Starting /dee2/code/volunteer_pipeline.sh SRR28623263 current disk space = 3050867425280 free memory = 1404551536 SRR28623263 SRAfilesize 6f2bf64a4811f8a68aae13c2f03c083d SRR28623263.sra SRR28623263.sra file validated SRR28623263 is paired end SRR28623263 is conventional basespace SRR28623263 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623263_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.50125 37.0 37.0 37.0 37.0 37.0 2 36.5105 37.0 37.0 37.0 37.0 37.0 3 36.598 37.0 37.0 37.0 37.0 37.0 4 36.653 37.0 37.0 37.0 37.0 37.0 5 36.665 37.0 37.0 37.0 37.0 37.0 6 36.624 37.0 37.0 37.0 37.0 37.0 7 36.584 37.0 37.0 37.0 37.0 37.0 8 36.5055 37.0 37.0 37.0 37.0 37.0 9 36.5905 37.0 37.0 37.0 37.0 37.0 10-14 36.5539 37.0 37.0 37.0 37.0 37.0 15-19 36.534800000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.541399999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.485299999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.4056 37.0 37.0 37.0 37.0 37.0 35-39 36.3869 37.0 37.0 37.0 37.0 37.0 40-44 36.3615 37.0 37.0 37.0 37.0 37.0 45-49 36.266999999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.194 37.0 37.0 37.0 37.0 37.0 55-59 36.1382 37.0 37.0 37.0 37.0 37.0 60-64 36.132400000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.090500000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.069900000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.18149999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.08 37.0 37.0 37.0 37.0 37.0 85-89 36.0298 37.0 37.0 37.0 37.0 37.0 90-94 36.01989999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.8972 37.0 37.0 37.0 37.0 37.0 100-104 36.0041 37.0 37.0 37.0 37.0 37.0 105-109 35.9919 37.0 37.0 37.0 37.0 37.0 110-114 35.886 37.0 37.0 37.0 37.0 37.0 115-119 35.9113 37.0 37.0 37.0 37.0 37.0 120-124 35.751999999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.7056 37.0 37.0 37.0 37.0 37.0 130-134 35.7642 37.0 37.0 37.0 37.0 37.0 135-139 35.6632 37.0 37.0 37.0 37.0 37.0 140-144 35.3559 37.0 37.0 37.0 34.6 37.0 145-149 35.226800000000004 37.0 37.0 37.0 34.6 37.0 150-151 34.939499999999995 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 1.0 23 3.0 24 2.0 25 3.0 26 11.0 27 14.0 28 19.0 29 27.0 30 33.0 31 46.0 32 75.0 33 89.0 34 136.0 35 364.0 36 2900.0 37 276.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.53543701477586 13.648885549711995 10.944152266466316 40.87152516904583 2 19.5 14.774999999999999 36.075 29.65 3 18.025 17.625 28.275 36.075 4 21.725 25.474999999999998 23.65 29.15 5 24.349999999999998 31.374999999999996 24.5 19.775000000000002 6 22.225 34.599999999999994 23.025000000000002 20.150000000000002 7 16.625 27.575 39.1 16.7 8 18.025 27.0 30.025000000000002 24.95 9 18.5 25.074999999999996 32.824999999999996 23.599999999999998 10-14 19.445 30.48 26.974999999999998 23.1 15-19 19.695 28.804999999999996 27.675 23.825 20-24 20.32 28.599999999999998 27.595 23.485 25-29 20.005 28.285 28.18 23.53 30-34 19.900000000000002 28.335 27.534999999999997 24.23 35-39 20.03 28.494999999999997 28.115000000000002 23.36 40-44 19.74 28.939999999999998 27.445000000000004 23.875 45-49 20.8 28.175 27.455000000000002 23.57 50-54 20.34 28.215 28.08 23.365 55-59 20.24 28.485 27.189999999999998 24.085 60-64 20.455000000000002 28.175 28.04 23.330000000000002 65-69 20.76 28.655 27.13 23.455000000000002 70-74 20.895 28.87 26.51 23.724999999999998 75-79 20.74 28.199999999999996 27.415 23.645 80-84 21.029999999999998 28.075 27.79 23.105 85-89 21.36 28.355000000000004 27.279999999999998 23.005 90-94 20.89 28.544999999999998 26.625 23.94 95-99 21.075 28.29 27.084999999999997 23.549999999999997 100-104 21.529999999999998 28.000000000000004 26.91 23.56 105-109 21.175 29.4 26.0 23.425 110-114 21.355 28.105000000000004 26.47 24.07 115-119 22.14 28.015 25.89 23.955000000000002 120-124 21.47 28.449999999999996 26.419999999999998 23.66 125-129 21.94 27.68 26.875 23.505000000000003 130-134 22.095000000000002 28.845 25.86 23.200000000000003 135-139 21.740000000000002 28.285 26.22 23.755000000000003 140-144 22.025 28.134999999999998 25.97 23.87 145-149 21.925 28.310000000000002 25.105 24.66 150-151 22.287499999999998 27.825 25.974999999999998 23.9125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 2.5 24 4.5 25 4.5 26 4.5 27 6.5 28 9.5 29 13.5 30 16.5 31 24.0 32 38.5 33 47.0 34 48.5 35 66.5 36 88.0 37 107.0 38 130.0 39 160.0 40 198.0 41 225.0 42 254.0 43 241.0 44 228.0 45 252.5 46 258.0 47 244.0 48 220.5 49 202.0 50 180.5 51 147.0 52 119.0 53 92.0 54 67.0 55 56.5 56 50.0 57 44.5 58 31.0 59 21.0 60 19.0 61 16.5 62 11.5 63 7.0 64 4.5 65 1.5 66 1.0 67 1.5 68 2.5 69 4.5 70 5.0 71 4.0 72 5.0 73 3.5 74 1.0 75 1.5 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.275 #Duplication Level Percentage of deduplicated Percentage of total 1 86.13309879800644 73.45 2 11.374963353855176 19.400000000000002 3 1.9642333626502493 5.025 4 0.4104368220463207 1.4000000000000001 5 0.05863383172090296 0.25 6 0.02931691586045148 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02931691586045148 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAAGAGCCAATCTCGGTT 13 0.325 TruSeq Adapter, Index 7 (97% over 37bp) CCTGCCCACTTTGCAGGACCTCCATAGATTATTAACTCTTAGCCGTACTT 6 0.15 No Hit GGTATCAAAGAGCTTTACAGTAAGTTCCTTGAGGGATTTCTTCTCATCCT 5 0.125 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACAAGAGCCAATCTCGGGT 5 0.125 TruSeq Adapter, Index 7 (97% over 37bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.525 0.0 0.0 0.0 0.0 88-89 0.65 0.0 0.0 0.0 0.0 90-91 0.8374999999999999 0.0 0.0 0.0 0.0 92-93 0.9874999999999999 0.0 0.0 0.0 0.0 94-95 1.1375000000000002 0.0 0.0 0.0 0.0 96-97 1.25 0.0 0.0 0.0 0.0 98-99 1.525 0.0 0.0 0.0 0.0 100-101 2.0125 0.0 0.0 0.0 0.0 102-103 2.475 0.0 0.0 0.0 0.0 104-105 2.7874999999999996 0.0 0.0 0.0 0.0 106-107 3.175 0.0 0.0 0.0 0.0 108-109 3.7 0.0 0.0 0.0 0.0 110-111 4.2875 0.0 0.0 0.0 0.0 112-113 4.824999999999999 0.0 0.0 0.0 0.0 114-115 5.35 0.0 0.0 0.0 0.0 116-117 5.7875 0.0 0.0 0.0 0.0 118-119 6.3 0.0 0.0 0.0 0.0 120-121 7.075 0.0 0.0 0.0 0.0 122-123 7.775 0.0 0.0 0.0 0.0 124-125 8.675 0.0 0.0 0.0 0.0 126-127 9.325 0.0 0.0 0.0 0.0 128-129 10.1 0.0 0.0 0.0 0.0 130-131 10.6375 0.0 0.0 0.0 0.0 132-133 11.55 0.0 0.0 0.0 0.0 134-135 12.25 0.0 0.0 0.0 0.0 136-137 12.9875 0.0 0.0 0.0 0.0 138-139 13.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATAAAAG 10 0.006830828 145.0 8 GAATAAA 10 0.006830828 145.0 6 AATAAAA 10 0.006830828 145.0 7 GGAATAA 10 0.006830828 145.0 5 >>END_MODULE SRR28623263 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623263_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.8985 37.0 37.0 37.0 37.0 37.0 2 36.36 37.0 37.0 37.0 37.0 37.0 3 36.3685 37.0 37.0 37.0 37.0 37.0 4 36.3155 37.0 37.0 37.0 37.0 37.0 5 36.459 37.0 37.0 37.0 37.0 37.0 6 36.374 37.0 37.0 37.0 37.0 37.0 7 36.3235 37.0 37.0 37.0 37.0 37.0 8 36.35 37.0 37.0 37.0 37.0 37.0 9 36.2425 37.0 37.0 37.0 37.0 37.0 10-14 36.214800000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.2134 37.0 37.0 37.0 37.0 37.0 20-24 36.171800000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.0783 37.0 37.0 37.0 37.0 37.0 30-34 35.9957 37.0 37.0 37.0 37.0 37.0 35-39 35.9688 37.0 37.0 37.0 37.0 37.0 40-44 35.9815 37.0 37.0 37.0 37.0 37.0 45-49 35.964299999999994 37.0 37.0 37.0 37.0 37.0 50-54 35.929899999999996 37.0 37.0 37.0 37.0 37.0 55-59 35.845600000000005 37.0 37.0 37.0 37.0 37.0 60-64 35.8047 37.0 37.0 37.0 37.0 37.0 65-69 35.8497 37.0 37.0 37.0 37.0 37.0 70-74 35.8487 37.0 37.0 37.0 37.0 37.0 75-79 35.8223 37.0 37.0 37.0 37.0 37.0 80-84 35.693 37.0 37.0 37.0 37.0 37.0 85-89 35.720800000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.8143 37.0 37.0 37.0 37.0 37.0 95-99 35.775800000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.7002 37.0 37.0 37.0 37.0 37.0 105-109 35.7154 37.0 37.0 37.0 37.0 37.0 110-114 35.793099999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.72410000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.6609 37.0 37.0 37.0 37.0 37.0 125-129 35.2274 37.0 37.0 37.0 32.2 37.0 130-134 35.546499999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.4347 37.0 37.0 37.0 34.6 37.0 140-144 35.428700000000006 37.0 37.0 37.0 37.0 37.0 145-149 35.34599999999999 37.0 37.0 37.0 34.6 37.0 150-151 35.085750000000004 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 2.0 15 2.0 16 2.0 17 3.0 18 1.0 19 1.0 20 2.0 21 7.0 22 7.0 23 15.0 24 14.0 25 16.0 26 12.0 27 10.0 28 13.0 29 19.0 30 33.0 31 30.0 32 48.0 33 87.0 34 168.0 35 571.0 36 2617.0 37 317.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.8 20.424999999999997 15.174999999999999 27.6 2 28.95 25.650000000000002 28.525 16.875 3 21.525 28.299999999999997 30.425 19.75 4 26.05 32.375 22.575 19.0 5 26.200000000000003 35.925000000000004 21.9 15.975 6 21.425 38.675 22.625 17.275 7 20.225 22.525000000000002 38.275 18.975 8 22.625 26.275 26.450000000000003 24.65 9 22.650000000000002 24.875 29.775000000000002 22.7 10-14 23.875 29.270000000000003 26.155 20.7 15-19 23.41 28.7 27.625 20.265 20-24 24.42 28.249999999999996 27.24 20.09 25-29 24.39 27.655 27.73 20.225 30-34 23.135 28.035 27.965 20.865000000000002 35-39 23.565 27.925 27.375 21.135 40-44 24.245 27.700000000000003 27.625 20.43 45-49 23.515 27.615000000000002 28.244999999999997 20.625 50-54 23.205000000000002 28.345 27.689999999999998 20.76 55-59 24.135 27.99 27.33 20.544999999999998 60-64 23.665 28.055000000000003 27.985 20.294999999999998 65-69 24.2 27.555000000000003 27.785 20.46 70-74 23.78 28.115000000000002 27.22 20.885 75-79 23.185 27.405 28.000000000000004 21.41 80-84 23.919999999999998 27.91 27.145000000000003 21.025 85-89 24.125 28.485 27.185 20.205000000000002 90-94 24.21 28.549999999999997 27.415 19.825 95-99 24.305 28.299999999999997 26.715 20.68 100-104 24.87 27.355 27.779999999999998 19.994999999999997 105-109 24.87 28.175 26.66 20.294999999999998 110-114 25.05 27.384999999999998 27.72 19.845 115-119 25.245 28.09 26.950000000000003 19.715 120-124 25.715 28.025 26.14 20.119999999999997 125-129 25.305 28.595 25.835 20.265 130-134 26.56 28.285 25.674999999999997 19.48 135-139 26.135 27.76 26.71 19.395 140-144 26.355 28.575 26.090000000000003 18.98 145-149 26.695 28.48 25.814999999999998 19.009999999999998 150-151 27.5875 29.349999999999998 25.474999999999998 17.5875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 1.0 6 2.0 7 1.0 8 0.5 9 0.5 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 1.0 19 1.0 20 1.5 21 4.5 22 6.0 23 3.5 24 3.0 25 2.5 26 2.0 27 3.5 28 3.5 29 9.0 30 16.0 31 23.0 32 30.0 33 42.5 34 57.0 35 73.5 36 83.5 37 101.5 38 137.0 39 171.0 40 200.0 41 228.0 42 247.5 43 246.5 44 242.0 45 247.5 46 264.5 47 255.0 48 208.0 49 193.5 50 174.5 51 126.5 52 101.5 53 82.0 54 78.5 55 71.0 56 49.5 57 41.0 58 31.5 59 26.5 60 24.0 61 17.0 62 11.0 63 5.0 64 2.5 65 1.0 66 0.5 67 1.0 68 1.0 69 0.5 70 1.0 71 1.0 72 1.0 73 0.5 74 0.5 75 1.0 76 0.5 77 0.5 78 0.5 79 1.5 80 2.5 81 1.0 82 0.0 83 0.0 84 2.0 85 3.0 86 1.0 87 0.5 88 1.5 89 1.0 90 1.0 91 1.5 92 1.0 93 0.5 94 1.0 95 1.0 96 2.0 97 3.0 98 1.0 99 0.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.65 #Duplication Level Percentage of deduplicated Percentage of total 1 86.42732049036778 74.02499999999999 2 11.150029188558085 19.1 3 1.926444833625219 4.95 4 0.3502626970227671 1.2 5 0.05837711617046118 0.25 6 0.05837711617046118 0.3 7 0.02918855808523059 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 6 0.15 No Hit GTTGCCGGCTCCCGTTGGATTGCTTCTGCTCCGCTGCGCATTAATCAAAA 6 0.15 No Hit GGTAGAGAGCAGATAAGATAGCAGACACAAATTGTTATTATAGGCTCTAT 5 0.125 No Hit CGCCTCAAGGCTTCATATCTTCGTTATGATCTCAACACTGTTATATCTGC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.525 0.0 0.0 0.0 0.0 88-89 0.65 0.0 0.0 0.0 0.0 90-91 0.8374999999999999 0.0 0.0 0.0 0.0 92-93 0.9874999999999999 0.0 0.0 0.0 0.0 94-95 1.1375000000000002 0.0 0.0 0.0 0.0 96-97 1.25 0.0 0.0 0.0 0.0 98-99 1.5375 0.0 0.0 0.0 0.0 100-101 2.0375 0.0 0.0 0.0 0.0 102-103 2.4875 0.0 0.0 0.0 0.0 104-105 2.8125 0.0 0.0 0.0 0.0 106-107 3.2 0.0 0.0 0.0 0.0 108-109 3.725 0.0 0.0 0.0 0.0 110-111 4.3625 0.0 0.0 0.0 0.0 112-113 4.925000000000001 0.0 0.0 0.0 0.0 114-115 5.45 0.0 0.0 0.0 0.0 116-117 5.887499999999999 0.0 0.0 0.0 0.0 118-119 6.4125 0.0 0.0 0.0 0.0 120-121 7.2 0.0 0.0 0.0 0.0 122-123 7.9 0.0 0.0 0.0 0.0 124-125 8.787500000000001 0.0 0.0 0.0 0.0 126-127 9.425 0.0 0.0 0.0 0.0 128-129 10.2 0.0 0.0 0.0 0.0 130-131 10.7375 0.0 0.0 0.0 0.0 132-133 11.6875 0.0 0.0 0.0 0.0 134-135 12.375 0.0 0.0 0.0 0.0 136-137 13.1375 0.0 0.0 0.0 0.0 138-139 13.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTTTT 10 0.006830828 145.0 8 TAACCTC 10 0.006830828 145.0 4 >>END_MODULE Read 991179 spots for SRR28623263.sra Written 991179 spots for SRR28623263.sra Read 991179 spots for SRR28623263.sra Written 991179 spots for SRR28623263.sra Read 991179 spots for SRR28623263.sra Written 991179 spots for SRR28623263.sra Read 991179 spots for SRR28623263.sra Written 991179 spots for SRR28623263.sra Read 991179 spots for SRR28623263.sra Written 991179 spots for SRR28623263.sra Read 991179 spots for SRR28623263.sra Written 991179 spots for SRR28623263.sra Read 991179 spots for SRR28623263.sra Written 991179 spots for SRR28623263.sra Read 991179 spots for SRR28623263.sra Written 991179 spots for SRR28623263.sra Read 991179 spots for SRR28623263.sra Written 991179 spots for SRR28623263.sra Read 991179 spots for SRR28623263.sra Written 991179 spots for SRR28623263.sra Read 991179 spots for SRR28623263.sra Written 991179 spots for SRR28623263.sra Read 991179 spots for SRR28623263.sra Written 991179 spots for SRR28623263.sra Read 991179 spots for SRR28623263.sra Written 991179 spots for SRR28623263.sra Read 991179 spots for SRR28623263.sra Written 991179 spots for SRR28623263.sra Read 991179 spots for SRR28623263.sra Written 991179 spots for SRR28623263.sra Read 991179 spots for SRR28623263.sra Written 991179 spots for SRR28623263.sra Read 991179 spots for SRR28623263.sra Written 991179 spots for SRR28623263.sra Read 991179 spots for SRR28623263.sra Written 991179 spots for SRR28623263.sra Read 991179 spots for SRR28623263.sra Written 991179 spots for SRR28623263.sra Read 991184 spots for SRR28623263.sra Written 991184 spots for SRR28623263.sra SRR ids: ['SRR28623263.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o_0yr0cf SRR28623263.sra spots: 19823585 blocks: [[1, 991179], [991180, 1982358], [1982359, 2973537], [2973538, 3964716], [3964717, 4955895], [4955896, 5947074], [5947075, 6938253], [6938254, 7929432], [7929433, 8920611], [8920612, 9911790], [9911791, 10902969], [10902970, 11894148], [11894149, 12885327], [12885328, 13876506], [13876507, 14867685], [14867686, 15858864], [15858865, 16850043], [16850044, 17841222], [17841223, 18832401], [18832402, 19823585]] SRR28623263 file size 7315851 SRR28623263 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623263 SRR28623263_1.fastq SRR28623263_2.fastq Input file: SRR28623263_1.fastq Paired file: SRR28623263_2.fastq trimmed: SRR28623263-trimmed-pair1.fastq, SRR28623263-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:27:09 2025 >> started Tue Feb 11 12:27:34 2025 >> done (24.842s) 19823585 read pairs processed; of these: 10 ( 0.00%) short read pairs filtered out after trimming by size control 83997 ( 0.42%) empty read pairs filtered out after trimming by size control 19739578 (99.58%) read pairs available; of these: 3655384 (18.52%) trimmed read pairs available after processing 16084194 (81.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 3 0.00% 21 6 0.00% 22 2 0.00% 23 4 0.00% 24 4 0.00% 25 5 0.00% 26 3 0.00% 27 3 0.00% 28 3 0.00% 29 4 0.00% 30 6 0.00% 31 12 0.00% 32 14 0.00% 33 11 0.00% 34 8 0.00% 35 10 0.00% 36 12 0.00% 37 11 0.00% 38 17 0.00% 39 17 0.00% 40 22 0.00% 41 29 0.00% 42 26 0.00% 43 32 0.00% 44 40 0.00% 45 40 0.00% 46 46 0.00% 47 62 0.00% 48 73 0.00% 49 85 0.00% 50 111 0.00% 51 112 0.00% 52 133 0.00% 53 158 0.00% 54 170 0.00% 55 212 0.00% 56 223 0.00% 57 225 0.00% 58 326 0.00% 59 367 0.00% 60 424 0.00% 61 475 0.00% 62 562 0.00% 63 674 0.00% 64 776 0.00% 65 861 0.00% 66 965 0.00% 67 1106 0.01% 68 1301 0.01% 69 1485 0.01% 70 1696 0.01% 71 1973 0.01% 72 2341 0.01% 73 2778 0.01% 74 3141 0.02% 75 3423 0.02% 76 3829 0.02% 77 4345 0.02% 78 4846 0.02% 79 5415 0.03% 80 6259 0.03% 81 7102 0.04% 82 7989 0.04% 83 8941 0.05% 84 10083 0.05% 85 11002 0.06% 86 12305 0.06% 87 13266 0.07% 88 14248 0.07% 89 14916 0.08% 90 16424 0.08% 91 17973 0.09% 92 18967 0.10% 93 21096 0.11% 94 22812 0.12% 95 24446 0.12% 96 26287 0.13% 97 27485 0.14% 98 28760 0.15% 99 29520 0.15% 100 31324 0.16% 101 32493 0.16% 102 34148 0.17% 103 36171 0.18% 104 38215 0.19% 105 39889 0.20% 106 41782 0.21% 107 43345 0.22% 108 44656 0.23% 109 45636 0.23% 110 46758 0.24% 111 47987 0.24% 112 49579 0.25% 113 50205 0.25% 114 52454 0.27% 115 54651 0.28% 116 56640 0.29% 117 57794 0.29% 118 59718 0.30% 119 60131 0.30% 120 61288 0.31% 121 62289 0.32% 122 63263 0.32% 123 64142 0.32% 124 65494 0.33% 125 66818 0.34% 126 69141 0.35% 127 69634 0.35% 128 71075 0.36% 129 71794 0.36% 130 73035 0.37% 131 72371 0.37% 132 73515 0.37% 133 74928 0.38% 134 74842 0.38% 135 75712 0.38% 136 77390 0.39% 137 78782 0.40% 138 79662 0.40% 139 81891 0.41% 140 80686 0.41% 141 81250 0.41% 142 82185 0.42% 143 81383 0.41% 144 83192 0.42% 145 83403 0.42% 146 83365 0.42% 147 84549 0.43% 148 86136 0.44% 149 86474 0.44% 150 87173 0.44% 151 16084194 81.48% 19739578 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=33 prefix-density=0.35 prefix-fanout=2.1 sequence=CACTTGCAGCCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=42 fanout-score=235.78 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=16.6 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=44 prefix-density=0.22 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=47 fanout-score=45.55 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=1.8 sequence=GGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCGTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGGCCTCTCTGCTGACCCAGAGACCTTTGCCAAGAACCGTGAGCTTGAAGTCATCCATTCCAGGTGGGCCATGCTTGGAGCTCTTGGATGCGTCTTCCCCGAGCTCTTGTCCCGCAACGGTGTCAAGTTCGGCGAGGCTGTATGGTTCAAGGCTGGAGCCCAGA SRR28623263 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:28:18 Started mapping on | Feb 11 12:28:18 Finished on | Feb 11 12:30:29 Mapping speed, Million of reads per hour | 542.46 Number of input reads | 19739578 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 18446554 Uniquely mapped reads % | 93.45% Average mapped length | 290.80 Number of splices: Total | 17432619 Number of splices: Annotated (sjdb) | 17030088 Number of splices: GT/AG | 17076982 Number of splices: GC/AG | 287114 Number of splices: AT/AC | 11992 Number of splices: Non-canonical | 56531 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.40 Insertion rate per base | 0.02% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 576658 % of reads mapped to multiple loci | 2.92% Number of reads mapped to too many loci | 151917 % of reads mapped to too many loci | 0.77% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.60% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 716366 716366 716366 N_multimapping 576658 576658 576658 N_noFeature 695447 18147789 805655 N_ambiguous 307918 1335 118481 UnstrandedReadsAssigned:17443189 PositiveStrandReadsAssigned:297430 NegativeStrandReadsAssigned:17522418 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623263 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623263-trimmed-pair1.fastq SRR28623263-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,739,578 reads, 17,729,932 reads pseudoaligned [quant] estimated average fragment length: 220.195 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,059 rounds 52401 SRR28623263.ke.tsv 34699 SRR28623263.se.tsv 87100 total ==> SRR28623263.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1798.81 704 20.042 Potri.005G024800.1.v4.1 1035 815.805 399 25.0461 Potri.004G059700.1.v4.1 961 741.832 8 0.552253 Potri.007G009000.2.v4.1 1416 1196.81 0 0 Potri.003G141000.2.v4.1 2943 2723.81 1024.69 19.265 Potri.016G087400.1.v4.1 270 95.9815 1267.9 676.472 Potri.015G069301.1.v4.1 564 348.981 0 0 Potri.010G195200.1.v4.1 1773 1553.81 40 1.31831 Potri.012G127500.1.v4.1 977 757.805 33 2.23003 ==> SRR28623263.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 578 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 241 Potri.001G212900.v4.1 91 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 9 SRR28623263 completed mapping pipeline successfully