Starting /dee2/code/volunteer_pipeline.sh SRR28623265 current disk space = 3050754224128 free memory = 1159883540 SRR28623265 SRAfilesize 605ab6cbb7afd218153c4aaf0441dd90 SRR28623265.sra SRR28623265.sra file validated SRR28623265 is paired end SRR28623265 is conventional basespace SRR28623265 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623265_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.28625 37.0 37.0 37.0 37.0 37.0 2 36.3455 37.0 37.0 37.0 37.0 37.0 3 36.584 37.0 37.0 37.0 37.0 37.0 4 36.658 37.0 37.0 37.0 37.0 37.0 5 36.696 37.0 37.0 37.0 37.0 37.0 6 36.608 37.0 37.0 37.0 37.0 37.0 7 36.668 37.0 37.0 37.0 37.0 37.0 8 36.49 37.0 37.0 37.0 37.0 37.0 9 36.6335 37.0 37.0 37.0 37.0 37.0 10-14 36.636 37.0 37.0 37.0 37.0 37.0 15-19 36.596999999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.5625 37.0 37.0 37.0 37.0 37.0 25-29 36.5145 37.0 37.0 37.0 37.0 37.0 30-34 36.5099 37.0 37.0 37.0 37.0 37.0 35-39 36.456100000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.4358 37.0 37.0 37.0 37.0 37.0 45-49 36.405199999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.4134 37.0 37.0 37.0 37.0 37.0 55-59 36.3108 37.0 37.0 37.0 37.0 37.0 60-64 36.3758 37.0 37.0 37.0 37.0 37.0 65-69 36.3412 37.0 37.0 37.0 37.0 37.0 70-74 36.2638 37.0 37.0 37.0 37.0 37.0 75-79 36.2839 37.0 37.0 37.0 37.0 37.0 80-84 36.16859999999999 37.0 37.0 37.0 37.0 37.0 85-89 36.173700000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.1432 37.0 37.0 37.0 37.0 37.0 95-99 36.027 37.0 37.0 37.0 37.0 37.0 100-104 36.0732 37.0 37.0 37.0 37.0 37.0 105-109 36.056400000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.975 37.0 37.0 37.0 37.0 37.0 115-119 35.9653 37.0 37.0 37.0 37.0 37.0 120-124 35.88850000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.797799999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.9101 37.0 37.0 37.0 37.0 37.0 135-139 35.7513 37.0 37.0 37.0 37.0 37.0 140-144 35.5615 37.0 37.0 37.0 37.0 37.0 145-149 35.5226 37.0 37.0 37.0 37.0 37.0 150-151 35.373999999999995 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 5.0 25 1.0 26 7.0 27 8.0 28 17.0 29 14.0 30 16.0 31 32.0 32 44.0 33 82.0 34 141.0 35 401.0 36 3001.0 37 231.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.837150767681855 12.383589227284169 9.035992952428895 39.743267052605084 2 18.925 13.775 37.25 30.049999999999997 3 18.825 16.775000000000002 28.425 35.975 4 22.0 27.0 25.05 25.95 5 25.124999999999996 31.2 23.674999999999997 20.0 6 22.025 34.225 22.925 20.825 7 14.799999999999999 26.724999999999998 40.65 17.825 8 19.225 26.900000000000002 31.624999999999996 22.25 9 18.099999999999998 23.95 35.699999999999996 22.25 10-14 19.985 29.615000000000002 27.875 22.525000000000002 15-19 20.05 27.825 28.325 23.799999999999997 20-24 20.39 28.875 27.42 23.315 25-29 20.24 28.775000000000002 27.544999999999998 23.44 30-34 20.28 28.96 27.589999999999996 23.169999999999998 35-39 20.255000000000003 28.32 27.735 23.69 40-44 20.555 28.544999999999998 27.685 23.215 45-49 20.605 28.025 27.515 23.855 50-54 20.285 28.575 27.595 23.544999999999998 55-59 20.305 28.565 27.6 23.53 60-64 20.325 28.470000000000002 27.275 23.93 65-69 20.59 28.645 27.334999999999997 23.43 70-74 20.885 28.08 28.015 23.02 75-79 20.84 28.935 26.995 23.23 80-84 20.695 28.660000000000004 27.02 23.625 85-89 21.145 27.939999999999998 27.61 23.305 90-94 21.465 27.96 27.58 22.994999999999997 95-99 20.27 28.675 26.875 24.18 100-104 20.830000000000002 28.754999999999995 26.855 23.56 105-109 21.065 28.235 27.29 23.41 110-114 20.885 28.73 27.175 23.21 115-119 20.875 28.725 26.375 24.025 120-124 21.29 28.634999999999998 26.525 23.549999999999997 125-129 21.69 28.23 26.534999999999997 23.544999999999998 130-134 21.13 27.735 27.37 23.765 135-139 20.979999999999997 27.150000000000002 27.250000000000004 24.62 140-144 21.065 27.644999999999996 27.215 24.075 145-149 21.61 27.83 27.21 23.35 150-151 21.099999999999998 27.35 27.1375 24.4125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 3.0 18 3.0 19 1.0 20 0.0 21 1.0 22 2.5 23 4.0 24 4.0 25 2.0 26 3.0 27 7.0 28 7.5 29 10.0 30 17.0 31 24.5 32 33.0 33 41.0 34 51.0 35 66.5 36 76.0 37 89.5 38 126.5 39 154.5 40 177.5 41 212.5 42 234.0 43 248.5 44 263.0 45 267.5 46 261.5 47 253.0 48 255.0 49 241.5 50 202.5 51 151.5 52 119.5 53 100.5 54 77.0 55 58.0 56 36.5 57 26.0 58 22.5 59 17.5 60 14.0 61 10.0 62 6.0 63 5.5 64 3.5 65 2.5 66 2.5 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.5 #Duplication Level Percentage of deduplicated Percentage of total 1 83.77245508982037 69.95 2 13.353293413173652 22.3 3 2.3353293413173652 5.8500000000000005 4 0.41916167664670656 1.4000000000000001 5 0.11976047904191617 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATGAGATGGCAGCTTCTGCTAGTGGTGCACTAACAACCATCGCTACAAGC 5 0.125 No Hit GCCGGTTCTATTGTAGAATCATCTGATGGATTGCAATAGGTGGCGATGGA 5 0.125 No Hit TTAGCAAGAACTTGATTCTCCTGTTGCTGCTGAAAGTTCAAAGGCCTCCT 5 0.125 No Hit GCCCAGATTAGCAAGCCAGTCTTACCCCCAGCATAGACATCGCCAGTTGG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.45 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.625 0.0 0.0 0.0 0.0 92-93 0.8375 0.0 0.0 0.0 0.0 94-95 1.0125000000000002 0.0 0.0 0.0 0.0 96-97 1.1625 0.0 0.0 0.0 0.0 98-99 1.35 0.0 0.0 0.0 0.0 100-101 1.525 0.0 0.0 0.0 0.0 102-103 1.6625 0.0 0.0 0.0 0.0 104-105 2.025 0.0 0.0 0.0 0.0 106-107 2.275 0.0 0.0 0.0 0.0 108-109 2.675 0.0 0.0 0.0 0.0 110-111 3.0 0.0 0.0 0.0 0.0 112-113 3.4125 0.0 0.0 0.0 0.0 114-115 3.8 0.0 0.0 0.0 0.0 116-117 4.2875 0.0 0.0 0.0 0.0 118-119 4.887499999999999 0.0 0.0 0.0 0.0 120-121 5.325 0.0 0.0 0.0 0.0 122-123 5.7375 0.0 0.0 0.0 0.0 124-125 6.2875 0.0 0.0 0.0 0.0 126-127 7.075 0.0 0.0 0.0 0.0 128-129 7.725 0.0 0.0 0.0 0.0 130-131 8.2625 0.0 0.0 0.0 0.0 132-133 8.5625 0.0 0.0 0.0 0.0 134-135 9.175 0.0 0.0 0.0 0.0 136-137 9.912500000000001 0.0 0.0 0.0 0.0 138-139 10.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTTCT 10 0.006830828 145.0 6 GATACGT 10 0.006830828 145.0 145 CCCACTT 10 0.006830828 145.0 2 GTCTGCA 10 0.006830828 145.0 1 ACTTTTC 10 0.006830828 145.0 5 CCCCACT 10 0.006830828 145.0 1 CCACTTT 30 0.0017973486 72.5 3 CTGAACT 30 0.0017973486 72.5 145 CGTCTGA 40 2.9585467E-4 21.75 140-144 GCACACG 45 6.5511256E-4 19.333332 135-139 ACGTCTG 40 0.0076550315 18.125 140-144 CACGTCT 40 0.0076550315 18.125 140-144 GATCGGA 65 0.0076375785 13.384615 125-129 GAAGAGC 65 0.0076375785 13.384615 130-134 >>END_MODULE SRR28623265 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623265_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.524 37.0 37.0 37.0 37.0 37.0 2 36.321 37.0 37.0 37.0 37.0 37.0 3 36.1795 37.0 37.0 37.0 37.0 37.0 4 36.181 37.0 37.0 37.0 37.0 37.0 5 36.3435 37.0 37.0 37.0 37.0 37.0 6 36.335 37.0 37.0 37.0 37.0 37.0 7 36.2615 37.0 37.0 37.0 37.0 37.0 8 36.1795 37.0 37.0 37.0 37.0 37.0 9 36.1195 37.0 37.0 37.0 37.0 37.0 10-14 36.1329 37.0 37.0 37.0 37.0 37.0 15-19 36.176100000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.1005 37.0 37.0 37.0 37.0 37.0 25-29 36.1269 37.0 37.0 37.0 37.0 37.0 30-34 35.974199999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.0024 37.0 37.0 37.0 37.0 37.0 40-44 35.9756 37.0 37.0 37.0 37.0 37.0 45-49 36.0296 37.0 37.0 37.0 37.0 37.0 50-54 35.9625 37.0 37.0 37.0 37.0 37.0 55-59 35.783699999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.7809 37.0 37.0 37.0 37.0 37.0 65-69 35.87429999999999 37.0 37.0 37.0 37.0 37.0 70-74 35.8757 37.0 37.0 37.0 37.0 37.0 75-79 35.851299999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.687400000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.6918 37.0 37.0 37.0 37.0 37.0 90-94 35.6224 37.0 37.0 37.0 37.0 37.0 95-99 35.652100000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.507000000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.5921 37.0 37.0 37.0 37.0 37.0 110-114 35.6332 37.0 37.0 37.0 37.0 37.0 115-119 35.573800000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.4992 37.0 37.0 37.0 34.6 37.0 125-129 34.993900000000004 37.0 37.0 37.0 32.2 37.0 130-134 35.3721 37.0 37.0 37.0 34.6 37.0 135-139 35.180099999999996 37.0 37.0 37.0 29.8 37.0 140-144 35.1982 37.0 37.0 37.0 29.8 37.0 145-149 35.122 37.0 37.0 37.0 27.4 37.0 150-151 34.81925 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 2.0 15 7.0 16 6.0 17 4.0 18 3.0 19 0.0 20 2.0 21 3.0 22 6.0 23 4.0 24 2.0 25 11.0 26 6.0 27 18.0 28 19.0 29 19.0 30 25.0 31 40.0 32 72.0 33 128.0 34 232.0 35 644.0 36 2506.0 37 240.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.075 21.5 11.225 26.200000000000003 2 26.05 26.674999999999997 31.7 15.575 3 21.775 28.349999999999998 30.125 19.75 4 24.15 33.85 22.375 19.625 5 25.124999999999996 37.225 22.425 15.225 6 21.075 40.1 21.75 17.075000000000003 7 21.3 22.925 37.85 17.925 8 21.349999999999998 26.900000000000002 27.025 24.725 9 22.225 26.05 28.849999999999998 22.875 10-14 23.465 29.425 26.229999999999997 20.880000000000003 15-19 23.155 29.005 27.105 20.735 20-24 22.759999999999998 28.7 27.265 21.275 25-29 22.814999999999998 28.355000000000004 27.87 20.96 30-34 22.96 28.02 27.72 21.3 35-39 22.25 28.549999999999997 27.994999999999997 21.205 40-44 22.925 27.97 27.36 21.745 45-49 22.61 28.015 28.235 21.14 50-54 22.7 28.405 27.46 21.435000000000002 55-59 22.86 27.565 28.015 21.560000000000002 60-64 22.74 27.265 28.46 21.535 65-69 23.155 28.050000000000004 27.76 21.035 70-74 22.41 27.855 28.1 21.634999999999998 75-79 22.884999999999998 27.49 28.139999999999997 21.485000000000003 80-84 23.385 28.095 27.67 20.849999999999998 85-89 23.35 28.415000000000003 27.134999999999998 21.099999999999998 90-94 23.365 27.77 27.500000000000004 21.365000000000002 95-99 23.400000000000002 28.4 27.36 20.84 100-104 23.46 27.875 28.144999999999996 20.52 105-109 23.49 27.810000000000002 27.92 20.78 110-114 23.385 28.645 27.200000000000003 20.77 115-119 23.715 28.825 27.18 20.28 120-124 24.33 28.095 27.134999999999998 20.44 125-129 24.42 28.689999999999998 26.685 20.205000000000002 130-134 24.82 28.435 26.71 20.035 135-139 25.235000000000003 28.815 26.205000000000002 19.744999999999997 140-144 25.115 28.470000000000002 26.66 19.755 145-149 25.47 27.72 26.700000000000003 20.11 150-151 26.125 28.1375 27.2625 18.475 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 1.0 9 1.0 10 0.5 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.5 17 2.0 18 3.0 19 1.5 20 0.5 21 0.5 22 0.0 23 2.5 24 6.0 25 4.5 26 3.5 27 5.5 28 12.5 29 16.5 30 14.5 31 20.0 32 23.0 33 34.0 34 49.5 35 70.0 36 93.5 37 111.5 38 129.0 39 148.0 40 183.5 41 220.5 42 228.0 43 232.0 44 265.5 45 285.5 46 271.5 47 248.0 48 234.5 49 214.0 50 180.5 51 148.0 52 120.0 53 101.5 54 83.0 55 64.0 56 43.5 57 29.5 58 23.5 59 17.0 60 10.5 61 6.5 62 5.0 63 4.0 64 3.5 65 2.5 66 3.0 67 1.5 68 0.0 69 1.5 70 3.5 71 2.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.92500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 84.45040214477211 70.875 2 12.749478701221328 21.4 3 2.1745606196008342 5.475 4 0.44682752457551383 1.5 5 0.17873100983020554 0.75 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGT 5 0.125 No Hit ATGAGATGTTGAAGAATGCTATTGAGCTCCAGCTCCCTAGTTATATGGAG 5 0.125 No Hit GTCAGATCCAGTACTCCGACAAGTATTTCGATGACACTTTTGAGTACAGG 5 0.125 No Hit CAGCAATAGCTAAGCCGCACCATCAGCTAAACAATGGCAGCAGCAACAAT 5 0.125 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 5 0.125 No Hit ATCCAGCACGTAAACAAGAAGATTCAGAGCTTACTTGTGTACTTCGTGAC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.45 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.625 0.0 0.0 0.0 0.0 92-93 0.8375 0.0 0.0 0.0 0.0 94-95 1.025 0.0 0.0 0.0 0.0 96-97 1.1875 0.0 0.0 0.0 0.0 98-99 1.375 0.0 0.0 0.0 0.0 100-101 1.575 0.0 0.0 0.0 0.0 102-103 1.7375 0.0 0.0 0.0 0.0 104-105 2.0999999999999996 0.0 0.0 0.0 0.0 106-107 2.35 0.0 0.0 0.0 0.0 108-109 2.75 0.0 0.0 0.0 0.0 110-111 3.0875 0.0 0.0 0.0 0.0 112-113 3.5125 0.0 0.0 0.0 0.0 114-115 3.9000000000000004 0.0 0.0 0.0 0.0 116-117 4.4 0.0 0.0 0.0 0.0 118-119 4.987500000000001 0.0 0.0 0.0 0.0 120-121 5.4125 0.0 0.0 0.0 0.0 122-123 5.7875 0.0 0.0 0.0 0.0 124-125 6.3375 0.0 0.0 0.0 0.0 126-127 7.1 0.0 0.0 0.0 0.0 128-129 7.737500000000001 0.0 0.0 0.0 0.0 130-131 8.275 0.0 0.0 0.0 0.0 132-133 8.5875 0.0 0.0 0.0 0.0 134-135 9.2 0.0 0.0 0.0 0.0 136-137 9.9375 0.0 0.0 0.0 0.0 138-139 10.600000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACTAG 10 0.006830828 145.0 8 GAAACTA 10 0.006830828 145.0 7 CTCTCTT 10 0.006830828 145.0 1 TAATGAA 10 0.006830828 145.0 5 ATAATGA 10 0.006830828 145.0 4 GTGGTGG 10 0.006830828 145.0 9 GGAAACT 10 0.006830828 145.0 6 TAGGGAA 35 0.0033124194 62.14286 145 GTGTAGG 45 6.5511256E-4 19.333332 140-144 GCGTCGT 45 6.5511256E-4 19.333332 135-139 >>END_MODULE Read 2293335 spots for SRR28623265.sra Written 2293335 spots for SRR28623265.sra Read 2293335 spots for SRR28623265.sra Written 2293335 spots for SRR28623265.sra Read 2293335 spots for SRR28623265.sra Written 2293335 spots for SRR28623265.sra Read 2293335 spots for SRR28623265.sra Written 2293335 spots for SRR28623265.sra Read 2293335 spots for SRR28623265.sra Written 2293335 spots for SRR28623265.sra Read 2293335 spots for SRR28623265.sra Written 2293335 spots for SRR28623265.sra Read 2293335 spots for SRR28623265.sra Written 2293335 spots for SRR28623265.sra Read 2293335 spots for SRR28623265.sra Written 2293335 spots for SRR28623265.sra Read 2293335 spots for SRR28623265.sra Written 2293335 spots for SRR28623265.sra Read 2293335 spots for SRR28623265.sra Written 2293335 spots for SRR28623265.sra Read 2293339 spots for SRR28623265.sra Written 2293339 spots for SRR28623265.sra Read 2293335 spots for SRR28623265.sra Written 2293335 spots for SRR28623265.sra Read 2293335 spots for SRR28623265.sra Written 2293335 spots for SRR28623265.sra Read 2293335 spots for SRR28623265.sra Written 2293335 spots for SRR28623265.sra Read 2293335 spots for SRR28623265.sra Written 2293335 spots for SRR28623265.sra Read 2293335 spots for SRR28623265.sra Written 2293335 spots for SRR28623265.sra Read 2293335 spots for SRR28623265.sra Written 2293335 spots for SRR28623265.sra Read 2293335 spots for SRR28623265.sra Written 2293335 spots for SRR28623265.sra Read 2293335 spots for SRR28623265.sra Written 2293335 spots for SRR28623265.sra Read 2293335 spots for SRR28623265.sra Written 2293335 spots for SRR28623265.sra SRR ids: ['SRR28623265.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9_48i423 SRR28623265.sra spots: 45866704 blocks: [[1, 2293335], [2293336, 4586670], [4586671, 6880005], [6880006, 9173340], [9173341, 11466675], [11466676, 13760010], [13760011, 16053345], [16053346, 18346680], [18346681, 20640015], [20640016, 22933350], [22933351, 25226685], [25226686, 27520020], [27520021, 29813355], [29813356, 32106690], [32106691, 34400025], [34400026, 36693360], [36693361, 38986695], [38986696, 41280030], [41280031, 43573365], [43573366, 45866704]] SRR28623265 file size 16941265 SRR28623265 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623265 SRR28623265_1.fastq SRR28623265_2.fastq Input file: SRR28623265_1.fastq Paired file: SRR28623265_2.fastq trimmed: SRR28623265-trimmed-pair1.fastq, SRR28623265-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:41:55 2025 >> started Tue Feb 11 12:42:54 2025 >> done (58.980s) 45866704 read pairs processed; of these: 24 ( 0.00%) short read pairs filtered out after trimming by size control 16009 ( 0.03%) empty read pairs filtered out after trimming by size control 45850671 (99.97%) read pairs available; of these: 6485838 (14.15%) trimmed read pairs available after processing 39364833 (85.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 6 0.00% 20 7 0.00% 21 7 0.00% 22 10 0.00% 23 7 0.00% 24 9 0.00% 25 11 0.00% 26 11 0.00% 27 14 0.00% 28 10 0.00% 29 22 0.00% 30 22 0.00% 31 25 0.00% 32 28 0.00% 33 18 0.00% 34 34 0.00% 35 25 0.00% 36 44 0.00% 37 51 0.00% 38 43 0.00% 39 51 0.00% 40 68 0.00% 41 59 0.00% 42 73 0.00% 43 79 0.00% 44 102 0.00% 45 91 0.00% 46 113 0.00% 47 120 0.00% 48 141 0.00% 49 160 0.00% 50 194 0.00% 51 224 0.00% 52 311 0.00% 53 292 0.00% 54 302 0.00% 55 353 0.00% 56 455 0.00% 57 498 0.00% 58 583 0.00% 59 589 0.00% 60 772 0.00% 61 872 0.00% 62 1023 0.00% 63 1143 0.00% 64 1357 0.00% 65 1484 0.00% 66 1626 0.00% 67 1858 0.00% 68 2163 0.00% 69 2343 0.01% 70 2778 0.01% 71 3226 0.01% 72 3838 0.01% 73 4262 0.01% 74 4916 0.01% 75 5530 0.01% 76 6285 0.01% 77 7034 0.02% 78 8108 0.02% 79 8880 0.02% 80 9900 0.02% 81 10883 0.02% 82 12641 0.03% 83 14030 0.03% 84 15599 0.03% 85 17591 0.04% 86 18973 0.04% 87 20538 0.04% 88 22914 0.05% 89 24115 0.05% 90 26407 0.06% 91 29096 0.06% 92 31145 0.07% 93 33530 0.07% 94 36413 0.08% 95 39457 0.09% 96 41378 0.09% 97 44205 0.10% 98 46266 0.10% 99 48904 0.11% 100 51691 0.11% 101 53724 0.12% 102 56279 0.12% 103 59574 0.13% 104 62438 0.14% 105 65437 0.14% 106 69032 0.15% 107 71474 0.16% 108 74037 0.16% 109 77125 0.17% 110 78509 0.17% 111 81187 0.18% 112 83827 0.18% 113 86592 0.19% 114 88908 0.19% 115 92494 0.20% 116 95456 0.21% 117 99071 0.22% 118 101774 0.22% 119 103607 0.23% 120 105737 0.23% 121 108708 0.24% 122 109768 0.24% 123 113698 0.25% 124 115715 0.25% 125 117397 0.26% 126 120466 0.26% 127 124715 0.27% 128 126779 0.28% 129 128383 0.28% 130 131471 0.29% 131 131906 0.29% 132 134132 0.29% 133 137197 0.30% 134 137323 0.30% 135 139854 0.31% 136 142829 0.31% 137 144542 0.32% 138 146362 0.32% 139 150736 0.33% 140 150318 0.33% 141 152381 0.33% 142 154010 0.34% 143 155410 0.34% 144 158316 0.35% 145 158979 0.35% 146 159685 0.35% 147 160921 0.35% 148 164370 0.36% 149 165497 0.36% 150 167245 0.36% 151 39364833 85.85% 45850671 reads passed initial QC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=20 prefix-density=0.72 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=70.72 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=2.0 sequence=TGAATGGTGCACATTACGGGTCCATGGCACAAAATCAGAGGATAACAATATCCATTCAAGACTATGCAACAATATAATTTGATTATCCTTAGAAAGTGCTTCTCCTTACACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=2.79 fanout-score-rank=13 prefix-density=1.14 prefix-fanout=1.9 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=33.85 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=2.4 sequence=ACAAAGAGAGCAGCATACATCCATAGAGAGAAAGAGAAGACATGGCAACCAGAACTCCAAAGCTTGTGAAGCACACATTGTTGACTCGGTTCAAGGATGAGATCACACGAGAACAAATCGACAACTACATTAATGACTATACCAATCTGCTCGATCTCATTCCAACCATGAAGAGTTTCAATTGGGGCACGGATTTGGGCATGGAGTCTGCGGAGCTAAACCGAGGATACACTCATGCCTTTGAATCTACATTTGAGAGCAAGTCAGGTTTGCAAGAGTACCTCGATTCTGCTGCTCTTGCTGCATTTGCAGAAGGATTTTTGCCTACTTTGTCACAGCGTCTTGTGATAGACTACTTTCTCTACTAAATGCTCAGGAGTAACGACTTCGGCCGGGCTATTTCATGGGAATAAAGTAATGTAATGTGCAATAAATGCTGGTTTTGAACCACTGAATGTTCGTGTCTTGATTTCTTGTTTGTGCTGTGCTATGTGAAGGGAGT SRR28623265 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:43:38 Started mapping on | Feb 11 12:43:38 Finished on | Feb 11 12:49:23 Mapping speed, Million of reads per hour | 478.44 Number of input reads | 45850671 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 43066831 Uniquely mapped reads % | 93.93% Average mapped length | 293.39 Number of splices: Total | 40944972 Number of splices: Annotated (sjdb) | 40098403 Number of splices: GT/AG | 40124411 Number of splices: GC/AG | 684972 Number of splices: AT/AC | 29916 Number of splices: Non-canonical | 105673 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 3.09 Insertion rate per base | 0.02% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1263738 % of reads mapped to multiple loci | 2.76% Number of reads mapped to too many loci | 156044 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.85% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1520102 1520102 1520102 N_multimapping 1263738 1263738 1263738 N_noFeature 1460005 42579330 1646570 N_ambiguous 554372 2814 251549 UnstrandedReadsAssigned:41052454 PositiveStrandReadsAssigned:484687 NegativeStrandReadsAssigned:41168712 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623265 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623265-trimmed-pair1.fastq SRR28623265-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 45,850,671 reads, 41,779,285 reads pseudoaligned [quant] estimated average fragment length: 237.419 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,228 rounds 52401 SRR28623265.ke.tsv 34699 SRR28623265.se.tsv 87100 total ==> SRR28623265.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1781.58 727 9.8688 Potri.005G024800.1.v4.1 1035 798.581 345 10.4481 Potri.004G059700.1.v4.1 961 724.593 121 4.03856 Potri.007G009000.2.v4.1 1416 1179.58 0 0 Potri.003G141000.2.v4.1 2943 2706.58 496 4.43196 Potri.016G087400.1.v4.1 270 90.6352 1665.1 444.303 Potri.015G069301.1.v4.1 564 334.762 0 0 Potri.010G195200.1.v4.1 1773 1536.58 1 0.0157391 Potri.012G127500.1.v4.1 977 740.581 6695 218.632 ==> SRR28623265.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 44 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 598 Potri.001G212900.v4.1 808 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 9 SRR28623265 completed mapping pipeline successfully