Starting /dee2/code/volunteer_pipeline.sh SRR28623264 current disk space = 2824036548608 free memory = 1575675824 SRR28623264 SRAfilesize 5b8ad978d13b8f014f2dd0686da93d0e SRR28623264.sra SRR28623264.sra file validated SRR28623264 is paired end SRR28623264 is conventional basespace SRR28623264 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623264_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.43 37.0 37.0 37.0 37.0 37.0 2 36.408 37.0 37.0 37.0 37.0 37.0 3 36.488 37.0 37.0 37.0 37.0 37.0 4 36.665 37.0 37.0 37.0 37.0 37.0 5 36.716 37.0 37.0 37.0 37.0 37.0 6 36.6445 37.0 37.0 37.0 37.0 37.0 7 36.6125 37.0 37.0 37.0 37.0 37.0 8 36.395 37.0 37.0 37.0 37.0 37.0 9 36.5605 37.0 37.0 37.0 37.0 37.0 10-14 36.557 37.0 37.0 37.0 37.0 37.0 15-19 36.5068 37.0 37.0 37.0 37.0 37.0 20-24 36.503499999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.447500000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.43430000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.3495 37.0 37.0 37.0 37.0 37.0 40-44 36.308499999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.3336 37.0 37.0 37.0 37.0 37.0 50-54 36.282700000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.2412 37.0 37.0 37.0 37.0 37.0 60-64 36.224399999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.2868 37.0 37.0 37.0 37.0 37.0 70-74 36.1588 37.0 37.0 37.0 37.0 37.0 75-79 36.118700000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.0451 37.0 37.0 37.0 37.0 37.0 85-89 36.0355 37.0 37.0 37.0 37.0 37.0 90-94 36.003400000000006 37.0 37.0 37.0 37.0 37.0 95-99 35.83540000000001 37.0 37.0 37.0 37.0 37.0 100-104 35.935300000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.8965 37.0 37.0 37.0 37.0 37.0 110-114 35.8506 37.0 37.0 37.0 37.0 37.0 115-119 35.904 37.0 37.0 37.0 37.0 37.0 120-124 35.679700000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.6592 37.0 37.0 37.0 37.0 37.0 130-134 35.722899999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.5924 37.0 37.0 37.0 37.0 37.0 140-144 35.342499999999994 37.0 37.0 37.0 34.6 37.0 145-149 35.2089 37.0 37.0 37.0 32.2 37.0 150-151 35.10925 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 3.0 22 0.0 23 4.0 24 4.0 25 6.0 26 4.0 27 18.0 28 15.0 29 26.0 30 24.0 31 42.0 32 55.0 33 93.0 34 149.0 35 391.0 36 2896.0 37 269.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.397795591182366 14.40380761523046 8.366733466933868 40.831663326653306 2 19.650000000000002 14.299999999999999 36.05 30.0 3 18.125 17.45 28.000000000000004 36.425000000000004 4 22.45 25.35 24.875 27.325 5 23.674999999999997 34.325 23.525 18.475 6 21.05 34.975 24.375 19.6 7 15.7 28.025 39.15 17.125 8 17.0 27.250000000000004 31.474999999999998 24.275 9 18.625 25.2 34.449999999999996 21.725 10-14 19.064999999999998 31.19 27.400000000000002 22.345000000000002 15-19 20.22 28.044999999999998 27.560000000000002 24.175 20-24 19.785 29.395 27.63 23.189999999999998 25-29 19.855 28.68 28.07 23.395 30-34 19.32 29.425 27.58 23.674999999999997 35-39 19.54 29.205 27.435 23.82 40-44 19.605 28.51 28.1 23.785 45-49 19.445 29.265 27.279999999999998 24.01 50-54 19.555 28.999999999999996 28.27 23.175 55-59 19.54 28.994999999999997 28.1 23.365 60-64 20.24 28.849999999999998 27.584999999999997 23.325000000000003 65-69 20.235 28.794999999999998 27.73 23.24 70-74 20.200000000000003 28.65 27.6 23.549999999999997 75-79 20.105 28.585 27.634999999999998 23.674999999999997 80-84 20.74 28.12 27.87 23.27 85-89 20.05 28.58 27.85 23.52 90-94 20.69 27.99 27.52 23.799999999999997 95-99 20.315 28.785 27.779999999999998 23.119999999999997 100-104 20.035 28.255000000000003 28.144999999999996 23.565 105-109 20.325 28.115000000000002 27.685 23.875 110-114 20.369999999999997 28.865000000000002 26.755000000000003 24.01 115-119 20.51 29.509999999999998 26.655 23.325000000000003 120-124 20.474999999999998 28.975 26.950000000000003 23.599999999999998 125-129 20.549999999999997 28.144999999999996 26.810000000000002 24.495 130-134 20.560000000000002 28.665000000000003 27.01 23.765 135-139 20.06 28.689999999999998 26.71 24.54 140-144 20.845 28.470000000000002 26.25 24.435000000000002 145-149 20.794999999999998 28.994999999999997 26.3 23.91 150-151 20.424999999999997 27.500000000000004 27.5125 24.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 1.5 24 2.0 25 6.0 26 10.5 27 10.0 28 10.5 29 17.0 30 22.0 31 37.5 32 47.5 33 45.0 34 62.5 35 83.5 36 98.0 37 128.5 38 143.5 39 156.0 40 176.0 41 218.5 42 253.0 43 243.5 44 234.0 45 239.5 46 259.0 47 258.0 48 248.0 49 230.0 50 180.5 51 125.0 52 97.0 53 81.0 54 57.5 55 45.0 56 40.0 57 25.0 58 20.5 59 22.5 60 15.5 61 9.5 62 7.5 63 5.5 64 3.5 65 3.5 66 3.0 67 1.0 68 1.0 69 2.5 70 2.5 71 0.5 72 1.0 73 1.5 74 1.5 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.125 #Duplication Level Percentage of deduplicated Percentage of total 1 85.46255506607929 72.75 2 12.187958883994126 20.75 3 1.9383259911894273 4.95 4 0.2936857562408223 1.0 5 0.05873715124816446 0.25 6 0.05873715124816446 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTAAGCATGACTAAGGCACCAGGTGGGATCATCTCCCTGAGGGAGGCATC 6 0.15 No Hit GGGTGGAGCTAGATACTCGTCGACATGGATATGGAGGAACGTGCAAGCCA 6 0.15 No Hit GTCGAGAAAGAAGAGGAGAGTAGATAAATTATACTGGTTTTATTATATGC 5 0.125 No Hit CCAGAAGGCAGATAATATATATATTATAATCAAAATGTGCAATGTGTTCA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.07500000000000001 0.0 0.0 0.0 0.0 76-77 0.1625 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.30000000000000004 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.45 0.0 0.0 0.0 0.0 86-87 0.525 0.0 0.0 0.0 0.0 88-89 0.6125 0.0 0.0 0.0 0.0 90-91 0.7875 0.0 0.0 0.0 0.0 92-93 0.95 0.0 0.0 0.0 0.0 94-95 1.0375 0.0 0.0 0.0 0.0 96-97 1.35 0.0 0.0 0.0 0.0 98-99 1.55 0.0 0.0 0.0 0.0 100-101 1.8 0.0 0.0 0.0 0.0 102-103 2.075 0.0 0.0 0.0 0.0 104-105 2.3375 0.0 0.0 0.0 0.0 106-107 2.625 0.0 0.0 0.0 0.0 108-109 3.0625 0.0 0.0 0.0 0.0 110-111 3.675 0.0 0.0 0.0 0.0 112-113 4.125 0.0 0.0 0.0 0.0 114-115 4.699999999999999 0.0 0.0 0.0 0.0 116-117 5.0375 0.0 0.0 0.0 0.0 118-119 5.4 0.0 0.0 0.0 0.0 120-121 5.800000000000001 0.0 0.0 0.0 0.0 122-123 6.35 0.0 0.0 0.0 0.0 124-125 7.025 0.0 0.0 0.0 0.0 126-127 7.6 0.0 0.0 0.0 0.0 128-129 8.05 0.0 0.0 0.0 0.0 130-131 8.6 0.0 0.0 0.0 0.0 132-133 9.3375 0.0 0.0 0.0 0.0 134-135 9.775 0.0 0.0 0.0 0.0 136-137 10.3125 0.0 0.0 0.0 0.0 138-139 11.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR28623264 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623264_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.8425 37.0 37.0 37.0 37.0 37.0 2 36.1585 37.0 37.0 37.0 37.0 37.0 3 36.19 37.0 37.0 37.0 37.0 37.0 4 36.1835 37.0 37.0 37.0 37.0 37.0 5 36.3875 37.0 37.0 37.0 37.0 37.0 6 36.1085 37.0 37.0 37.0 37.0 37.0 7 36.257 37.0 37.0 37.0 37.0 37.0 8 36.194 37.0 37.0 37.0 37.0 37.0 9 36.2045 37.0 37.0 37.0 37.0 37.0 10-14 36.1548 37.0 37.0 37.0 37.0 37.0 15-19 36.102799999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.143100000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.1181 37.0 37.0 37.0 37.0 37.0 30-34 36.0146 37.0 37.0 37.0 37.0 37.0 35-39 36.0156 37.0 37.0 37.0 37.0 37.0 40-44 35.9502 37.0 37.0 37.0 37.0 37.0 45-49 35.9215 37.0 37.0 37.0 37.0 37.0 50-54 35.9053 37.0 37.0 37.0 37.0 37.0 55-59 35.7562 37.0 37.0 37.0 37.0 37.0 60-64 35.7932 37.0 37.0 37.0 37.0 37.0 65-69 35.832800000000006 37.0 37.0 37.0 37.0 37.0 70-74 35.8233 37.0 37.0 37.0 37.0 37.0 75-79 35.7825 37.0 37.0 37.0 37.0 37.0 80-84 35.6533 37.0 37.0 37.0 37.0 37.0 85-89 35.6614 37.0 37.0 37.0 37.0 37.0 90-94 35.5909 37.0 37.0 37.0 37.0 37.0 95-99 35.575300000000006 37.0 37.0 37.0 37.0 37.0 100-104 35.4251 37.0 37.0 37.0 37.0 37.0 105-109 35.5064 37.0 37.0 37.0 37.0 37.0 110-114 35.5495 37.0 37.0 37.0 37.0 37.0 115-119 35.4168 37.0 37.0 37.0 37.0 37.0 120-124 35.4045 37.0 37.0 37.0 37.0 37.0 125-129 35.018299999999996 37.0 37.0 37.0 27.4 37.0 130-134 35.284800000000004 37.0 37.0 37.0 32.2 37.0 135-139 35.048199999999994 37.0 37.0 37.0 25.0 37.0 140-144 35.1187 37.0 37.0 37.0 29.8 37.0 145-149 35.0566 37.0 37.0 37.0 27.4 37.0 150-151 34.7515 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 8.0 15 3.0 16 3.0 17 2.0 18 2.0 19 4.0 20 3.0 21 2.0 22 7.0 23 15.0 24 6.0 25 11.0 26 14.0 27 18.0 28 15.0 29 16.0 30 20.0 31 45.0 32 66.0 33 109.0 34 225.0 35 685.0 36 2485.0 37 234.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.725 20.599999999999998 12.65 25.025 2 28.9 24.8 28.925 17.375 3 22.650000000000002 29.625 30.125 17.599999999999998 4 25.0 34.825 22.375 17.8 5 25.474999999999998 34.925 22.6 17.0 6 20.150000000000002 39.975 22.0 17.875 7 21.45 23.150000000000002 36.925000000000004 18.475 8 20.474999999999998 26.1 29.575000000000003 23.849999999999998 9 24.425 24.325 28.849999999999998 22.400000000000002 10-14 23.86 30.55 25.314999999999998 20.275000000000002 15-19 23.785 28.355000000000004 27.575 20.285 20-24 23.815 29.18 26.395000000000003 20.61 25-29 23.405 29.020000000000003 26.865 20.71 30-34 23.09 28.985 27.58 20.345 35-39 23.565 28.965000000000003 27.355 20.115 40-44 23.435 28.73 27.255000000000003 20.580000000000002 45-49 22.735 28.615000000000002 28.28 20.369999999999997 50-54 22.765 28.205000000000002 28.560000000000002 20.47 55-59 23.53 28.799999999999997 27.534999999999997 20.135 60-64 22.785 28.42 27.529999999999998 21.265 65-69 22.869999999999997 28.925 28.15 20.055 70-74 23.595 27.72 27.875 20.810000000000002 75-79 23.085 28.060000000000002 27.91 20.945 80-84 23.794999999999998 27.994999999999997 27.839999999999996 20.369999999999997 85-89 23.305 28.765 27.565 20.365 90-94 23.805 27.805000000000003 28.410000000000004 19.98 95-99 24.33 28.09 27.29 20.29 100-104 23.64 27.500000000000004 27.98 20.880000000000003 105-109 24.415 28.22 27.12 20.244999999999997 110-114 24.385 28.035 26.924999999999997 20.655 115-119 25.415 28.29 26.905 19.39 120-124 25.180000000000003 28.64 26.36 19.82 125-129 25.130000000000003 28.494999999999997 27.045 19.33 130-134 24.965 28.244999999999997 26.840000000000003 19.950000000000003 135-139 25.724999999999998 28.084999999999997 26.86 19.33 140-144 25.46 28.685 27.150000000000002 18.705 145-149 25.900000000000002 28.360000000000003 26.674999999999997 19.064999999999998 150-151 26.55 28.3875 26.25 18.8125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 1.0 8 1.0 9 0.0 10 0.0 11 0.5 12 1.0 13 1.0 14 1.5 15 1.0 16 0.5 17 1.0 18 1.0 19 2.0 20 2.0 21 1.5 22 2.5 23 4.5 24 5.0 25 4.0 26 5.5 27 11.0 28 14.0 29 15.0 30 20.5 31 24.0 32 29.0 33 37.0 34 48.5 35 62.0 36 87.0 37 122.0 38 147.0 39 167.5 40 197.5 41 221.5 42 227.5 43 244.5 44 290.5 45 293.0 46 265.5 47 244.0 48 216.5 49 198.5 50 169.0 51 133.5 52 101.0 53 85.5 54 67.0 55 43.5 56 36.0 57 27.5 58 20.5 59 20.5 60 15.5 61 10.5 62 8.0 63 5.5 64 3.5 65 3.0 66 2.5 67 2.5 68 5.0 69 3.5 70 0.5 71 0.0 72 0.0 73 1.0 74 1.0 75 0.5 76 0.5 77 0.5 78 1.0 79 0.5 80 1.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.65 #Duplication Level Percentage of deduplicated Percentage of total 1 86.28137769994161 73.9 2 11.500291885580852 19.7 3 1.6929363689433743 4.35 4 0.43782837127845886 1.5 5 0.02918855808523059 0.125 6 0.02918855808523059 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02918855808523059 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 11 0.27499999999999997 No Hit TGAAGAGTGTAGGAAGTGCAGCACTCAAAATGGTCGAAGAGGTTCGTCGA 6 0.15 No Hit ACATGGGTGCCGCAGGTGAATTCAAAGCAACTGTAAAAAAGATGATAAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.07500000000000001 0.0 0.0 0.0 0.0 76-77 0.1625 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.425 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.5875 0.0 0.0 0.0 0.0 90-91 0.7625 0.0 0.0 0.0 0.0 92-93 0.925 0.0 0.0 0.0 0.0 94-95 1.0125 0.0 0.0 0.0 0.0 96-97 1.325 0.0 0.0 0.0 0.0 98-99 1.525 0.0 0.0 0.0 0.0 100-101 1.775 0.0 0.0 0.0 0.0 102-103 2.05 0.0 0.0 0.0 0.0 104-105 2.3125 0.0 0.0 0.0 0.0 106-107 2.5999999999999996 0.0 0.0 0.0 0.0 108-109 3.0625 0.0 0.0 0.0 0.0 110-111 3.725 0.0 0.0 0.0 0.0 112-113 4.175 0.0 0.0 0.0 0.0 114-115 4.75 0.0 0.0 0.0 0.0 116-117 5.125 0.0 0.0 0.0 0.0 118-119 5.512499999999999 0.0 0.0 0.0 0.0 120-121 5.925000000000001 0.0 0.0 0.0 0.0 122-123 6.475 0.0 0.0 0.0 0.0 124-125 7.1375 0.0 0.0 0.0 0.0 126-127 7.699999999999999 0.0 0.0 0.0 0.0 128-129 8.175 0.0 0.0 0.0 0.0 130-131 8.7375 0.0 0.0 0.0 0.0 132-133 9.45 0.0 0.0 0.0 0.0 134-135 9.8625 0.0 0.0 0.0 0.0 136-137 10.399999999999999 0.0 0.0 0.0 0.0 138-139 11.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATCACC 10 0.006830828 145.0 9 TCATGGA 10 0.006830828 145.0 3 CATGGAA 10 0.006830828 145.0 4 TCTCATC 10 0.006830828 145.0 6 >>END_MODULE Read 1685475 spots for SRR28623264.sra Written 1685475 spots for SRR28623264.sra Read 1685475 spots for SRR28623264.sra Written 1685475 spots for SRR28623264.sra Read 1685475 spots for SRR28623264.sra Written 1685475 spots for SRR28623264.sra Read 1685475 spots for SRR28623264.sra Written 1685475 spots for SRR28623264.sra Read 1685475 spots for SRR28623264.sra Written 1685475 spots for SRR28623264.sra Read 1685475 spots for SRR28623264.sra Written 1685475 spots for SRR28623264.sra Read 1685475 spots for SRR28623264.sra Written 1685475 spots for SRR28623264.sra Read 1685475 spots for SRR28623264.sra Written 1685475 spots for SRR28623264.sra Read 1685475 spots for SRR28623264.sra Written 1685475 spots for SRR28623264.sra Read 1685475 spots for SRR28623264.sra Written 1685475 spots for SRR28623264.sra Read 1685475 spots for SRR28623264.sra Written 1685475 spots for SRR28623264.sra Read 1685475 spots for SRR28623264.sra Written 1685475 spots for SRR28623264.sra Read 1685475 spots for SRR28623264.sra Written 1685475 spots for SRR28623264.sra Read 1685481 spots for SRR28623264.sra Written 1685481 spots for SRR28623264.sra Read 1685475 spots for SRR28623264.sra Written 1685475 spots for SRR28623264.sra Read 1685475 spots for SRR28623264.sra Written 1685475 spots for SRR28623264.sra Read 1685475 spots for SRR28623264.sra Written 1685475 spots for SRR28623264.sra Read 1685475 spots for SRR28623264.sra Written 1685475 spots for SRR28623264.sra Read 1685475 spots for SRR28623264.sra Written 1685475 spots for SRR28623264.sra Read 1685475 spots for SRR28623264.sra Written 1685475 spots for SRR28623264.sra SRR ids: ['SRR28623264.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_60q3150v SRR28623264.sra spots: 33709506 blocks: [[1, 1685475], [1685476, 3370950], [3370951, 5056425], [5056426, 6741900], [6741901, 8427375], [8427376, 10112850], [10112851, 11798325], [11798326, 13483800], [13483801, 15169275], [15169276, 16854750], [16854751, 18540225], [18540226, 20225700], [20225701, 21911175], [21911176, 23596650], [23596651, 25282125], [25282126, 26967600], [26967601, 28653075], [28653076, 30338550], [30338551, 32024025], [32024026, 33709506]] SRR28623264 file size 12448027 SRR28623264 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623264 SRR28623264_1.fastq SRR28623264_2.fastq Input file: SRR28623264_1.fastq Paired file: SRR28623264_2.fastq trimmed: SRR28623264-trimmed-pair1.fastq, SRR28623264-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Apr 10 12:47:30 2025 >> started Thu Apr 10 12:48:13 2025 >> done (42.730s) 33709506 read pairs processed; of these: 21 ( 0.00%) short read pairs filtered out after trimming by size control 25229 ( 0.07%) empty read pairs filtered out after trimming by size control 33684256 (99.93%) read pairs available; of these: 5006390 (14.86%) trimmed read pairs available after processing 28677866 (85.14%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 3 0.00% 21 3 0.00% 22 2 0.00% 23 4 0.00% 24 3 0.00% 25 7 0.00% 26 9 0.00% 27 4 0.00% 28 11 0.00% 29 12 0.00% 30 11 0.00% 31 19 0.00% 32 16 0.00% 33 19 0.00% 34 11 0.00% 35 14 0.00% 36 15 0.00% 37 21 0.00% 38 25 0.00% 39 35 0.00% 40 41 0.00% 41 50 0.00% 42 55 0.00% 43 57 0.00% 44 87 0.00% 45 73 0.00% 46 75 0.00% 47 103 0.00% 48 127 0.00% 49 151 0.00% 50 157 0.00% 51 195 0.00% 52 219 0.00% 53 261 0.00% 54 222 0.00% 55 303 0.00% 56 338 0.00% 57 390 0.00% 58 502 0.00% 59 501 0.00% 60 619 0.00% 61 713 0.00% 62 848 0.00% 63 999 0.00% 64 1078 0.00% 65 1156 0.00% 66 1310 0.00% 67 1576 0.00% 68 1734 0.01% 69 2044 0.01% 70 2388 0.01% 71 2755 0.01% 72 3209 0.01% 73 3627 0.01% 74 4102 0.01% 75 4709 0.01% 76 5186 0.02% 77 5826 0.02% 78 6631 0.02% 79 7190 0.02% 80 8095 0.02% 81 9089 0.03% 82 10416 0.03% 83 11525 0.03% 84 12918 0.04% 85 14267 0.04% 86 15637 0.05% 87 16891 0.05% 88 18670 0.06% 89 19626 0.06% 90 21203 0.06% 91 23530 0.07% 92 24998 0.07% 93 26783 0.08% 94 29045 0.09% 95 31405 0.09% 96 33577 0.10% 97 35205 0.10% 98 36679 0.11% 99 38896 0.12% 100 40378 0.12% 101 42241 0.13% 102 44629 0.13% 103 47530 0.14% 104 49456 0.15% 105 52096 0.15% 106 54444 0.16% 107 55954 0.17% 108 58490 0.17% 109 60365 0.18% 110 61748 0.18% 111 64315 0.19% 112 65651 0.19% 113 67175 0.20% 114 69696 0.21% 115 72776 0.22% 116 74108 0.22% 117 77016 0.23% 118 78766 0.23% 119 80703 0.24% 120 82409 0.24% 121 83863 0.25% 122 84332 0.25% 123 87560 0.26% 124 89456 0.27% 125 90534 0.27% 126 93708 0.28% 127 95840 0.28% 128 96212 0.29% 129 98104 0.29% 130 100830 0.30% 131 101240 0.30% 132 102563 0.30% 133 104552 0.31% 134 105428 0.31% 135 106755 0.32% 136 108474 0.32% 137 110823 0.33% 138 112451 0.33% 139 113748 0.34% 140 114232 0.34% 141 115651 0.34% 142 116983 0.35% 143 117808 0.35% 144 119625 0.36% 145 120556 0.36% 146 120701 0.36% 147 121942 0.36% 148 123284 0.37% 149 123495 0.37% 150 125381 0.37% 151 28677866 85.14% 33684256 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=42 prefix-density=0.12 prefix-fanout=2.0 sequence=TGCGACATGGTTGGCAAGAATCCTTCTGCGAATTTAGCAACAACCGAAGAATCAAGATACTCCTGCAAGCCCTCCAGATCATCAAAGGTAGTTTCAAAAGCATGAGTATATCCGAAATTGAGGTCGTGAATACCCAGATTAGTGCCCCAGTGTAAGCTCTTCAAGGGTTCAACTTGATTGACCAGATGAGTGAAGTCGTTTATGATTTTCTCAATTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=200.24 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=13.0 sequence=ACAACAACAAGAGGAGCGGGCCTAACCAGGCTAAAAACAGGGCAGTTAAACCAACATTAATACCACAACTATCTTAATTGCCACTGACTAGCAATAACAACACCCATTTCTAAAGAAAATATCTTATTCTGCAAATCTCAGACTCTTCTCCCTCGTTGTAAACAAGGAAGAGAAGTACTTGAGTTTGACATGTAGCAAATCAAAGTTTCTAGTGGTGCTTGTTTGCAACAGTGCACTGCTTTCTGATCTCACCCTTGGTACCGGTGAGTGGGTTGTTCTCAGAAAGAATGGTGATAGCCCTAGAAAACTCCTTAAAGAAGTAATCCTGACTCTTGGCCATTTTCTTCACGTAAGGCTTAGTTCTCTTGTCAGTGGCTAGTTGGTGATCCACTATCAACAAGCCCTTGTTGTCCAATATGTTTCTGTAGTAGTTGTTGTCTAGAACCATGGGTGTGCCTCTGTCATTCCTCACATATTGGACAGCTTTAGGGTCTGGGATTGAATCAGGGCA criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=11.66 fanout-score-rank=13 prefix-density=0.14 prefix-fanout=11.7 sequence=GAGAGAGAGAGTTAAGACAATGGCCTCGAAGAAATCTGCAATCGTATTACCTGGTTCAAAGGTGTTGAAGCACATAGTTTTTGTACGGTTTAATGATGGGATCACTGATGAACAAATTGAGAA criterion=fanout-score sequence-density=0.09 sequence-density-rank=10 fanout-score=326.50 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=30.6 sequence=AAGAAGAAGAAA SRR28623264 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 10 12:48:55 Started mapping on | Apr 10 12:48:55 Finished on | Apr 10 12:52:28 Mapping speed, Million of reads per hour | 569.31 Number of input reads | 33684256 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 31447255 Uniquely mapped reads % | 93.36% Average mapped length | 292.71 Number of splices: Total | 28579372 Number of splices: Annotated (sjdb) | 27860236 Number of splices: GT/AG | 28058159 Number of splices: GC/AG | 405532 Number of splices: AT/AC | 31382 Number of splices: Non-canonical | 84299 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 3.02 Insertion rate per base | 0.03% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 808354 % of reads mapped to multiple loci | 2.40% Number of reads mapped to too many loci | 277827 % of reads mapped to too many loci | 0.82% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.15% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1428647 1428647 1428647 N_multimapping 808354 808354 808354 N_noFeature 1432149 31060255 1623994 N_ambiguous 377742 2869 180582 UnstrandedReadsAssigned:29637364 PositiveStrandReadsAssigned:384131 NegativeStrandReadsAssigned:29642679 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623264 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623264-trimmed-pair1.fastq SRR28623264-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,684,256 reads, 30,084,466 reads pseudoaligned [quant] estimated average fragment length: 233.182 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,146 rounds 52401 SRR28623264.ke.tsv 34699 SRR28623264.se.tsv 87100 total ==> SRR28623264.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1785.82 1170 20.2467 Potri.005G024800.1.v4.1 1035 802.818 567 21.8258 Potri.004G059700.1.v4.1 961 728.828 488 20.6919 Potri.007G009000.2.v4.1 1416 1183.82 0 0 Potri.003G141000.2.v4.1 2943 2710.82 843.173 9.61216 Potri.016G087400.1.v4.1 270 91.5063 2586.53 873.516 Potri.015G069301.1.v4.1 564 338.108 0 0 Potri.010G195200.1.v4.1 1773 1540.82 49 0.982764 Potri.012G127500.1.v4.1 977 744.818 16956 703.522 ==> SRR28623264.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2725 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 599 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 52 Potri.001G452600.v4.1 10 SRR28623264 completed mapping pipeline successfully