.0 0.0 0.0 0.0 138-139 13.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR28623262 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623262_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.616 37.0 37.0 37.0 37.0 37.0 2 36.118 37.0 37.0 37.0 37.0 37.0 3 36.115 37.0 37.0 37.0 37.0 37.0 4 36.026 37.0 37.0 37.0 37.0 37.0 5 36.2055 37.0 37.0 37.0 37.0 37.0 6 36.1105 37.0 37.0 37.0 37.0 37.0 7 36.1025 37.0 37.0 37.0 37.0 37.0 8 36.101 37.0 37.0 37.0 37.0 37.0 9 36.0805 37.0 37.0 37.0 37.0 37.0 10-14 36.0596 37.0 37.0 37.0 37.0 37.0 15-19 36.0261 37.0 37.0 37.0 37.0 37.0 20-24 35.9887 37.0 37.0 37.0 37.0 37.0 25-29 35.9944 37.0 37.0 37.0 37.0 37.0 30-34 35.8775 37.0 37.0 37.0 37.0 37.0 35-39 35.895300000000006 37.0 37.0 37.0 37.0 37.0 40-44 35.896 37.0 37.0 37.0 37.0 37.0 45-49 35.82809999999999 37.0 37.0 37.0 37.0 37.0 50-54 35.8076 37.0 37.0 37.0 37.0 37.0 55-59 35.717499999999994 37.0 37.0 37.0 37.0 37.0 60-64 35.6919 37.0 37.0 37.0 37.0 37.0 65-69 35.7034 37.0 37.0 37.0 37.0 37.0 70-74 35.695299999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.7177 37.0 37.0 37.0 37.0 37.0 80-84 35.5811 37.0 37.0 37.0 37.0 37.0 85-89 35.534 37.0 37.0 37.0 37.0 37.0 90-94 35.56270000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.5207 37.0 37.0 37.0 37.0 37.0 100-104 35.4298 37.0 37.0 37.0 37.0 37.0 105-109 35.4073 37.0 37.0 37.0 37.0 37.0 110-114 35.475300000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.3574 37.0 37.0 37.0 37.0 37.0 120-124 35.4274 37.0 37.0 37.0 34.6 37.0 125-129 34.8979 37.0 37.0 37.0 25.0 37.0 130-134 35.315099999999994 37.0 37.0 37.0 32.2 37.0 135-139 35.0489 37.0 37.0 37.0 25.0 37.0 140-144 35.0869 37.0 37.0 37.0 27.4 37.0 145-149 35.010000000000005 37.0 37.0 37.0 25.0 37.0 150-151 34.73975 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 6.0 15 7.0 16 8.0 17 7.0 18 5.0 19 0.0 20 2.0 21 6.0 22 9.0 23 13.0 24 7.0 25 9.0 26 5.0 27 12.0 28 15.0 29 19.0 30 25.0 31 52.0 32 65.0 33 103.0 34 234.0 35 702.0 36 2466.0 37 219.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.574999999999996 21.525 11.625 27.275 2 27.625 26.625 29.799999999999997 15.950000000000001 3 23.325000000000003 27.55 30.825000000000003 18.3 4 23.95 35.0 22.375 18.675 5 27.224999999999998 35.475 21.475 15.825 6 21.5 39.900000000000006 21.475 17.125 7 19.825 22.825 37.25 20.1 8 20.625 27.425 28.050000000000004 23.9 9 23.5 26.55 27.450000000000003 22.5 10-14 24.015 29.485 25.44 21.060000000000002 15-19 24.4 28.62 27.384999999999998 19.595000000000002 20-24 23.515 28.265 27.185 21.035 25-29 24.02 29.09 26.755000000000003 20.135 30-34 24.099999999999998 27.99 27.11 20.8 35-39 23.78 27.97 28.09 20.16 40-44 22.985 28.075 27.455000000000002 21.485000000000003 45-49 23.474999999999998 28.68 27.51 20.335 50-54 23.635 28.285 26.950000000000003 21.13 55-59 23.45 27.6 27.72 21.23 60-64 23.06 28.43 27.455000000000002 21.055 65-69 23.43 27.815 27.42 21.335 70-74 23.32 28.199999999999996 27.46 21.02 75-79 22.595000000000002 28.315 27.97 21.12 80-84 23.1 27.839999999999996 27.595 21.465 85-89 23.48 27.944999999999997 27.42 21.154999999999998 90-94 24.19 27.99 27.49 20.330000000000002 95-99 23.935000000000002 28.325 26.995 20.745 100-104 24.14 27.584999999999997 27.544999999999998 20.73 105-109 24.23 27.839999999999996 27.650000000000002 20.28 110-114 24.3 28.16 27.245 20.294999999999998 115-119 24.185000000000002 27.955000000000002 27.400000000000002 20.46 120-124 24.985 28.694999999999997 26.275 20.044999999999998 125-129 24.77 28.560000000000002 26.83 19.84 130-134 25.615 27.785 26.615 19.985 135-139 25.775 27.815 26.685 19.725 140-144 26.77 27.894999999999996 26.590000000000003 18.745 145-149 26.590000000000003 28.144999999999996 26.345000000000002 18.92 150-151 27.175 27.3625 27.237499999999997 18.224999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 1.0 11 1.0 12 1.5 13 1.0 14 0.5 15 1.0 16 1.0 17 0.5 18 0.5 19 1.0 20 1.5 21 2.0 22 1.5 23 2.0 24 3.5 25 4.5 26 6.0 27 6.5 28 8.5 29 13.5 30 18.0 31 23.0 32 29.0 33 37.5 34 51.0 35 60.0 36 79.5 37 117.5 38 126.0 39 150.5 40 197.0 41 211.0 42 223.5 43 245.0 44 265.5 45 274.5 46 252.0 47 236.0 48 231.5 49 208.0 50 176.0 51 138.5 52 113.5 53 98.5 54 79.5 55 58.0 56 49.0 57 47.0 58 35.5 59 26.5 60 21.0 61 14.0 62 8.5 63 2.5 64 1.5 65 2.5 66 3.5 67 3.0 68 1.0 69 1.0 70 2.0 71 2.5 72 1.5 73 0.5 74 0.0 75 0.0 76 0.5 77 0.5 78 1.0 79 1.0 80 0.5 81 2.0 82 1.5 83 0.0 84 0.0 85 0.5 86 0.5 87 0.5 88 1.0 89 0.5 90 0.5 91 0.5 92 0.5 93 1.0 94 1.0 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.8 #Duplication Level Percentage of deduplicated Percentage of total 1 86.7132867132867 74.4 2 10.693473193473194 18.35 3 2.0396270396270397 5.25 4 0.49533799533799533 1.7000000000000002 5 0.029137529137529136 0.125 6 0.0 0.0 7 0.029137529137529136 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit GTGACACAAATCTTGGTTGTTTTTGTTAAATTGTTCAAAAAGTCACGAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.3125 0.0 0.0 0.0 0.0 82-83 0.36250000000000004 0.0 0.0 0.0 0.0 84-85 0.48750000000000004 0.0 0.0 0.0 0.0 86-87 0.6125 0.0 0.0 0.0 0.0 88-89 0.7749999999999999 0.0 0.0 0.0 0.0 90-91 1.0 0.0 0.0 0.0 0.0 92-93 1.2625 0.0 0.0 0.0 0.0 94-95 1.4625 0.0 0.0 0.0 0.0 96-97 1.7125 0.0 0.0 0.0 0.0 98-99 1.9375 0.0 0.0 0.0 0.0 100-101 2.0875 0.0 0.0 0.0 0.0 102-103 2.4 0.0 0.0 0.0 0.0 104-105 2.95 0.0 0.0 0.0 0.0 106-107 3.3 0.0 0.0 0.0 0.0 108-109 3.5875 0.0 0.0 0.0 0.0 110-111 4.0 0.0 0.0 0.0 0.0 112-113 4.625 0.0 0.0 0.0 0.0 114-115 5.0375 0.0 0.0 0.0 0.0 116-117 5.574999999999999 0.0 0.0 0.0 0.0 118-119 6.1875 0.0 0.0 0.0 0.0 120-121 6.9125 0.0 0.0 0.0 0.0 122-123 7.9 0.0 0.0 0.0 0.0 124-125 8.775 0.0 0.0 0.0 0.0 126-127 9.662500000000001 0.0 0.0 0.0 0.0 128-129 10.275 0.0 0.0 0.0 0.0 130-131 10.9625 0.0 0.0 0.0 0.0 132-133 11.6375 0.0 0.0 0.0 0.0 134-135 12.5125 0.0 0.0 0.0 0.0 136-137 13.3 0.0 0.0 0.0 0.0 138-139 13.975000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTGCAT 10 0.006830828 145.0 7 CACTGCA 10 0.006830828 145.0 6 AAAAAAA 25 4.977651E-4 29.0 130-134 AGATCGG 65 0.0076375785 13.384615 140-144 >>END_MODULE Read 1602668 spots for SRR28623262.sra Written 1602668 spots for SRR28623262.sra Read 1602668 spots for SRR28623262.sra Written 1602668 spots for SRR28623262.sra Read 1602668 spots for SRR28623262.sra Written 1602668 spots for SRR28623262.sra Read 1602668 spots for SRR28623262.sra Written 1602668 spots for SRR28623262.sra Read 1602668 spots for SRR28623262.sra Written 1602668 spots for SRR28623262.sra Read 1602668 spots for SRR28623262.sra Written 1602668 spots for SRR28623262.sra Read 1602668 spots for SRR28623262.sra Written 1602668 spots for SRR28623262.sra Read 1602671 spots for SRR28623262.sra Written 1602671 spots for SRR28623262.sra Read 1602668 spots for SRR28623262.sra Written 1602668 spots for SRR28623262.sra Read 1602668 spots for SRR28623262.sra Written 1602668 spots for SRR28623262.sra Read 1602668 spots for SRR28623262.sra Written 1602668 spots for SRR28623262.sra Read 1602668 spots for SRR28623262.sra Written 1602668 spots for SRR28623262.sra Read 1602668 spots for SRR28623262.sra Written 1602668 spots for SRR28623262.sra Read 1602668 spots for SRR28623262.sra Written 1602668 spots for SRR28623262.sra Read 1602668 spots for SRR28623262.sra Written 1602668 spots for SRR28623262.sra Read 1602668 spots for SRR28623262.sra Written 1602668 spots for SRR28623262.sra Read 1602668 spots for SRR28623262.sra Written 1602668 spots for SRR28623262.sra Read 1602668 spots for SRR28623262.sra Written 1602668 spots for SRR28623262.sra Read 1602668 spots for SRR28623262.sra Written 1602668 spots for SRR28623262.sra Read 1602668 spots for SRR28623262.sra Written 1602668 spots for SRR28623262.sra SRR ids: ['SRR28623262.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m_yhoghw SRR28623262.sra spots: 32053363 blocks: [[1, 1602668], [1602669, 3205336], [3205337, 4808004], [4808005, 6410672], [6410673, 8013340], [8013341, 9616008], [9616009, 11218676], [11218677, 12821344], [12821345, 14424012], [14424013, 16026680], [16026681, 17629348], [17629349, 19232016], [19232017, 20834684], [20834685, 22437352], [22437353, 24040020], [24040021, 25642688], [25642689, 27245356], [27245357, 28848024], [28848025, 30450692], [30450693, 32053363]] SRR28623262 file size 11835889 SRR28623262 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623262 SRR28623262_1.fastq SRR28623262_2.fastq Input file: SRR28623262_1.fastq Paired file: SRR28623262_2.fastq trimmed: SRR28623262-trimmed-pair1.fastq, SRR28623262-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:04:21 2025 >> started Tue Feb 11 12:04:59 2025 >> done (37.544s) 32053363 read pairs processed; of these: 20 ( 0.00%) short read pairs filtered out after trimming by size control 11025 ( 0.03%) empty read pairs filtered out after trimming by size control 32042318 (99.97%) read pairs available; of these: 5785041 (18.05%) trimmed read pairs available after processing 26257277 (81.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 8 0.00% 21 5 0.00% 22 6 0.00% 23 5 0.00% 24 11 0.00% 25 7 0.00% 26 8 0.00% 27 10 0.00% 28 4 0.00% 29 19 0.00% 30 10 0.00% 31 12 0.00% 32 10 0.00% 33 19 0.00% 34 23 0.00% 35 24 0.00% 36 30 0.00% 37 26 0.00% 38 35 0.00% 39 27 0.00% 40 33 0.00% 41 47 0.00% 42 61 0.00% 43 76 0.00% 44 76 0.00% 45 97 0.00% 46 97 0.00% 47 120 0.00% 48 132 0.00% 49 181 0.00% 50 166 0.00% 51 263 0.00% 52 282 0.00% 53 312 0.00% 54 340 0.00% 55 335 0.00% 56 384 0.00% 57 509 0.00% 58 573 0.00% 59 673 0.00% 60 777 0.00% 61 944 0.00% 62 1078 0.00% 63 1248 0.00% 64 1438 0.00% 65 1484 0.00% 66 1848 0.01% 67 2045 0.01% 68 2236 0.01% 69 2649 0.01% 70 3142 0.01% 71 3573 0.01% 72 4124 0.01% 73 4675 0.01% 74 5249 0.02% 75 5907 0.02% 76 6769 0.02% 77 7433 0.02% 78 8277 0.03% 79 9303 0.03% 80 10329 0.03% 81 11579 0.04% 82 13192 0.04% 83 14472 0.05% 84 16142 0.05% 85 18195 0.06% 86 19399 0.06% 87 21260 0.07% 88 22914 0.07% 89 24518 0.08% 90 26250 0.08% 91 28681 0.09% 92 30912 0.10% 93 33467 0.10% 94 35991 0.11% 95 39171 0.12% 96 41005 0.13% 97 43429 0.14% 98 44675 0.14% 99 47017 0.15% 100 49722 0.16% 101 51256 0.16% 102 54151 0.17% 103 56856 0.18% 104 58993 0.18% 105 61816 0.19% 106 64977 0.20% 107 67324 0.21% 108 69315 0.22% 109 72175 0.23% 110 72364 0.23% 111 75121 0.23% 112 76652 0.24% 113 78419 0.24% 114 81547 0.25% 115 84742 0.26% 116 87333 0.27% 117 90442 0.28% 118 91667 0.29% 119 93279 0.29% 120 95874 0.30% 121 96893 0.30% 122 97312 0.30% 123 100563 0.31% 124 103227 0.32% 125 104186 0.33% 126 107482 0.34% 127 109669 0.34% 128 111756 0.35% 129 113470 0.35% 130 114612 0.36% 131 115422 0.36% 132 116956 0.37% 133 119222 0.37% 134 119558 0.37% 135 120725 0.38% 136 123049 0.38% 137 124241 0.39% 138 126482 0.39% 139 128438 0.40% 140 129618 0.40% 141 130475 0.41% 142 131524 0.41% 143 131408 0.41% 144 133032 0.42% 145 133758 0.42% 146 133852 0.42% 147 136610 0.43% 148 137665 0.43% 149 137619 0.43% 150 140335 0.44% 151 26257277 81.95% 32042318 reads passed initial QC criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=11 prefix-density=0.76 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.16 sequence-density-rank=20 fanout-score=8.40 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=4.8 sequence=GCTCCAAGCATGGCCCACCTGGAATGGATGACTTCAAGCTCACGGTTCTTGGCAAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCAGCCGTAGTCACCAGGGAACTCACCAGTCAAGTAGGATGGGGGCTCACCAGAGAACGGGCCCAAGTATTTAACACGGTCTGGTCCGTACCATGGGCTCCCGGAGGGAACAGGCTTGGTGGTTTTCCTCATGGAGACACGGCCATTGCCCATGATCTCAGAGGAGGAGGGGTTGAGCTTCACCGCCTTTCCGGCTAGCGAAGGGGACGAGAGGGCCATTGTTGCTGCTGCCATTG criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=18 prefix-density=0.69 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=113.42 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=6.3 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACC SRR28623262 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:05:49 Started mapping on | Feb 11 12:05:49 Finished on | Feb 11 12:09:23 Mapping speed, Million of reads per hour | 539.03 Number of input reads | 32042318 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 29640334 Uniquely mapped reads % | 92.50% Average mapped length | 291.01 Number of splices: Total | 26833391 Number of splices: Annotated (sjdb) | 26264818 Number of splices: GT/AG | 26261167 Number of splices: GC/AG | 483934 Number of splices: AT/AC | 18052 Number of splices: Non-canonical | 70238 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.47 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 924530 % of reads mapped to multiple loci | 2.89% Number of reads mapped to too many loci | 236419 % of reads mapped to too many loci | 0.74% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.61% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1477454 1477454 1477454 N_multimapping 924530 924530 924530 N_noFeature 1033360 29277701 1193123 N_ambiguous 388835 1745 184837 UnstrandedReadsAssigned:28218139 PositiveStrandReadsAssigned:360888 NegativeStrandReadsAssigned:28262374 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623262 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623262-trimmed-pair1.fastq SRR28623262-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,042,318 reads, 28,954,801 reads pseudoaligned [quant] estimated average fragment length: 217.914 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,105 rounds 52401 SRR28623262.ke.tsv 34699 SRR28623262.se.tsv 87100 total ==> SRR28623262.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1801.09 701 14.1049 Potri.005G024800.1.v4.1 1035 818.086 129 5.71449 Potri.004G059700.1.v4.1 961 744.086 51 2.4839 Potri.007G009000.2.v4.1 1416 1199.09 2 0.0604459 Potri.003G141000.2.v4.1 2943 2726.09 808.857 10.7527 Potri.016G087400.1.v4.1 270 95.0862 1328.87 506.469 Potri.015G069301.1.v4.1 564 350.144 0 0 Potri.010G195200.1.v4.1 1773 1556.09 0 0 Potri.012G127500.1.v4.1 977 760.086 1060 50.5394 ==> SRR28623262.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 63 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 366 Potri.001G212900.v4.1 9 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR28623262 completed mapping pipeline successfully