Starting /dee2/code/volunteer_pipeline.sh SRR28623266 current disk space = 3050340397056 free memory = 1580003544 SRR28623266 SRAfilesize 5af1e3b675eecfc6806688d185429a9a SRR28623266.sra SRR28623266.sra file validated SRR28623266 is paired end SRR28623266 is conventional basespace SRR28623266 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623266_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.44375 37.0 37.0 37.0 37.0 37.0 2 36.436 37.0 37.0 37.0 37.0 37.0 3 36.601 37.0 37.0 37.0 37.0 37.0 4 36.627 37.0 37.0 37.0 37.0 37.0 5 36.664 37.0 37.0 37.0 37.0 37.0 6 36.69 37.0 37.0 37.0 37.0 37.0 7 36.5705 37.0 37.0 37.0 37.0 37.0 8 36.4495 37.0 37.0 37.0 37.0 37.0 9 36.588 37.0 37.0 37.0 37.0 37.0 10-14 36.604200000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.5665 37.0 37.0 37.0 37.0 37.0 20-24 36.5049 37.0 37.0 37.0 37.0 37.0 25-29 36.5182 37.0 37.0 37.0 37.0 37.0 30-34 36.48530000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.4533 37.0 37.0 37.0 37.0 37.0 40-44 36.402 37.0 37.0 37.0 37.0 37.0 45-49 36.3447 37.0 37.0 37.0 37.0 37.0 50-54 36.3688 37.0 37.0 37.0 37.0 37.0 55-59 36.3196 37.0 37.0 37.0 37.0 37.0 60-64 36.2873 37.0 37.0 37.0 37.0 37.0 65-69 36.2966 37.0 37.0 37.0 37.0 37.0 70-74 36.1785 37.0 37.0 37.0 37.0 37.0 75-79 36.206500000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.088499999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.1863 37.0 37.0 37.0 37.0 37.0 90-94 36.0904 37.0 37.0 37.0 37.0 37.0 95-99 36.0032 37.0 37.0 37.0 37.0 37.0 100-104 36.0037 37.0 37.0 37.0 37.0 37.0 105-109 36.035199999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.9457 37.0 37.0 37.0 37.0 37.0 115-119 35.989799999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.816500000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.753 37.0 37.0 37.0 37.0 37.0 130-134 35.8654 37.0 37.0 37.0 37.0 37.0 135-139 35.650999999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.3349 37.0 37.0 37.0 34.6 37.0 145-149 35.2487 37.0 37.0 37.0 34.6 37.0 150-151 35.03675 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 1.0 25 4.0 26 6.0 27 5.0 28 15.0 29 19.0 30 34.0 31 30.0 32 61.0 33 100.0 34 159.0 35 360.0 36 2942.0 37 263.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.386756960120394 13.042387760220716 8.628041133684475 43.94281414597442 2 16.85 14.45 37.225 31.474999999999998 3 17.25 17.875 27.700000000000003 37.175000000000004 4 22.35 25.324999999999996 24.75 27.575 5 25.074999999999996 32.025 21.975 20.925 6 20.9 35.3 22.900000000000002 20.9 7 17.0 26.900000000000002 38.3 17.8 8 18.65 27.55 30.925000000000004 22.875 9 17.775 23.875 34.925 23.425 10-14 19.66 30.135 27.455000000000002 22.75 15-19 19.994999999999997 28.244999999999997 27.715 24.044999999999998 20-24 19.97 28.07 28.185 23.775 25-29 19.96 28.99 27.279999999999998 23.77 30-34 20.474999999999998 28.73 27.045 23.75 35-39 20.24 27.560000000000002 27.77 24.43 40-44 19.855 28.549999999999997 27.57 24.025 45-49 20.395 28.735 27.015 23.855 50-54 20.150000000000002 28.499999999999996 27.855 23.494999999999997 55-59 19.935 28.494999999999997 27.685 23.885 60-64 19.98 27.950000000000003 28.000000000000004 24.07 65-69 20.225 27.77 28.144999999999996 23.86 70-74 20.064999999999998 28.285 27.339999999999996 24.310000000000002 75-79 20.555 28.744999999999997 26.924999999999997 23.775 80-84 20.335 28.355000000000004 27.345000000000002 23.965 85-89 20.865000000000002 27.58 27.395000000000003 24.16 90-94 20.955 29.049999999999997 26.605 23.39 95-99 21.3 28.18 27.750000000000004 22.770000000000003 100-104 20.585 28.549999999999997 27.01 23.855 105-109 20.77 28.235 26.76 24.235 110-114 20.915 28.46 26.755000000000003 23.87 115-119 21.47 28.625 26.35 23.555 120-124 21.205 27.834999999999997 27.029999999999998 23.93 125-129 21.755 27.595 27.12 23.53 130-134 21.035 28.060000000000002 27.015 23.89 135-139 22.055 28.26 25.990000000000002 23.695 140-144 21.98 27.474999999999998 26.8 23.745 145-149 22.335 27.275 25.405 24.985 150-151 21.8875 28.775000000000002 25.412499999999998 23.925 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 2.0 24 3.5 25 4.5 26 4.5 27 7.0 28 11.5 29 12.5 30 17.5 31 28.5 32 35.0 33 56.5 34 69.0 35 73.5 36 87.5 37 97.0 38 118.0 39 164.0 40 196.0 41 195.0 42 203.5 43 221.0 44 231.5 45 231.5 46 257.0 47 269.5 48 236.0 49 211.5 50 178.5 51 155.0 52 133.5 53 99.0 54 90.0 55 70.5 56 49.0 57 46.0 58 40.5 59 33.5 60 23.0 61 13.5 62 10.0 63 5.5 64 1.0 65 0.5 66 0.5 67 0.0 68 0.5 69 0.5 70 1.0 71 1.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.4 #Duplication Level Percentage of deduplicated Percentage of total 1 87.72883295194508 76.67500000000001 2 10.240274599542335 17.9 3 1.9164759725400458 5.025 4 0.11441647597254005 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.42500000000000004 0.0 0.0 0.0 0.0 86-87 0.55 0.0 0.0 0.0 0.0 88-89 0.6375 0.0 0.0 0.0 0.0 90-91 0.8 0.0 0.0 0.0 0.0 92-93 1.0875 0.0 0.0 0.0 0.0 94-95 1.4125 0.0 0.0 0.0 0.0 96-97 1.6124999999999998 0.0 0.0 0.0 0.0 98-99 1.75 0.0 0.0 0.0 0.0 100-101 1.9125 0.0 0.0 0.0 0.0 102-103 2.1375 0.0 0.0 0.0 0.0 104-105 2.65 0.0 0.0 0.0 0.0 106-107 3.0875 0.0 0.0 0.0 0.0 108-109 3.4875 0.0 0.0 0.0 0.0 110-111 3.9375 0.0 0.0 0.0 0.0 112-113 4.4 0.0 0.0 0.0 0.0 114-115 4.7875 0.0 0.0 0.0 0.0 116-117 5.3625 0.0 0.0 0.0 0.0 118-119 5.9 0.0 0.0 0.0 0.0 120-121 6.4125 0.0 0.0 0.0 0.0 122-123 6.987500000000001 0.0 0.0 0.0 0.0 124-125 7.387499999999999 0.0 0.0 0.0 0.0 126-127 7.9125 0.0 0.0 0.0 0.0 128-129 8.75 0.0 0.0 0.0 0.0 130-131 9.524999999999999 0.0 0.0 0.0 0.0 132-133 10.35 0.0 0.0 0.0 0.0 134-135 10.8875 0.0 0.0 0.0 0.0 136-137 11.525 0.0 0.0 0.0 0.0 138-139 12.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAAAAC 10 0.006830828 145.0 2 GGAATTA 10 0.006830828 145.0 3 CTCCAGT 60 4.3742658E-4 48.333332 145 >>END_MODULE SRR28623266 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623266_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.982 37.0 37.0 37.0 37.0 37.0 2 36.1945 37.0 37.0 37.0 37.0 37.0 3 36.247 37.0 37.0 37.0 37.0 37.0 4 36.2195 37.0 37.0 37.0 37.0 37.0 5 36.345 37.0 37.0 37.0 37.0 37.0 6 36.2165 37.0 37.0 37.0 37.0 37.0 7 36.3115 37.0 37.0 37.0 37.0 37.0 8 36.2425 37.0 37.0 37.0 37.0 37.0 9 36.1265 37.0 37.0 37.0 37.0 37.0 10-14 36.1391 37.0 37.0 37.0 37.0 37.0 15-19 36.14150000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.1031 37.0 37.0 37.0 37.0 37.0 25-29 36.075 37.0 37.0 37.0 37.0 37.0 30-34 35.9859 37.0 37.0 37.0 37.0 37.0 35-39 36.0101 37.0 37.0 37.0 37.0 37.0 40-44 35.9922 37.0 37.0 37.0 37.0 37.0 45-49 35.9969 37.0 37.0 37.0 37.0 37.0 50-54 35.9352 37.0 37.0 37.0 37.0 37.0 55-59 35.8224 37.0 37.0 37.0 37.0 37.0 60-64 35.856700000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.8864 37.0 37.0 37.0 37.0 37.0 70-74 35.9054 37.0 37.0 37.0 37.0 37.0 75-79 35.8821 37.0 37.0 37.0 37.0 37.0 80-84 35.7436 37.0 37.0 37.0 37.0 37.0 85-89 35.72959999999999 37.0 37.0 37.0 37.0 37.0 90-94 35.686499999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.7051 37.0 37.0 37.0 37.0 37.0 100-104 35.584799999999994 37.0 37.0 37.0 37.0 37.0 105-109 35.5478 37.0 37.0 37.0 37.0 37.0 110-114 35.636100000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.5493 37.0 37.0 37.0 37.0 37.0 120-124 35.5256 37.0 37.0 37.0 37.0 37.0 125-129 35.1382 37.0 37.0 37.0 32.2 37.0 130-134 35.4129 37.0 37.0 37.0 37.0 37.0 135-139 35.275400000000005 37.0 37.0 37.0 34.6 37.0 140-144 35.26610000000001 37.0 37.0 37.0 34.6 37.0 145-149 35.2066 37.0 37.0 37.0 32.2 37.0 150-151 34.7975 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 5.0 14 11.0 15 4.0 16 3.0 17 1.0 18 5.0 19 2.0 20 3.0 21 3.0 22 4.0 23 11.0 24 12.0 25 10.0 26 14.0 27 12.0 28 11.0 29 15.0 30 24.0 31 28.0 32 47.0 33 99.0 34 204.0 35 573.0 36 2616.0 37 282.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.95 19.55 14.174999999999999 28.325 2 27.450000000000003 25.674999999999997 29.75 17.125 3 21.475 27.825 30.25 20.45 4 24.65 34.225 21.475 19.650000000000002 5 25.05 35.675000000000004 22.425 16.85 6 20.65 38.824999999999996 22.575 17.95 7 21.675 21.6 38.125 18.6 8 22.25 25.424999999999997 28.375 23.95 9 24.25 25.2 28.075 22.475 10-14 23.75 29.815 25.525 20.91 15-19 23.43 27.994999999999997 27.67 20.905 20-24 23.335 28.615000000000002 26.83 21.22 25-29 22.900000000000002 29.14 26.905 21.055 30-34 22.915 28.355000000000004 27.655 21.075 35-39 23.575 28.235 27.250000000000004 20.94 40-44 23.615 28.22 27.08 21.085 45-49 23.724999999999998 28.075 27.515 20.685000000000002 50-54 23.615 27.88 27.29 21.215 55-59 23.5 28.084999999999997 27.139999999999997 21.275 60-64 24.005000000000003 27.36 27.375 21.26 65-69 23.34 27.750000000000004 28.175 20.735 70-74 23.23 28.015 27.445000000000004 21.310000000000002 75-79 23.415 27.265 27.615000000000002 21.705 80-84 23.544999999999998 28.285 27.83 20.34 85-89 23.89 28.325 27.455000000000002 20.330000000000002 90-94 23.580000000000002 28.299999999999997 27.465 20.655 95-99 24.3 27.47 28.005000000000003 20.225 100-104 24.279999999999998 27.775 27.384999999999998 20.560000000000002 105-109 24.135 27.88 27.175 20.810000000000002 110-114 24.81 28.03 27.12 20.04 115-119 25.14 28.89 26.015 19.955000000000002 120-124 24.77 28.215 26.71 20.305 125-129 25.715 28.76 25.61 19.915 130-134 25.6 28.77 25.965 19.665 135-139 24.9 28.610000000000003 26.665 19.825 140-144 26.284999999999997 28.360000000000003 25.955000000000002 19.400000000000002 145-149 26.05 27.905 26.729999999999997 19.314999999999998 150-151 26.950000000000003 28.512500000000003 26.137500000000003 18.4 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 1.5 5 1.5 6 0.0 7 0.5 8 0.5 9 1.5 10 2.0 11 1.5 12 1.5 13 0.5 14 0.5 15 1.0 16 1.0 17 0.5 18 1.0 19 1.0 20 1.0 21 1.5 22 1.0 23 1.5 24 2.5 25 4.0 26 4.5 27 4.5 28 6.5 29 14.5 30 17.0 31 21.5 32 32.0 33 33.5 34 39.0 35 58.0 36 82.5 37 96.5 38 115.0 39 167.5 40 196.5 41 209.0 42 235.5 43 249.0 44 268.5 45 261.5 46 243.0 47 249.5 48 237.5 49 203.5 50 176.0 51 148.5 52 120.0 53 100.0 54 84.5 55 67.5 56 55.0 57 46.5 58 38.5 59 25.5 60 15.0 61 13.0 62 7.5 63 3.0 64 1.5 65 1.5 66 1.5 67 1.0 68 1.5 69 1.0 70 0.5 71 0.5 72 0.5 73 1.0 74 0.5 75 0.5 76 0.5 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 1.0 85 2.0 86 2.0 87 1.0 88 0.5 89 0.5 90 0.5 91 0.5 92 0.0 93 0.0 94 0.5 95 0.5 96 0.5 97 0.5 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.675 #Duplication Level Percentage of deduplicated Percentage of total 1 88.05246649558028 77.2 2 10.122611919019105 17.75 3 1.6253207869974338 4.275 4 0.1710863986313088 0.6 5 0.0 0.0 6 0.0 0.0 7 0.028514399771884805 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.525 0.0 0.0 0.0 0.0 88-89 0.6125 0.0 0.0 0.0 0.0 90-91 0.7749999999999999 0.0 0.0 0.0 0.0 92-93 1.0625 0.0 0.0 0.0 0.0 94-95 1.375 0.0 0.0 0.0 0.0 96-97 1.5625 0.0 0.0 0.0 0.0 98-99 1.7000000000000002 0.0 0.0 0.0 0.0 100-101 1.8624999999999998 0.0 0.0 0.0 0.0 102-103 2.1 0.0 0.0 0.0 0.0 104-105 2.625 0.0 0.0 0.0 0.0 106-107 3.0625 0.0 0.0 0.0 0.0 108-109 3.45 0.0 0.0 0.0 0.0 110-111 3.9124999999999996 0.0 0.0 0.0 0.0 112-113 4.375 0.0 0.0 0.0 0.0 114-115 4.775 0.0 0.0 0.0 0.0 116-117 5.4 0.0 0.0 0.0 0.0 118-119 5.925000000000001 0.0 0.0 0.0 0.0 120-121 6.4375 0.0 0.0 0.0 0.0 122-123 7.012499999999999 0.0 0.0 0.0 0.0 124-125 7.4125 0.0 0.0 0.0 0.0 126-127 7.9375 0.0 0.0 0.0 0.0 128-129 8.7375 0.0 0.0 0.0 0.0 130-131 9.475000000000001 0.0 0.0 0.0 0.0 132-133 10.3125 0.0 0.0 0.0 0.0 134-135 10.8625 0.0 0.0 0.0 0.0 136-137 11.45 0.0 0.0 0.0 0.0 138-139 12.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCGAAA 10 0.006830828 145.0 1 CCGAAAG 10 0.006830828 145.0 2 AAAGAGT 60 4.3742658E-4 48.333332 145 >>END_MODULE Read 1664741 spots for SRR28623266.sra Written 1664741 spots for SRR28623266.sra Read 1664741 spots for SRR28623266.sra Written 1664741 spots for SRR28623266.sra Read 1664741 spots for SRR28623266.sra Written 1664741 spots for SRR28623266.sra Read 1664741 spots for SRR28623266.sra Written 1664741 spots for SRR28623266.sra Read 1664741 spots for SRR28623266.sra Written 1664741 spots for SRR28623266.sra Read 1664741 spots for SRR28623266.sra Written 1664741 spots for SRR28623266.sra Read 1664741 spots for SRR28623266.sra Written 1664741 spots for SRR28623266.sra Read 1664741 spots for SRR28623266.sra Written 1664741 spots for SRR28623266.sra Read 1664741 spots for SRR28623266.sra Written 1664741 spots for SRR28623266.sra Read 1664741 spots for SRR28623266.sra Written 1664741 spots for SRR28623266.sra Read 1664741 spots for SRR28623266.sra Written 1664741 spots for SRR28623266.sra Read 1664741 spots for SRR28623266.sra Written 1664741 spots for SRR28623266.sra Read 1664741 spots for SRR28623266.sra Written 1664741 spots for SRR28623266.sra Read 1664741 spots for SRR28623266.sra Written 1664741 spots for SRR28623266.sra Read 1664741 spots for SRR28623266.sra Written 1664741 spots for SRR28623266.sra Read 1664741 spots for SRR28623266.sra Written 1664741 spots for SRR28623266.sra Read 1664741 spots for SRR28623266.sra Written 1664741 spots for SRR28623266.sra Read 1664741 spots for SRR28623266.sra Written 1664741 spots for SRR28623266.sra Read 1664758 spots for SRR28623266.sra Written 1664758 spots for SRR28623266.sra Read 1664741 spots for SRR28623266.sra Written 1664741 spots for SRR28623266.sra SRR ids: ['SRR28623266.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zlu8houh SRR28623266.sra spots: 33294837 blocks: [[1, 1664741], [1664742, 3329482], [3329483, 4994223], [4994224, 6658964], [6658965, 8323705], [8323706, 9988446], [9988447, 11653187], [11653188, 13317928], [13317929, 14982669], [14982670, 16647410], [16647411, 18312151], [18312152, 19976892], [19976893, 21641633], [21641634, 23306374], [23306375, 24971115], [24971116, 26635856], [26635857, 28300597], [28300598, 29965338], [29965339, 31630079], [31630080, 33294837]] SRR28623266 file size 12294762 SRR28623266 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623266 SRR28623266_1.fastq SRR28623266_2.fastq Input file: SRR28623266_1.fastq Paired file: SRR28623266_2.fastq trimmed: SRR28623266-trimmed-pair1.fastq, SRR28623266-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 13:27:58 2025 >> started Tue Feb 11 13:28:40 2025 >> done (41.685s) 33294837 read pairs processed; of these: 16 ( 0.00%) short read pairs filtered out after trimming by size control 35349 ( 0.11%) empty read pairs filtered out after trimming by size control 33259472 (99.89%) read pairs available; of these: 5580872 (16.78%) trimmed read pairs available after processing 27678600 (83.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 1 0.00% 21 0 0.00% 22 4 0.00% 23 3 0.00% 24 3 0.00% 25 5 0.00% 26 4 0.00% 27 9 0.00% 28 8 0.00% 29 5 0.00% 30 9 0.00% 31 4 0.00% 32 22 0.00% 33 18 0.00% 34 18 0.00% 35 15 0.00% 36 19 0.00% 37 25 0.00% 38 26 0.00% 39 42 0.00% 40 64 0.00% 41 49 0.00% 42 61 0.00% 43 65 0.00% 44 87 0.00% 45 78 0.00% 46 101 0.00% 47 111 0.00% 48 140 0.00% 49 175 0.00% 50 173 0.00% 51 217 0.00% 52 254 0.00% 53 294 0.00% 54 313 0.00% 55 386 0.00% 56 411 0.00% 57 447 0.00% 58 530 0.00% 59 653 0.00% 60 805 0.00% 61 939 0.00% 62 1051 0.00% 63 1169 0.00% 64 1372 0.00% 65 1612 0.00% 66 1796 0.01% 67 1967 0.01% 68 2288 0.01% 69 2667 0.01% 70 3088 0.01% 71 3483 0.01% 72 4018 0.01% 73 4655 0.01% 74 5182 0.02% 75 6087 0.02% 76 6788 0.02% 77 7380 0.02% 78 8335 0.03% 79 9482 0.03% 80 10160 0.03% 81 11490 0.03% 82 13049 0.04% 83 14489 0.04% 84 15909 0.05% 85 17578 0.05% 86 19185 0.06% 87 21006 0.06% 88 22444 0.07% 89 23765 0.07% 90 26239 0.08% 91 28184 0.08% 92 29714 0.09% 93 32274 0.10% 94 35071 0.11% 95 37489 0.11% 96 39690 0.12% 97 41670 0.13% 98 43774 0.13% 99 45975 0.14% 100 47973 0.14% 101 49565 0.15% 102 51994 0.16% 103 54555 0.16% 104 56324 0.17% 105 59637 0.18% 106 61940 0.19% 107 64037 0.19% 108 65964 0.20% 109 68257 0.21% 110 69383 0.21% 111 71735 0.22% 112 74022 0.22% 113 75631 0.23% 114 78059 0.23% 115 81446 0.24% 116 83558 0.25% 117 85845 0.26% 118 88330 0.27% 119 90174 0.27% 120 91584 0.28% 121 92746 0.28% 122 94485 0.28% 123 96827 0.29% 124 99299 0.30% 125 100283 0.30% 126 103152 0.31% 127 105817 0.32% 128 106457 0.32% 129 109349 0.33% 130 110978 0.33% 131 110938 0.33% 132 112134 0.34% 133 115506 0.35% 134 114376 0.34% 135 116619 0.35% 136 118572 0.36% 137 119667 0.36% 138 122124 0.37% 139 124401 0.37% 140 124150 0.37% 141 125952 0.38% 142 126481 0.38% 143 127463 0.38% 144 129512 0.39% 145 130203 0.39% 146 129890 0.39% 147 132050 0.40% 148 133339 0.40% 149 133925 0.40% 150 135994 0.41% 151 27678600 83.22% 33259472 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=20 prefix-density=0.55 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.21 sequence-density-rank=20 fanout-score=14.06 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=6.4 sequence=CCATCTTCTTCATCTATAGATTTCAATCACAACAG criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=24 prefix-density=0.52 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=88.05 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=3.2 sequence=CACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGT SRR28623266 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 13:29:23 Started mapping on | Feb 11 13:29:24 Finished on | Feb 11 13:32:50 Mapping speed, Million of reads per hour | 581.23 Number of input reads | 33259472 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 31181456 Uniquely mapped reads % | 93.75% Average mapped length | 291.68 Number of splices: Total | 29401775 Number of splices: Annotated (sjdb) | 28783782 Number of splices: GT/AG | 28736995 Number of splices: GC/AG | 560893 Number of splices: AT/AC | 21832 Number of splices: Non-canonical | 82055 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.51 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 807402 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 223620 % of reads mapped to too many loci | 0.67% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.89% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1270614 1270614 1270614 N_multimapping 807402 807402 807402 N_noFeature 1208306 30763296 1349857 N_ambiguous 490970 2363 212804 UnstrandedReadsAssigned:29482180 PositiveStrandReadsAssigned:415797 NegativeStrandReadsAssigned:29618795 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623266 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623266-trimmed-pair1.fastq SRR28623266-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,259,472 reads, 29,966,552 reads pseudoaligned [quant] estimated average fragment length: 225.845 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,105 rounds 52401 SRR28623266.ke.tsv 34699 SRR28623266.se.tsv 87100 total ==> SRR28623266.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.16 2098 35.5654 Potri.005G024800.1.v4.1 1035 810.155 932 34.9694 Potri.004G059700.1.v4.1 961 736.17 413 17.0535 Potri.007G009000.2.v4.1 1416 1191.16 0 0 Potri.003G141000.2.v4.1 2943 2718.16 1552.8 17.3653 Potri.016G087400.1.v4.1 270 94.0927 1715.19 554.112 Potri.015G069301.1.v4.1 564 344.594 0 0 Potri.010G195200.1.v4.1 1773 1548.16 24 0.471235 Potri.012G127500.1.v4.1 977 752.16 75 3.03104 ==> SRR28623266.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 267 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 452 Potri.001G212900.v4.1 163 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 54 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 34 SRR28623266 completed mapping pipeline successfully